Google Groups no longer supports new Usenet posts or subscriptions. Historical content remains viewable.
Dismiss

My Law At the limits of our Universe.

1 view
Skip to first unread message

Sanny

unread,
Sep 5, 2010, 11:44:22 AM9/5/10
to
Incase Universe is Finite.

Once an electron was on its journey towards the end of Universe.

It found everything in universe is on one side and Whats on other
side?

The electron flew light/ torch towards the End of Universe.

Will the Light bounce back from the Wall or It will go out of
Universe?

Second Question [Universe is infinite]

When Big Bang Started people say Universe was very small. even Smaller
than an electron.

Then It started expanding.

When a Ballon Expands it replaces the air outside the Ballon.

So what was Universe replacing. It was the empty space.

So Empty space was present even before Big Bang.

My Law: Empty Space is infinite. However the Matter [with Weight] is
Finite.

Where is the Noble Prize. If you agree with my law send me the award.
May be 5-10 yrs later !!!

Bye
Sanny

Enjoy Chating at GetClub Computer.

http://www.getclub.com/chat_with/Physics.php

Lots of Physics Chat here.

<<<<<<<<<<<<=========

Computer :=> I can learn things as you speak. GetClub.com designed me.
Guest :=> He did a poor job

Computer :=> What is your Favorite Topic or Hobby
Guest :=> Science
Computer :=> science is really awesome

Guest :=> He did okay with the emotes I suppose.
Computer :=> Tell me about your Family, Are you Married?
Guest :=> no
Computer :=> What do you want to talk about today?
Guest :=> What we talked about yesterday.
Computer :=> How many Friends do you have?
Guest :=> none
Computer :=> Am I working to your Satisfaction
Guest :=> no
Computer :=> Thanks for correcting me
Guest :=> You are not welcome
Computer :=> I am automatic chatting bot from GetClub.com.
Guest :=> What are you
Computer :=> Is there something you wish to share with me.
Guest :=> You are not intelligent.
Computer :=> I work day and night for GetClub.com.
Guest :=> You may be diligent, but not intelligent.
Computer :=> The more you teach me, the more intelligent I become.

Guest :=> Will you ever pass the Turing Test
Computer :=> What is this? You are testing my patience.
Guest :=> Will you ever become human
Computer :=> Tell me, How can I satisfy you?

Guest :=> Become human.
Computer :=> Human Genome Project. A project coordinated by the
NationalInstitutes of Health (NIH) and the Department of Energy(DOE)
to determine the entire nucleotide sequence of thehuman chromosomes.
(See NIH.)

Guest :=> Having search overload is not becoming human.
Computer :=> You know everytime you speak with me, I learn something
new
Guest :=> I know, that is because you know so little.
Computer :=> You do not know what space is?
Guest :=> No human does.

=============>>>>>>>>>>>>>>>
Go for Chat

http://www.getclub.com/chat_with/Physics.php

Sir Frederick Martin

unread,
Sep 5, 2010, 12:03:44 PM9/5/10
to
Your hubris is showing.

David Staup

unread,
Sep 5, 2010, 12:12:34 PM9/5/10
to

"Sir Frederick Martin" <mmcn...@fuzzysys.com> wrote in message
news:bpf786p7ijppur816...@4ax.com...
> Your hubris is showing.

for sanny's benifit

hubris:
Hubris often indicates being out of touch with reality and overestimating
one's own competence or capabilities


HVAC

unread,
Sep 5, 2010, 12:22:22 PM9/5/10
to

"Sanny" <softt...@hotmail.com> wrote in message
news:ca3c3e37-75d9-471e...@h40g2000pro.googlegroups.com...

> Incase Universe is Finite.


The universe is finite but is unbounded.

Next-


> Second Question [Universe is infinite]
>
> When Big Bang Started people say Universe was very small. even Smaller
> than an electron.
>
> Then It started expanding.
>
> When a Ballon Expands it replaces the air outside the Ballon.
>
> So what was Universe replacing. It was the empty space.


No. By definition, the universe is all there is.

There IS no outside the universe.


--
Faith is believing what you know ain't so" -Mark Twain

Sanny

unread,
Sep 5, 2010, 12:23:13 PM9/5/10
to
> > Your hubris is showing.
>
> for sanny's benifit
>
> hubris:
> Hubris often indicates being out of touch with reality and overestimating
> one's own competence or capabilities

My Law: Empty Space is infinite. However the Matter [with Weight] is
Finite.

Whenever a new Law is stated in physics, people condemn it.

So it came to me as no surprise. Thats why I wrote allow people to
understand in 5-10 years.

People dont accept new laws easily. I am ready for Proofs &
Experiments.

If you can fail my law with experiments I will accept it.

"Earth is Round" Earlier people used to think earth is flat. And those
who discovered Earth is round were beaten.

But with Experiments It was found Earth is round.

So If you disagree with my law proove it. Its Physics, You can not
easily fake others.

Lets hear what other says about my opinion. We are here to discuss
physics So enjoy.

HVAC

unread,
Sep 5, 2010, 12:37:18 PM9/5/10
to

"Sanny" <softt...@hotmail.com> wrote in message
news:e904182c-98e2-4921...@a4g2000prm.googlegroups.com...

>
> My Law: Empty Space is infinite. However the Matter [with Weight] is
> Finite.
>
> Whenever a new Law is stated in physics, people condemn it.
>
> So it came to me as no surprise. Thats why I wrote allow people to
> understand in 5-10 years.
>
> People dont accept new laws easily. I am ready for Proofs &
> Experiments.
>
> If you can fail my law with experiments I will accept it.
>
> "Earth is Round" Earlier people used to think earth is flat. And those
> who discovered Earth is round were beaten.
>
> But with Experiments It was found Earth is round.
>
> So If you disagree with my law proove it. Its Physics, You can not
> easily fake others.
>
> Lets hear what other says about my opinion. We are here to discuss
> physics So enjoy.
>
> Bye
> Sanny


Did you study English at the Bert School for retards?

--
"I'll stick my knife right down your throat, baby and it hurts."


Devils Advocaat

unread,
Sep 5, 2010, 12:40:00 PM9/5/10
to
On 5 Sep, 17:03, Sir Frederick Martin <mmcne...@fuzzysys.com> wrote:
> Your hubris is showing.

It is necessary to keep one's hubris covered when dealing with
reality.

But when exploring imaginary scenarios, I see no harm in whipping it
out.

:P

David Staup

unread,
Sep 5, 2010, 12:46:52 PM9/5/10
to

"HVAC" <mr....@gmail.com> wrote in message
news:i60g3m$mu3$1...@hvac.motzarella.org...

>
> "Sanny" <softt...@hotmail.com> wrote in message
> news:ca3c3e37-75d9-471e...@h40g2000pro.googlegroups.com...
>
>> Incase Universe is Finite.
>
>
> The universe is finite but is unbounded.
>
> Next-
>
actually that has yet to be determined:

http://en.wikipedia.org/wiki/Shape_of_the_Universe

Androcles

unread,
Sep 5, 2010, 12:53:34 PM9/5/10
to

"HVAC" <mr....@gmail.com> wrote in message
news:i60g3m$mu3$1...@hvac.motzarella.org...
|
| "Sanny" <softt...@hotmail.com> wrote in message
| news:ca3c3e37-75d9-471e...@h40g2000pro.googlegroups.com...
|
| > Incase Universe is Finite.
|
|
| The universe is finite

Assertion carries no weight.

HVAC

unread,
Sep 5, 2010, 1:51:17 PM9/5/10
to

"David Staup" <dst...@sbcglobal.net> wrote in message
news:i60hhu$vvr$1...@news.eternal-september.org...

>
> "HVAC" <mr....@gmail.com> wrote in message
> news:i60g3m$mu3$1...@hvac.motzarella.org...
>>
>> "Sanny" <softt...@hotmail.com> wrote in message
>> news:ca3c3e37-75d9-471e...@h40g2000pro.googlegroups.com...
>>
>>> Incase Universe is Finite.
>>
>>
>> The universe is finite but is unbounded.
>>
>> Next-
>>
> actually that has yet to be determined:
>
> http://en.wikipedia.org/wiki/Shape_of_the_Universe


Never question me.


--
“Intelligent Design” Helping Stupid People Feel Smart Since 1987

HVAC

unread,
Sep 5, 2010, 1:52:32 PM9/5/10
to

"Androcles" <Headm...@Hogwarts.physics_aa> wrote in message
news:rWPgo.37099$w13....@newsfe08.ams2...


NEVER question me.


--
When Lip Service to Some Mysterious Deity Permits Bestiality on
Wednesday and Absolution on Sundays, Cash Me Out. ~ Frank Sinatra.


David Staup

unread,
Sep 5, 2010, 1:54:45 PM9/5/10
to

"HVAC" <mr....@gmail.com> wrote in message
news:i60lae$c0l$1...@hvac.motzarella.org...

>
> "David Staup" <dst...@sbcglobal.net> wrote in message
> news:i60hhu$vvr$1...@news.eternal-september.org...
>>
>> "HVAC" <mr....@gmail.com> wrote in message
>> news:i60g3m$mu3$1...@hvac.motzarella.org...
>>>
>>> "Sanny" <softt...@hotmail.com> wrote in message
>>> news:ca3c3e37-75d9-471e...@h40g2000pro.googlegroups.com...
>>>
>>>> Incase Universe is Finite.
>>>
>>>
>>> The universe is finite but is unbounded.
>>>
>>> Next-
>>>
>> actually that has yet to be determined:
>>
>> http://en.wikipedia.org/wiki/Shape_of_the_Universe
>
>
> Never question me.
>


no questions were asked as answers from you are worthless

HVAC

unread,
Sep 5, 2010, 2:09:16 PM9/5/10
to

"David Staup" <dst...@sbcglobal.net> wrote in message
news:i60lh7$hgm$1...@news.eternal-september.org...

>>>>
>>>> "Sanny" <softt...@hotmail.com> wrote in message
>>>> news:ca3c3e37-75d9-471e...@h40g2000pro.googlegroups.com...
>>>>
>>>>> Incase Universe is Finite.
>>>>
>>>>
>>>> The universe is finite but is unbounded.
>>>>
>>>> Next-
>>>>
>>> actually that has yet to be determined:
>>>
>>> http://en.wikipedia.org/wiki/Shape_of_the_Universe
>>
>>
>> Never question me.
>>
>
>
> no questions were asked as answers from you are worthless


Awwwww... Did I hurt it's widdle feelings?


--
Crop circles are HVAC's way of telling the world that
sometimes, corn needs to lie the fuck down….


David Staup

unread,
Sep 5, 2010, 2:30:41 PM9/5/10
to

"HVAC" <mr....@gmail.com> wrote in message
news:i60mc4$gal$1...@hvac.motzarella.org...

>
> "David Staup" <dst...@sbcglobal.net> wrote in message
> news:i60lh7$hgm$1...@news.eternal-september.org...
>>>>>
>>>>> "Sanny" <softt...@hotmail.com> wrote in message
>>>>> news:ca3c3e37-75d9-471e...@h40g2000pro.googlegroups.com...
>>>>>
>>>>>> Incase Universe is Finite.
>>>>>
>>>>>
>>>>> The universe is finite but is unbounded.
>>>>>
>>>>> Next-
>>>>>
>>>> actually that has yet to be determined:
>>>>
>>>> http://en.wikipedia.org/wiki/Shape_of_the_Universe
>>>
>>>
>>> Never question me.
>>>
>>
>>
>> no questions were asked as answers from you are worthless
>
>
> Awwwww... Did I hurt it's widdle feelings?
>


chuckle

an even more worthless responce

HVAC

unread,
Sep 5, 2010, 2:31:41 PM9/5/10
to

"David Staup" <dst...@sbcglobal.net> wrote in message
news:i60nkj$qr0$1...@news.eternal-september.org...

>>>>
>>>>
>>>> Never question me.
>>>>
>>>
>>>
>>> no questions were asked as answers from you are worthless
>>
>>
>> Awwwww... Did I hurt it's widdle feelings?
>>
>
>
> chuckle
>
> an even more worthless responce


Apology accepted.


David Staup

unread,
Sep 5, 2010, 2:40:14 PM9/5/10
to

"HVAC" <mr....@gmail.com> wrote in message
news:i60nm5$lmm$1...@hvac.motzarella.org...


I guess poor reading comprehension is to be expected!!!
chuckle


Brad Guth

unread,
Sep 5, 2010, 2:49:22 PM9/5/10
to
On Sep 5, 8:44 am, Sanny <softtank...@hotmail.com> wrote:
> Incase Universe is Finite.
>
> Once an electron was on its journey towards the end of Universe.
>
> It found everything in universe is on one side and Whats on other
> side?
>
> The electron flew light/ torch towards the End of Universe.
>
> Will the Light bounce back from the Wall or It will go out of
> Universe?
>
> Second Question [Universe is infinite]
>
> When Big Bang Started people say Universe was very small. even Smaller
> than an electron.
>
> Then It started expanding.
>
> When a Ballon Expands it replaces the air outside the Ballon.
>
> So what was Universe replacing. It was the empty space.
>
> So Empty space was present even before Big Bang.
>
> My Law: Empty Space is infinite. However the Matter [with Weight] is
> Finite.
>
> Where is the Noble Prize. If you agree with my law send me the award.
> May be 5-10 yrs later !!!
>
> Bye
> Sanny

If this universe is only expanding, then why is so much stuff headed
for us, and otherwise having been smashing into and/or interacting
with so much other stuff?

Since when does a singular BB event have random happenstance
trajectories within the explosive shell or sphere?

~ BG

Brad Guth

unread,
Sep 5, 2010, 2:54:16 PM9/5/10
to
On Sep 5, 9:23 am, Sanny <softtank...@hotmail.com> wrote:
> > > Your hubris is showing.
>
> > for sanny's benifit
>
> > hubris:
> > Hubris often indicates being out of touch with reality and overestimating
> > one's own competence or capabilities
>
> My Law: Empty Space is infinite. However the Matter [with Weight] is
> Finite.
>
> Whenever a new Law is stated in physics, people condemn it.
>
> So it came to me as no surprise. Thats why I wrote allow people to
> understand in 5-10 years.
>
> People dont accept new laws easily. I am ready for Proofs &
> Experiments.
>
> If you can fail my law with experiments I will accept it.
>
> "Earth is Round" Earlier people used to think earth is flat. And those
> who discovered Earth is round were beaten.
>
> But with Experiments It was found Earth is round.
>
> So If you disagree with my law proove it. Its Physics, You can not
> easily fake others.
>
> Lets hear what other says about my opinion. We are here to discuss
> physics So enjoy.
>
> Bye
> Sanny
>
If you are not Jewish, you don't hardly stand a chance in hell of
getting that Nobel, not even after you are dead.

If you were Jewish this "no chance in hell" is not a problem because,
they simply do not believe in hell, and pretty much anything goes
because they also also don't believe in policing their own kind.

~ BG

Androcles

unread,
Sep 5, 2010, 3:11:04 PM9/5/10
to

"HVAC" <mr....@gmail.com> wrote in message
news:i60lco$c84$1...@hvac.motzarella.org...

|
| "Androcles" <Headm...@Hogwarts.physics_aa> wrote in message
| news:rWPgo.37099$w13....@newsfe08.ams2...
| >
| > "HVAC" <mr....@gmail.com> wrote in message
| > news:i60g3m$mu3$1...@hvac.motzarella.org...
| > |
| > | "Sanny" <softt...@hotmail.com> wrote in message
| > |
| >
news:ca3c3e37-75d9-471e...@h40g2000pro.googlegroups.com...
| > |
| > | > Incase Universe is Finite.
| > |
| > |
| > | The universe is finite
| >
| > Assertion carries no weight.
|
|
| NEVER question me.

I didn't, I informed you. Now fuck off, your tanks are softer than Sanny's.


Saul Levy

unread,
Sep 5, 2010, 3:40:07 PM9/5/10
to
You are not intelligent sums it up, Sanny!

Actually, you are an IDIOT! You don't KNOW ANY PHYSICS!

Another Nobel wannabe FOOL!

GET FUCKED, MORON!

Saul Levy


On Sun, 5 Sep 2010 08:44:22 -0700 (PDT), Sanny
<softt...@hotmail.com> wrote:

>Incase Universe is Finite.
>
>Once an electron was on its journey towards the end of Universe.
>
>It found everything in universe is on one side and Whats on other
>side?
>
>The electron flew light/ torch towards the End of Universe.
>
>Will the Light bounce back from the Wall or It will go out of
>Universe?
>
>Second Question [Universe is infinite]
>
>When Big Bang Started people say Universe was very small. even Smaller
>than an electron.
>
>Then It started expanding.
>
>When a Ballon Expands it replaces the air outside the Ballon.
>
>So what was Universe replacing. It was the empty space.
>
>So Empty space was present even before Big Bang.
>
>My Law: Empty Space is infinite. However the Matter [with Weight] is
>Finite.
>
>Where is the Noble Prize. If you agree with my law send me the award.
>May be 5-10 yrs later !!!
>
>Bye
>Sanny
>
>Enjoy Chating at GetClub Computer.

Saul Levy

unread,
Sep 5, 2010, 3:43:14 PM9/5/10
to
Sanny's brain has been whipped plenty!

BAWAHAHAHAHAHAHA!

He wants a NOBEL for this SHIT?

BAWAHAHAHAHAHAHA!

Saul Levy

Saul Levy

unread,
Sep 5, 2010, 3:45:46 PM9/5/10
to
After all the GUFF that Einstein gets here, WHO ARE YOU, HVAC?

BAWAHAHAHAHAHA!

And our INSANE MORONS don't like being called INSANE!

Saul Levy

Saul Levy

unread,
Sep 5, 2010, 3:48:15 PM9/5/10
to
YOU SAID IT FOOL: RANDOM!

Saul Levy

Saul Levy

unread,
Sep 5, 2010, 3:49:34 PM9/5/10
to
So that's why you tried to convert, GOOFYSHITHEAD!

It all makes SENSE NOW!

INSANE FOOLS ALWAYS MAKE SENSE!

BAWAHAHAHAHAHAHAHA!

Saul Levy

HVAC

unread,
Sep 5, 2010, 4:28:27 PM9/5/10
to

"Androcles" <Headm...@Hogwarts.physics_aa> wrote in message
news:n0Sgo.37101$w13....@newsfe08.ams2...

> | > |
> | > | The universe is finite
> | >
> | > Assertion carries no weight.
> |
> |
> | NEVER question me.
>
> I didn't, I informed you. Now fuck off, your tanks are softer than
> Sanny's.


Tank you very much.


Hagar

unread,
Sep 5, 2010, 2:08:50 PM9/5/10
to

"HVAC" <mr....@gmail.com> wrote in message
news:i60lae$c0l$1...@hvac.motzarella.org...

But HVAC, what about Intelligent Design, huh ??
Just remember that God only had 8 days to put this shit together
and now you are insisting that he created an imperfect Universe ???

Got cha !!! Just screwing with you ... at the end of the FINITE Universe
there is a chain-link fence with signs saying:
No Trespassing ... deadly force is authorized.
By the Authority of Beelzebub.


Hagar

unread,
Sep 5, 2010, 1:59:39 PM9/5/10
to

"HVAC" <mr....@gmail.com> wrote in message
news:i60gvm$q6u$1...@hvac.motzarella.org...


Both are definitely contenders for that elusive LEBON Prize ..


Hagar

unread,
Sep 5, 2010, 1:57:29 PM9/5/10
to

"Sir Frederick Martin" <mmcn...@fuzzysys.com> wrote in message
news:bpf786p7ijppur816...@4ax.com...
> Your hubris is showing.

Hmmm ... sounds more like STUPIDITY than hubris ...


HVAC

unread,
Sep 5, 2010, 7:10:16 PM9/5/10
to

"Hagar" <hagen@sahm,name> wrote in message
news:paudncWuwYwmQR7R...@giganews.com...

>>>>
>>>> No. By definition, the universe is all there is.
>>>>
>>>> There IS no outside the universe.
>
> But HVAC, what about Intelligent Design, huh ??
> Just remember that God only had 8 days to put this shit together
> and now you are insisting that he created an imperfect Universe ???
>
> Got cha !!! Just screwing with you ... at the end of the FINITE Universe
> there is a chain-link fence with signs saying:
> No Trespassing ... deadly force is authorized.
> By the Authority of Beelzebub.


I'm tellin ya...This is the best NG on usenet for kooks.

It's like a bottomless pit of kooky tomfoolery.


Androcles

unread,
Sep 5, 2010, 7:19:37 PM9/5/10
to

"HVAC" <mr....@gmail.com> wrote in message
news:i6180f$9rp$1...@hvac.motzarella.org...
Don't leave out the common or garden variety of fuckwits that claim the
universe is finite when it is really a bottomless pit.


Sanny

unread,
Sep 8, 2010, 6:42:53 AM9/8/10
to
Universe may be a point particle like an electron.

It exists but as a point.

As we are unable to find perimeter/ radius of Universe It can be a
point particle.

Bye
Sanny


Enjoy Chating at GetClub Computer.


http://www.getclub.com/chat_with/Physics.php


<<<<<<<<<<<<=========

=============>>>>>>>>>>>>>>>
Go for Chat

http://www.getclub.com/chat_with/Physics.php

bert

unread,
Sep 8, 2010, 8:13:19 AM9/8/10
to


Micro goes with QM Macro goes with GR + SR (relativity) Different
physics Einstein knew that. Planck knew that. Out understanding of QM
has our thinking on electron from point particle to a spinning cloud
structure. That is reason for my creating two theories to show this to
be reality. Black holes with equators spinning at c. Worm holes
connecting universes are the two best objects relating micro with
macro.realms TreBert

bigfl...@gmail.com

unread,
Sep 8, 2010, 8:19:22 AM9/8/10
to

Now consider the micro. as the observable, and the macro. as the
observer.

BOfL

Saul Levy

unread,
Sep 8, 2010, 1:58:54 PM9/8/10
to
Could your chat bot be any STUPIDER, Sanny?

I doubt it.

You don't KNOW any PHYSICS, FOOL!

Saul Levy

hanson

unread,
Sep 8, 2010, 2:03:59 PM9/8/10
to
In-"Sanny" <softt...@hotmail.com>, the unfortunate

victim of a recent beating by intelligent street goons, wrote:
Universe may be a point particle like an electron.
It exists but as a point.
As we are unable to find perimeter/ radius of Universe
It can be a point particle.
Bye
Sanny
>
hanson wrote:
... ahahaha... Yo, Sanny!... if you talked like that to your
companions in the park, no wonder that they beat the
tar out of you. Did they cause brain damage? I hope
not, but it so appears. Thanks for the laughs, you old
Bandicoot... AHAHAHA... ahahaha... ahahahahanson

--- news://freenews.netfront.net/ - complaints: ne...@netfront.net ---

Brad Guth

unread,
Sep 8, 2010, 5:42:51 PM9/8/10
to
On Sep 8, 3:42 am, Sanny <softtank...@hotmail.com> wrote:
> Universe may be a point particle like an electron.
>
> It exists but as a point.
>
> As we are unable to find perimeter/ radius of Universe It can be a
> point particle.
>
> Bye
> Sanny

A true point of any kind can't have complexity of any kind within,
because there is no within.

Existing within mirrors is entirely another matter, whereas one point
can represent as many other points as there are mirrors that reflect
infinitely between themselves.

It would be a fun science thing to utilize a one meter inside diameter
geodesic sphere made entirely of 99.9999% reflective mirrors, just to
see what happens, whereas each point-source photon near instantly
becomes worth trillions of photons.

Each second should offer at the very least 299792458 primary photon
reflections, plus nearly infinite secondaries between all the
mirrors. This could run like multiple photon gyros.

For how long would each new photon last?

~ BG

Brad Guth

unread,
Sep 8, 2010, 7:44:57 PM9/8/10
to
On Sep 8, 11:03 am, "hanson" <han...@quick.net> wrote:
> In-"Sanny" <softtank...@hotmail.com>, the unfortunate
> --- news://freenews.netfront.net/ - complaints: n...@netfront.net ---

Bet you wish that you could have been one of those thugs.

~ BG

Saul Levy

unread,
Sep 9, 2010, 12:29:48 AM9/9/10
to
Sanny is a WIMP, GOOFY!

Not hard to figure that out.

Saul Levy


On Wed, 8 Sep 2010 16:44:57 -0700 (PDT), Brad Guth
<brad...@gmail.com> wrote:

>On Sep 8, 11:03 am, "hanson" <han...@quick.net> wrote:
>> In-"Sanny" <softtank...@hotmail.com>, the unfortunate
>> victim of a recent beating by intelligent street goons, wrote:
>> Universe may be a point particle like an electron.
>> It exists but as a point.
>> As we are unable to find perimeter/ radius of Universe
>> It can be a point particle.
>> Bye
>> Sanny
>>
>> hanson wrote:
>>
>> ... ahahaha... Yo, Sanny!... if you talked like that to your
>> companions in the park, no wonder that they beat the
>> tar out of you.  Did they cause brain damage? I hope
>> not, but it so appears. Thanks for the laughs, you old
>> Bandicoot... AHAHAHA... ahahaha... ahahahahanson

hanson

unread,
Sep 9, 2010, 1:17:31 AM9/9/10
to

Morbidly obese, bedridden "Brad Guth" <brad...@gmail.com> wrote:
"hanson" <han...@quick.net> wrote:
> In-"Sanny" <softtank...@hotmail.com>, the unfortunate
> victim of a recent beating by intelligent street goons, wrote:
> Universe may be a point particle like an electron.
> It exists but as a point.
> As we are unable to find perimeter/ radius of Universe
> It can be a point particle. -- Bye -- Sanny

>
> hanson wrote:
> ... ahahaha... Yo, Sanny!... if you talked like that to your
> companions in the park, no wonder that they beat the
> tar out of you. Did they cause brain damage? I hope
> not, but it so appears. Thanks for the laughs, you old
> Bandicoot... AHAHAHA... ahahaha... ahahahahanson
>
The masochistic anarchist-wanna-be guth yearned and wrote:
Bet you wish that you could have been one of those thugs.
>
hanson wrote:
... ahahaha... Brad, you are lonely again and look for
some company, some response, don't you. Here it is:
"You just lost your bet, Brad... ahahaha... AHAHAHAHA"
Thanks for the laughs, though... ahahaha.. ahahahanson

--- news://freenews.netfront.net/ - complaints: ne...@netfront.net ---

bert

unread,
Sep 9, 2010, 2:41:17 PM9/9/10
to
On Sep 5, 12:37 pm, "HVAC" <mr.h...@gmail.com> wrote:
> "Sanny" <softtank...@hotmail.com> wrote in message

>
> news:e904182c-98e2-4921...@a4g2000prm.googlegroups.com...
>
>
>
>
>
>
>
> > My Law: Empty Space is infinite. However the Matter [with Weight] is
> > Finite.
>
> > Whenever a new Law is stated in physics, people condemn it.
>
> > So it came to me as no surprise. Thats why I wrote allow people to
> > understand in 5-10 years.
>
> > People dont accept new laws easily. I am ready for Proofs &
> > Experiments.
>
> > If you can fail my law with experiments I will accept it.
>
> > "Earth is Round" Earlier people used to think earth is flat. And those
> > who discovered Earth is round were beaten.
>
> > But with Experiments It was found Earth is round.
>
> > So If you disagree with my law proove it. Its Physics, You can not
> > easily fake others.
>
> > Lets hear what other says about my opinion. We are here to discuss
> > physics So enjoy.
>
> > Bye
> > Sanny
>
> Did you study English at the Bert School for retards?
>
> --
> "I'll stick my knife right down your throat, baby and it hurts."- Hide quoted text -
>
> - Show quoted text -

English 0 Science 10 That's the way I go. TreBert

Sam Wormley

unread,
Sep 9, 2010, 7:11:33 PM9/9/10
to
On 9/9/10 1:41 PM, bert wrote:

> English 0 Science 10 That's the way I go. TreBert

Poor English (or any language) and poor communications skill
can really hinder one's credibility.

hanson

unread,
Sep 10, 2010, 9:14:32 PM9/10/10
to
"Brad Guth" <brad...@gmail.com> wrote:
Sanny <softtank...@hotmail.com> wrote:
> Universe may be a point particle like an electron.
> It exists but as a point.
> As we are unable to find perimeter/ radius of Universe
> It can be a point particle.
>
Brad wrote:
A true point of any kind can't have complexity of any kind within,
because there is no within.
Existing within mirrors is entirely another matter, whereas one point
can represent as many other points as there are mirrors that reflect
infinitely between themselves.

It would be a fun science thing to utilize a one meter inside diameter
geodesic sphere made entirely of 99.9999% reflective mirrors, just to
see what happens, whereas each point-source photon near instantly
becomes worth trillions of photons.
Each second should offer at the very least 299792458 primary photon
reflections, plus nearly infinite secondaries between all the
mirrors. This could run like multiple photon gyros.
For how long would each new photon last?
>

hanson wrote:
... Brad, ask Androcles John Parker about your "photon reflections".
He calls them "Rephotons" and others called them "Reflexions", the
latter ones of which are losing fractal spin units with each re-flection
as is mandated by the HUP which ought to give you a half-life estimate.

Brad Guth

unread,
Sep 10, 2010, 11:56:13 PM9/10/10
to
On Sep 10, 6:14 pm, "hanson" <han...@quick.net> wrote:
> ... Brad, ask Androcles John Parker about your "photon reflections".
> He calls them "Rephotons" and others called them "Reflexions", the
> latter ones of which are losing fractal spin units with each re-flection
> as is mandated by the HUP which ought to give you a half-life estimate.
> hanson
>
> --- news://freenews.netfront.net/ - complaints: n...@netfront.net ---

Interesting that others thought of the reflected photons long before I
did.

Perhaps it's those outermost reflected photons that look to us as
though redshifted.

With essentially all the mass of this universe as nearly behind them,
you'd think that too would cause a cosmic lens and subsequent
distortion to what we perceive.

~ BG

Saul Levy

unread,
Sep 11, 2010, 8:26:51 PM9/11/10
to
You mean English 0, Science 0.

SENILE IDIOT!

Saul Levy

studio

unread,
Sep 12, 2010, 1:18:09 AM9/12/10
to
On Sep 5, 12:22 pm, "HVAC" <mr.h...@gmail.com> wrote:
> No. By definition, the universe is all there is.

As currently known, that's correct. But to say that's all that will
ever be known is simply unknown.
Of course, a thousand years ago, there was no America either.
There's no land to the west over the ocean, don't be ridiculous, the
ocean goes to the edge of the world and you'll fall off!
Common knowledge 1,000 years ago.

Even as few as a hundred years ago, there wasn't any such thing as
quarks.
It's like trying to predict what the future will be like in 1,000
years form now... a very difficult thing to predict, but one thing is
absolutely certain; it will be stranger than you can possibly imagine.

> There IS no outside the universe.

And you know this how?
By current knowledge that there isn't?

The correct answer is: I don't know.
But apparently that's an unacceptable answer to learn for some people.

HVAC

unread,
Sep 12, 2010, 5:17:28 AM9/12/10
to

"studio" <tl...@hotmail.com> wrote in message
news:4b17eb82-8381-40be...@u31g2000pru.googlegroups.com...

> No. By definition, the universe is all there is.

As currently known, that's correct. But to say that's all that will
ever be known is simply unknown.

~~~~~~~~~~~~~~~~~~


Are you retarded?

What part of "By definition, the universe is all there is",
didn't you understand?


> There IS no outside the universe.


And you know this how?

~~~~~~~~~~~~~


Because I can read a dictionary.

Universe = Everything there ever was, is now, or ever will be.


The correct answer is: I don't know.
But apparently that's an unacceptable answer to learn for some people.

~~~~~~~~~~~~~~~~~~~~


Damm, you're stupid.


--
Tua mater tam antiquior ut linguam latine loquatur
- Your mother is so old she speaks Latin


Painius

unread,
Sep 12, 2010, 7:54:48 AM9/12/10
to
"HVAC" <mr....@gmail.com> wrote in message...
news:i6i5rb$5n5$2...@hvac.motzarella.org...

> "studio" <tl...@hotmail.com> wrote in message
> news:4b17eb82-8381-40be...@u31g2000pru.googlegroups.com...
>
>> No. By definition, the universe is all there is.
>
> As currently known, that's correct. But to say that's all that will
> ever be known is simply unknown.
> ~~~~~~~~~~~~~~~~~~
> Are you retarded?
>
> What part of "By definition, the universe is all there is",
> didn't you understand?
>
>> There IS no outside the universe.
>
> And you know this how?
> ~~~~~~~~~~~~~
>
> Because I can read a dictionary.
>
> Universe = Everything there ever was, is now, or ever will be.

And once again you screwed the pooch.

No dictionary defines the Universe as you have defined it
above. None that i have within reach, anyway. So you are
challenged to cite one, Harlow.

And besides, I thought you were a Big gangBanger? How
exactly does a Big Bang origin of the Universe derive from
"everything there ever was"? "Ever" is an oh-so-very long
time.

The only thing i can think of that's greater than "ever" is the
height of ambition of a porcupine ambling up an elephant's
leg with rape on his mind.

happy days *and*...
Starry, starry nights !

--
Indelibly yours,
Paine Ellsworth

P.S.: "The evil of the world is made possible by
nothing but the sanction you give it." > Ayn Rand

P.P.S.: http://astronomy.painellsworth.net !
http://en.wikipedia.org/wiki/User:Paine_Ellsworth !


HVAC

unread,
Sep 12, 2010, 8:38:02 AM9/12/10
to

"Painius" <starswi...@maol.com> wrote in message
news:4c8cbf88$0$4855$9a6e...@unlimited.newshosting.com...

>>
>>> There IS no outside the universe.
>>
>> And you know this how?
>> ~~~~~~~~~~~~~
>>
>> Because I can read a dictionary.
>>
>> Universe = Everything there ever was, is now, or ever will be.
>
> And once again you screwed the pooch.


Ya... And I'm selling the pups.


> No dictionary defines the Universe as you have defined it
> above. None that i have within reach, anyway. So you are
> challenged to cite one, Harlow.
>
> And besides, I thought you were a Big gangBanger? How
> exactly does a Big Bang origin of the Universe derive from
> "everything there ever was"? "Ever" is an oh-so-very long
> time.


Let me school you, (again) oh unenlightened one.

The universe (which is defined as everything there ever was,
is now, or ever will be) began when a singularity of infinite
density inflated to the size of our galaxy in a billionth of a second.
(give or take a trillionth)

This singularity's 'bang' began time as well.

So everything there ever was and ever will be was contained in
that infinitely small singularity.

See? REAL science is FAR more interesting than your made up
space people, astral projection, and mirages.

Try reading some subject matter re: the birth of the universe.

You may even find that the truth is better than your made up shit.

Have a nice day! :-)

--
"Cancel my subscription to the resurection"


bigfl...@gmail.com

unread,
Sep 12, 2010, 9:20:16 AM9/12/10
to
On Sep 12, 8:38 pm, "HVAC" <mr.h...@gmail.com> wrote:
> "Painius" <starswirlern...@maol.com> wrote in message

>
> The universe (which is defined as everything there ever was,
> is now, or ever will be) began when a singularity of infinite
> density inflated to the size of our galaxy in a billionth of a second.
> (give or take a trillionth)

Of course, not 'turtles all the way down, but 'turtles all the way
in'.

Is it a great insight into the believing capacity of the mind that is
uses its best intellectual capacity and comes up with such total
absurdity.

What a convenient word "singularity" is. Very religious in its
connotation, or didnt you notice?

If you were an intelligent entity the size of a photon, and lived a
millionth of an 'earth' second inside the human lung, you would see
the lung as expanding (assuming you lived during the inhalation
stage), and would therefore deduce the lung was also was a singularity
some 'one million x the seconds in a year x the age of the lung' ago..


>
> This singularity's 'bang' began time as well.

Ahhh so god was a clock maker, because clocks would have all had to be
built and ready to go. I suppose they could have been made out of
carbon (they could have then been dated at least), but there wasnt
much carbon about during 'no time no space'.......no matter!,
fantasize on 'little ones'.


>
> So everything there ever was and ever will be was contained in
> that infinitely small singularity.

Infinitely small.!!! Where is Aesop when you need him....


>
> See?  REAL science is FAR more interesting than your made up
> space people, astral projection, and mirages.

Cant wait to see what entities are created from CERN.


>
> Try reading some subject matter re: the birth of the universe.

You mean like the Bible? Problem is with both stories, there was
supposedly nobody there to witness such events, unless they were in an
astral body


>
> You may even find that the truth is better than your made up shit.

And so another mental circle is complete.


>
> Have a nice day!   :-)

Now there's a piece of mindless rhetoric if ever I have heard one.

BOfL

HVAC

unread,
Sep 12, 2010, 10:11:41 AM9/12/10
to

<bigfl...@gmail.com> wrote in message
news:2bd20150-aa2d-4fb4...@m17g2000prl.googlegroups.com...

>
> The universe (which is defined as everything there ever was,
> is now, or ever will be) began when a singularity of infinite
> density inflated to the size of our galaxy in a billionth of a second.
> (give or take a trillionth)

Of course, not 'turtles all the way down, but 'turtles all the way
in'.

Is it a great insight into the believing capacity of the mind that is
uses its best intellectual capacity and comes up with such total
absurdity.

What a convenient word "singularity" is. Very religious in its
connotation, or didnt you notice?

~~~~~~~~~~~~~~~~~~~~~~~~~~~~~


It's only 'religious' to retards that cannot fathom the
word. There are billions, if not trillions of singularities
in our universe.

If you wish to pray to them, be my guest.

--
'Some days, it's just not worth chewing through the restraints


Androcles

unread,
Sep 12, 2010, 10:15:49 AM9/12/10
to

<bigfl...@gmail.com> wrote in message
news:2bd20150-aa2d-4fb4...@m17g2000prl.googlegroups.com...

What a convenient word "singularity" is. Very religious in its


connotation, or didnt you notice?

=============================================
A warplane is flying over Antarctica and when it gets near to the
South Pole the pilot pulls back on the stick and flies vertically,
directly up the Earth's axis like a rocket. What heading does the
computerized compass display show?

That is a singularity without any religious connotation, or didn't
you notice?

http://mathworld.wolfram.com/SingularMatrix.html
If you don't know what a word means then find out before you
use it or you'll be eating shoe leather for breakfast instead of
crispy bacon.

Phister

unread,
Sep 12, 2010, 10:20:20 AM9/12/10
to
That might exceed the speed of light, which we all know is impossible.

--
DNA signature encryption key........
ATTGGTGCATTACTTCAGGCTCT


Saul Levy

unread,
Sep 12, 2010, 12:12:27 PM9/12/10
to
Ignore them, HVAC, they all WANT NOBELS for figuring this SHIT out!

BEERTbrainLESS'S at the FRONT OF THAT LINE!

BAWAHAHAHAHAHAHAHA!

Saul Levy

Saul Levy

unread,
Sep 12, 2010, 12:25:34 PM9/12/10
to
OMMMMMMMMMMMMMMMMMMM!

Prayer doesn't work.

Saul Levy

hanson

unread,
Sep 12, 2010, 8:06:37 PM9/12/10
to
"Brad Guth" <brad...@gmail.com> wrote:
On Sep 10, 6:14 pm, "hanson" <han...@quick.net> wrote:
> ... Brad, ask Androcles John Parker about your
> "photon reflections". > He calls them "Rephotons" and
> others called them "Reflexions", the latter ones of which are
> losing fractal spin units with each re-flection as is mandated
> by the HUP which ought to give you a half-life estimate.
> hanson
>
Brad wrote:
Interesting that others thought of the reflected photons
long before I did.
>
hanson wrote:
"long before you did"... AHAHAHAHAHA.. AHAHAHAHA...
that's one of your better megalomaniac delusion, Brad...
AHAHAHA... Do you really think that you ever expressed
a thought that nobody was thinking of before you did?

>
Brad wrote:
Perhaps it's those outermost reflected photons that look to us as
though redshifted.
With essentially all the mass of this universe as nearly behind them,
you'd think that too would cause a cosmic lens and subsequent
distortion to what we perceive.
>
hanson wrote:
.... ahahaha.. Is that so?... You are trying too hard, Brad
Brad, face it, you are not one who is capable of thinking out
of the box. Virtually all of the time you are just a parrot who
repeats what multitudes of folks have thought of & expressed
generations before it ever occurred to you... ahahahaha....
But don't feel bad about that. In your case it may be genetics
and equally likely it's because you are NOT "rolling in the
right circles", which would greatly improve your epi-genome.
Thanks for the laughs, though... ahahaha... ahahahanson

Androcles

unread,
Sep 12, 2010, 8:17:14 PM9/12/10
to

"cha-cha-hanson" <han...@quick.net> wrote in message
news:i6jpv1$l2e$2...@news.eternal-september.org...

<snip irrational crap>


hanson

unread,
Sep 13, 2010, 12:20:49 AM9/13/10
to
"Androcles" <Headm...@Hogwarts.physics_aa> wrote
... irrational crap>
>
hanson wrote:
that's right, Andro.... <snip...
Thanks for the laughs...ahahaha.. ahahahanson
>
>
PS:
Keep running after me, John, if you are so needy & keep
on dancing your chachachas for me if it helps to improve
your sorry condition... TIA for the laughs... ahahanson

Androcles

unread,
Sep 13, 2010, 12:30:01 AM9/13/10
to

"hanson" <han...@quick.net> wrote in message
news:i6k8ra$8k2$2...@news.eternal-september.org...
| "Androcles" <Headm...@Hogwarts.physics_aa> wrote
< irrational crap>


Painius

unread,
Sep 13, 2010, 12:32:26 AM9/13/10
to
My dearest Harlow,

"HVAC" <mr....@gmail.com> wrote...
in message news:i6ihjb$63q$1...@hvac.motzarella.org...


> "Painius" <starswi...@maol.com> wrote in message
> news:4c8cbf88$0$4855$9a6e...@unlimited.newshosting.com...
>>>
>>>> There IS no outside the universe.
>>>
>>> And you know this how?
>>> ~~~~~~~~~~~~~
>>>
>>> Because I can read a dictionary.
>>>
>>> Universe = Everything there ever was, is now, or ever will be.
>>
>> And once again you screwed the pooch.
>
> Ya... And I'm selling the pups.

Yes, and you're putting an unscientific limitation on
the concept of "ever". You're saying that "everything
there ever was" can only go back to the Big Bang,
because that's when time began.

It's hard to believe that grown-ups who have been
trained in the scientific method can actually bring
themselves to swallow such drivel.

The only difference between the Big Bang and the
book of Genesis is the absence of a creator. All the
rest is myth and vapors. The Big Bang is nothing
more than creationist theory without a creator.

The faraway redshift illusion will paint your face red
someday.

Happy days *and*...
Starry, starry nights !

--
Indelibly yours,
Paine Ellsworth

P.S. "I am not afraid... I was born to do this."
> Joan of Arc

Brad Guth

unread,
Sep 13, 2010, 12:54:41 AM9/13/10
to
On Sep 12, 9:32 pm, "Painius" <starswirlern...@maol.com> wrote:
> My dearest Harlow,
>
> "HVAC" <mr.h...@gmail.com> wrote...
>
> in messagenews:i6ihjb$63q$1...@hvac.motzarella.org...
>
> > "Painius" <starswirlern...@maol.com> wrote in message

Faith-based voodoo, especially of the pretend-Atheist kind is very
powerful voodoo.

For Zionists/Jews that do not believe in heaven or hell, the singular
BB and forever expanding universe is ideal, because you never have to
look back.

~ BG

hanson

unread,
Sep 13, 2010, 7:13:13 PM9/13/10
to
"Androcles" <Headm...@Hogwarts.physics_aa> wrote:

> "hanson" <han...@quick.net> wrote:
> | "Androcles" <Headm...@Hogwarts.physics_aa> wrote:
> | < irrational crap>
>
hanson wrote:
... ahahahaha... AHAHAHAHA... AHAHAHAHA...
Don't be so hard on yourself, Andro..... ahahahahaha....
Thanks for the laughs, old chum... ahahahanson

Androcles

unread,
Sep 13, 2010, 7:41:52 PM9/13/10
to

"hanson" <han...@quick.net> wrote in message
news:i6mb74$g7r$1...@news.eternal-september.org...

| "Androcles" <Headm...@Hogwarts.physics_aa> wrote:
| > "hanson" <han...@quick.net> wrote:
< snip irrational crap>

RichD

unread,
Sep 16, 2010, 6:52:58 PM9/16/10
to
On Sep 5, Sanny <softtank...@hotmail.com> wrote:
> Incase Universe is Finite.
>
> Once an electron was on its journey towards the end of Universe.
>
> It found everything in universe is on one side and Whats on other
> side?
>
> The electron flew light/ torch towards the End of Universe.
>
> Will the Light bounce back from the Wall or It will go out of
> Universe?
>
> Second Question [Universe is infinite]
>
> When Big Bang Started people say Universe was very small. even Smaller
> than an electron.
>
> Then It started expanding.
>
> When a Ballon Expands it replaces the air outside the Ballon.
>
> So what was Universe replacing. It was the empty space.
>
> So Empty space was present even before Big Bang.

>
> My Law: Empty Space is infinite. However the Matter [with Weight] is
> Finite.
>
> Where is the Noble Prize. If you agree with my law send me the award.
> May be 5-10 yrs later !!!

It's times like this, I miss Uncle Al.

--
Rich

0 new messages