samToQlx.pl mystery error

[bram.v...@gmail.com]

Hi all,

I've been reading through this forum and elsewhere trying to figure out what is going wrong, but I cannot spot the issue. 

I downloaded the rc454 scripts from the BROAD website and checked if all works properly by running a positive try-out on the testdata. When I execute runMosaik2.pl on my own data however, all goes fine until the script invokes samToQlx.pl, after which I get numerous error messages like the ones below:

MosaikAligner CPU time: 60.799 s, wall time: 62.794 s

Use of uninitialized value in substr at /Users/Bram/Documents/programs/RC454/samToQlx.pl line 168, <SAMFILE> line 5.

Use of uninitialized value in substr at /Users/Bram/Documents/programs/RC454/samToQlx.pl line 176, <SAMFILE> line 5.

substr outside of string at /Users/Bram/Documents/programs/RC454/samToQlx.pl line 176, <SAMFILE> line 5.

Use of uninitialized value in concatenation (.) or string at /Users/Bram/Documents/programs/RC454/samToQlx.pl line 176, <SAMFILE> line 5.

Use of uninitialized value in substr at /Users/Bram/Documents/programs/RC454/samToQlx.pl line 168, <SAMFILE> line 5.

substr outside of string at /Users/Bram/Documents/programs/RC454/samToQlx.pl line 168, <SAMFILE> line 5.

Use of uninitialized value in concatenation (.) or string at /Users/Bram/Documents/programs/RC454/samToQlx.pl line 168, <SAMFILE> line 5.

Use of uninitialized value in substr at /Users/Bram/Documents/programs/RC454/samToQlx.pl line 176, <SAMFILE> line 5.

I suppose this has to do with the rather weird-looking sam file (see link to the sam file for those interested).

My fasta and qual file have no issues with the naming. They look like this:

>HC1L4YH03HLBJE

GGTCATGGAGTCTCCATAGAATGGCACACAAGGCTTCTTCCNCT

>HC1L4YH03HGNW0

AGACATATGCCTGGCCTGTACCGTCAGCGTCACTGACGCTGCGCCACTAGTG

>HC1L4YH03GH3YO

ATAGCTCTCAGCAATTGTTCTGCTGTTGCACTATACC

and

>HC1L4YH03HLBJE

30 30 30 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 39 39 39 39 39 37 32 32 32 33 33 33 29 29 0 15 14

>HC1L4YH03HGNW0

39 37 37 37 34 32 32 32 32 33 33 32 28 28 28 28 32 32 35 37 37 37 37 37 39 39 39 39 39 39 39 39 39 39 39 37 37 37 35 35 33 32 32 23 23 19 17 19 18 19 18 18

>HC1L4YH03GH3YO

40 40 40 40 40 40 39 38 38 35 35 35 32 32 32 25 18 18 18 20 24 33 33 35 31 30 30 35 37 37 38 35 33 33 32 33 20

Any help is greatly appreciated because I'm really stuck and would like to first clean these data (rc454) and run VPhaser to call variants.

Many thanks!

Bram