The Cosmological Argument
Foucaultian
of fallacy:
http://en.wikipedia.org/wiki/Cosmological_argument
Intelligent design was developed by people, including fellows, working
with the Discovery Institute:
It was a reaction to the lack of American judicial success some
evangelical and fundamentalist Christians had experienced in fighting
for "creationism" to be taught in the public schools.
Although many intelligent design (ID) advocates will say that ID is
not creationism, they are simply playing with words. What they mean is
that, unlike classical creationism, ID does not require a belief that
humans (hominoids) have always been distinct from other apes
(hominoids), i.e., the classic distinction which classical
creationists have tried to make between macroevolution and
microevolution.
While that is true, it neglects what most people would regard as the
larger issue: All creationists, including IDers, believe that
explanations of the biological origins require the intervention of a
creator or intelligent designer. For that reason, ID is a type of
creationism, albeit a specialized type.
Just as the Protestant Christian Discovery Institute has its ID, some
Muslims have their Kalam theological argument. It is very similar:
http://en.wikipedia.org/wiki/Kalam_cosmological_argument
Mark A. Foster
http://www.markfoster.net
'Rev Dr' Lenny Flank
wrote:
You, uh, just NOW found all this out . . . . . . . ?
================================================
Lenny Flank
"There are no loose threads in the web of life"
Editor, Red and Black Publishers
http://www.RedAndBlackPublishers.com
Ron O
wrote:
Wiki has a summary of intelligent design that pretty much covers the
major points.
http://en.wikipedia.org/wiki/Intelligent_design
There are other organizations, probably less competent at running the
ID scam like ID Network.
http://www.intelligentdesignnetwork.org/
These are the guys that were involved in the Kansas fiasco and Ohio.
They were involved in writing up the bogus Ohio Model lesson plan that
used Wells' book Icons of Evolution and it made them look like the
total screw ups that they are. When you don't cross check dishonest
propaganda material and leave the blatant lies in something that is
going to get national attention, you are either clueless or you want
to get caught.
The Discovery Institute and the ID Network are the two most active ID
scam outfits that I know of. Both came up in the Dover fiasco and in
the PBS documentary.
The Ohio lesson plan fiasco and Kansas was so lame that Leonard (I
think that was the graduate students name) didn't even make it into
Expelled. Expelled had to stoop to interviewing ID perps like Egnor
that just had mean things said about the stupid things he wrote on the
web. It is like putting Ray or Backspace up as the poster child of
how mean the intolerant science side can be. Leonard was the Ohio
graduate student that testified in the Kansas kangaroo court about his
exploits in Ohio, and was supposed to be one of the authors of the
Ohio Model lesson plan for the ID/creationist switch scam. As far as
I know he has never been able to mount a defense of his PhD "thesis"
on teaching the intelligent design creationist scam to high school
students. Leonard was supposed to be associated with the ID Network.
If the first draft of the Ohio Model lesson plan was an example of
what he taught to high school students for his thesis work, there is a
good reason why he has never defended his thesis.
http://www.ohioscience.org/lesson-plans.shtml
Ron Okimoto
Foucaultian
> You, uh, just NOW found all this out . . . . . . . ?
No, but it has been a long time since I posted here. ;-) I actually,
many years ago, taught a course called Human Evolution and Prehistory at
a branch of the University of Virginia, and I would get into discussions
with some of my students on the subject. (Actually, as a sociologist, I
was not qualified to teach the course, but I was the new guy in the
Sociology and Anthropology Dept. at the time.)
Ron O. wrote:
> The Ohio lesson plan fiasco and Kansas was so lame that Leonard (I
> think that was the graduate students name) didn't even make it into
> Expelled.
Yes, I live in Kansas, and Kansas Citizens for Science fought hard
against it.
Given that the ID agenda, like earlier creationist agendas, has largely
failed to live up to the expectations of the Discovery Institute, that
organization is no longer even emphasizing it on its website. ID used to
be highlighted on the main page, but you now need to really look for it.
They appear to me to have moved onto other areas of their "culture war"
and left ID mostly to others.
Mark Foster
John Wilkins
Actually, I have to disagree on a point of interpretation. Disco's
versions of the cosmological argument run inversely to the traditional
one. Where the Kalam (which is proposed also by Alvin Plantinga and
other Christian philosophers) and the Thomist argument aim to show that
a deity exists because [some part of] the universe exists, the Disco
argument says that because some deity/designer (let's be frank, it's a
deity) exists, aspects of the universe are explained.
In short, ID is an invitation to stop looking for natural explanations.
At least the older cosmological arguments had some backbone and honesty.
--
John S. Wilkins, Postdoctoral Research Fellow, Philosophy
University of Queensland - Blog: scienceblogs.com/evolvingthoughts
"He used... sarcasm. He knew all the tricks, dramatic irony, metaphor,
bathos, puns, parody, litotes and... satire. He was vicious."
Robert Carnegie
Is that the same as saying that "because some aspects of the universe
have no reasonable explanation othersthan a deity/designer, there is a
deity/designer" - because that's what I thought they were up to.
Robert Carnegie
Well, Wikipedia's policy of intellectual neutrality probably excludes
saying what ought to be said, such as, as I have pointed out before,
"intelligent design" is for lying, thieving cowards who deny their
God. I decided to add "thieving" this time to take account inside the
sound bite of the goal of using public tax funds to pay for religious
teaching. The elements of lying, cowardice, and God-denial should be
evident upon reflection.
TomS
<1ihwnhz.1fixrrcy80colN%j.wil...@uq.edu.au>, John Wilkins stated..."
ID is an invitation to stop looking for explanations.
I wouldn't narrow that down to "natural" explanations.
Or, come to think of it, ID is an invitation to stop
looking.
--
---Tom S.
"As scarce as truth is, the supply has always been in excess of the demand."
attributed to Josh Billings
John Wilkins
No, for if they were doing that, they'd be curious about the nature of
the designer, just as natural theology used to be.
Robert Carnegie
Well, they have a motive in U.S..constitutional law, and in other
people's good sense elsewhere, for restraining their curiosity about
the designer they have "discovered" by his fingerprints.
I repeat: I thought they were doing it the way that I said, and not
the way that you said. Your way, they seem to produce the designer
first, like a rabbit from a magician's hat. I think it's the
fingerprints first. That is to say, they claim there are
fingerprints, the designedness... A design argument has to start by
detecting design, surely?
Cj
news:48974676-9958-4ebe...@s50g2000hsb.googlegroups.com...
I've been waiting for years for some IDcreationist to publish on these
"fingerprints". So far nothing. You can babble all you want but you can't
detect design except by reference to Genesis.
Cj
Robert Carnegie
> "Robert Carnegie" <rja.carne...@excite.com> wrote in message
But, but, the flagellum! The clotting of blood! The... no, I'm not
very much impressed, either. If God's messengers on earth can't show
us /convincing/ miracles in concrete for, well, it's "Never mind,
lads, same time tomorrow..." again.
Nevertheless, that /is/ the "Intelligent Design" argument, I'd
thought. It just isn't a very good one. But it is clearly
distinguished from, say, "Pascal's Wager".
Bill
Creationists -require- Genesis, IDers don't. Creationists argue for a
6 day creation, IDers don't. Creationists argue a Young Earth, IDers
don't. If you confuse these facts, what else have you gotten wrong?
Bill
Foucaultian
> Creationists -require- Genesis, IDers don't. Creationists argue for a
> 6 day creation, IDers don't. Creationists argue a Young Earth, IDers
> don't. If you confuse these facts, what else have you gotten wrong?
Not necessarily. There are numerous creationist frameworks. Progressive
creationists, for instance, will often assert that the creation accounts
in Genesis are a figurative narrative. Their perspectives are actually
closer to theistic evolution, in most respects, than to young-earth
creationism.
Also, old-earth creationism is not the same as intelligent design. Most
old earth creationists believe, like young-earth creationists, that
hominids were created separately. They also accept the historicity of
the 6-day creation, but will argue that the days signify some longer
period of time.
On the other hand, ID does not *require* a belief in the "special
creation" of hominids. There are also a small number of self-identified
IDers who believe in extraterrestrial, not supernatural, origins.
--
Regards, Mark A. Foster, Ph.D. * http://www.markfoster.net
"... the modern challenge is how to live with uncertainty. The
basic fault lines today are not between people with different
beliefs but between people who hold these beliefs with an
element of uncertainty and people who hold these beliefs with
a pretense of certitude." — Peter L. Berger, sociologist
noctiluca
"Scientific creationists' publicly expressed argumentation regarding
evolution requires Genesis, that of ID proponents doesn't. There is a
difference between this and your statement. ID "theory" is configured
such that all religious references are assiduously eliminated from
official talking points. However when speaking with sympathetic
audiences ID spokesman often betray the religious underpinnings of
their movement. Some have expressed doubt as to the primate origins of
humans. Some won't answer the question directly. Some (very few I
believe) do not accept an old earth (tantamount to requiring Genesis),
most have not spoken to the issue.
The evidence suggests that while there may be legitimate theoretical
differences between scientific and ID creationists, they are far more
alike than ID proponents wish to concede (evidence of this can be
found at - http://litcandle.blogspot.com/2005/07/in-their-own-words-is-intelligent.html).
ID is most definitely motivated and sustained by religious sentiment
and in most cases where it has been used to argue for political action
(legislation, education etc.) it has been a prop for fundamentalist
ideals.
ID "theory" differs from scientific creationism in that it seeks to
gain scientific approval more subtly than its evidence distorting
cousin, but its goals are at root quite consonant with those of more
traditional creationisms.
That doesn't mean you personally fit this mold, it just means that you
cannot co-opt the word based on what minimal (and as yet undetermined)
differences you may have with the Discovery Institute's brand of ID,
which is demonstrably creationism.
> Creationists argue for a
> 6 day creation, IDers don't.
See above.
> Creationists argue a Young Earth, IDers
> don't.
Ever heard of Paul Nelson? He's not the only one.
> If you confuse these facts, what else have you gotten wrong?
Indeed.
RLC
> Bill
Bill
> ID is most definitely motivated and sustained by religious sentiment
> and in most cases where it has been used to argue for political action
> (legislation, education etc.) it has been a prop for fundamentalist
> ideals.
>
> ID "theory" differs from scientific creationism in that it seeks to
> gain scientific approval more subtly than its evidence distorting
> cousin, but its goals are at root quite consonant with those of more
> traditional creationisms.
>
> That doesn't mean you personally fit this mold, it just means that you
> cannot co-opt the word based on what minimal (and as yet undetermined)
> differences you may have with the Discovery Institute's brand of ID,
> which is demonstrably creationism.
>
> > Creationists argue for a
> > 6 day creation, IDers don't.
>
> See above.
>
> > Creationists argue a Young Earth, IDers
> > don't.
>
> Ever heard of Paul Nelson? He's not the only one.
>
> > If you confuse these facts, what else have you gotten wrong?
>
> Indeed.
>
> RLC
>
> > Bill
May be that since I'm so often identified with creationists and ID ers
that it's assumed that I support one or the other, possibly both. No
matter how often or how clearly I say otherwise, my posts continue to
be characterized as arguing for some version of creationism. The
reason is obvious of course: I am skeptical of many of the claims made
for theories of evolution. My remarks are inevitably construed to mean
that this skepticism is anti-science. It's either or, either I am 100%
devoted to the latest rendition of some theory of evolution or I'm a
creationist. Simple solutions for simple minds, as usual.
Even so, if there are grounds for doubt, it there are serious
difficulties about evolution, why not talk about them? Since there is
never any basis for doubt and there are no difficulties, I'm told,
it's perverse to say there are. Since the only people who would make
such a claim are creationists, I must be a creationist. It makes any
kind of progress pretty hopeless which is, I assume, the whole point.
My doubts center on the persuasiveness of the arguments for design. It
seems that there are some versions of the argument that are at least
as plausible as evolution. If there are religious implications, so
what? Which is more important that the world is the way we want it to
be or that we discover the way the world really is? While there maybe
nothing designed in nature, the point is that there appears to be
design.
Bill
noctiluca
No, you are not skeptical. Skepticism does indeed imply having doubts
and reservations; withholding judgement until more is known. But you
say things like this,
"This isn't just some trivial accident of some number of chemicals
bumping into each other
randomly. While not necessarily designed, the end result mimics
design
so closely as to be equivalent to design."
...and this,
"It IS magic, top to bottom, front to back. Spontaneous anything is
always unlikely, but spontaneous complexity that also includes very
specific functions interacting with other very specific structures
goes way beyond merely unlikely."
...and this,
"Everything about DNA suggests design."
There is nothing skeptical about the above (and many other) quotes.
Besides reflecting scientific ignorance, they are unreserved and
enthusiastic celebrations of an extremely credulous point of view. You
have avoided all attempts to get you to expand upon them, to offer any
semblance of argument in support of them.
You are not skeptical at all, you are an ideologue.
> My remarks are inevitably construed to mean
> that this skepticism is anti-science.
Sometimes it's hard to distinguish between anti-science and ignorance
of science.
> It's either or, either I am 100%
> devoted to the latest rendition of some theory of evolution or I'm a
> creationist. Simple solutions for simple minds, as usual.
It's clear at this point that you need to believe this is the case.
What is unclear is whether you are unwilling or incapable of
perceiving the truth of the matter. The facts are these: your
opponents have gone to great lengths both to understand your point of
view and to try to detail the nuances of theirs. Your perspective on
the other hand remains substantially ambiguous at this point and you
have offered nothing in the way of explication of your nebulous
claims.
Even simple minds can recognize resentful projection.
> Even so, if there are grounds for doubt, it there are serious
> difficulties about evolution, why not talk about them? Since there is
> never any basis for doubt and there are no difficulties, I'm told,
> it's perverse to say there are. Since the only people who would make
> such a claim are creationists, I must be a creationist. It makes any
> kind of progress pretty hopeless which is, I assume, the whole point.
And here you provide an excellent illustration of the points I made
just above. Please try not to leave hay all over the place after
you're done going upside another strawman's head.
> My doubts center on the persuasiveness of the arguments for design. It
> seems that there are some versions of the argument that are at least
> as plausible as evolution.
Yet you remain incapable or disinclined to enumerate them.
> If there are religious implications, so
> what? Which is more important that the world is the way we want it to
> be or that we discover the way the world really is? While there maybe
> nothing designed in nature, the point is that there appears to be
> design.
I can assure you that by now I'm well aware that this is your point.
It remains vacuous. But I continue to be hopeful that you'll summon
the sack to emulate your words about discovering "the way the world
really is" and open up your vague proclamations to honest appraisal,
both from within and without.
RLC
> Bill
Cj
news:158352ff-3508-471b...@p25g2000hsf.googlegroups.com...
There are multiple theories of evolution? What is the appearance of design?
, a crystal has the appearance of design doesn't it?. The problem you have
is that there is no defining characteristic of design. "Looks like it's
designed" just doesn't cut it...
When something "appears" designed what is different from those things that
don't "appear" to be designed? You cannot define appearance so you've
nothing.
Cj
numerous
wrote:
>In short, ID is an invitation to stop looking for natural explanations.
Yes, for it explains everything. Or rather, the greater paradigm it is
part of does.
IMO, the main problem with ID is that it is focuses mainly on
intelligence and more or less ignores those other factors of
consciousness which must be understood also in order for the whole
thing to make sense. I.e. purpose, desire and whatever other factors
that fall into the category called mind or conscioussness.
There is a reason for this however, and that is that intelligence is
the easiest of these factors to deal with and find evidence for
scientifically, because intelligence is always rational and logical in
its methods and expressions, just like science is. Whereas purpose and
desire, though well known by most of us as expressions of our own
consciousness, are difficult to deal with and explain scientifically
because they are irrational in their expressions.
Ultimately, if you understand consciousness and the relationship
between mind and matter and the logical relationship between rational
and irrational expression, you'll understand everything that it is
possible to understand, scientifically and philosophically.
That's why the old Greeks said "Know Thyself" and the Hindus "Tat Twam
Asi" ("Thou art that"), for mind/consciousness is our true identity
which ultimately represents God which again is the ultimate and
eternal cause of all the effects called physical phenomena.
Robert Carnegie
If you go to a movie, there appears to be motion, but actually there
is a series of still images substituted in rapid succession.
Can you be more specific about "some versions of the argument for
design that are at least as plausible as evolution", because we could
discuss that.
John Wilkins
> I've been to Plantinga's talk(he apparently only has the one) and I'm
> not getting that hour back. I think I know what 'planting'
> <http://www.blackwellpublishing.com/lexicon/#P> and
> 'Alvanize'<http://www.blackwellpublishing.com/lexicon/#A> mean.
>
> Are we gong to get a definition of 'Wilkinsate' sometime?
Not any time soon. I have a feeling it is indefinable, as it has no
essence.
Don Cates
I've been to Plantinga's talk(he apparently only has the one) and I'm
not getting that hour back. I think I know what 'planting'
<http://www.blackwellpublishing.com/lexicon/#P> and
'Alvanize'<http://www.blackwellpublishing.com/lexicon/#A> mean.
Are we gong to get a definition of 'Wilkinsate' sometime?
> In short, ID is an invitation to stop looking for natural explanations.
> At least the older cosmological arguments had some backbone and honesty.
--
Don Cates ("he's a cunning rascal" - PN)
Ernest Major
<158352ff-3508-471b...@p25g2000hsf.googlegroups.com>,
Bill <b...@billconner.com> writes
If there are serious difficulties about evolution, why not talk about
them? Considering you've being doing your best to eschew talking about
difficulties with evolution, insisting that you're not arguing against
any theory of evolution, one would perhaps be warranting in inferring
that you don't believe that there are any such difficulties.
Suggesting that there are difficulties with evolution, but then refusing
to actually state any, does make the prospect of progress pretty much
hopeless.
Why, if you are skeptical of the claims made for the theory of
evolution, do you refrain from stating what you are skeptical of,
instead insisting that you are not arguing against any theory of
evolution.
When you appear to be reading from the Discovery Institute playbook in
such fashion why don't you expect to be identified as a fellow traveller
of theirs?
>
>My doubts center on the persuasiveness of the arguments for design. It
>seems that there are some versions of the argument that are at least
>as plausible as evolution. If there are religious implications, so
>what? Which is more important that the world is the way we want it to
>be or that we discover the way the world really is? While there maybe
>nothing designed in nature, the point is that there appears to be
>design.
Please be specific. What versions of the argument of design are as least
as plausible of evolution? There are literally billions of observations
supporting the factuality of common descent with modification by natural
selection and other processes; there are literal mountains of evidence
for evolution. More than an assertion that DNA appears to be designed is
required for equal plausibility.
>
>Bill
>
--
alias Ernest Major
Kermit
<snip>
>
> May be that since I'm so often identified with creationists and ID ers
> that it's assumed that I support one or the other, possibly both. No
> matter how often or how clearly I say otherwise, my posts continue to
> be characterized as arguing for some version of creationism. The
> reason is obvious of course: I am skeptical of many of the claims made
> for theories of evolution. My remarks are inevitably construed to mean
> that this skepticism is anti-science. It's either or, either I am 100%
> devoted to the latest rendition of some theory of evolution or I'm a
> creationist. Simple solutions for simple minds, as usual.
If you are not anti-science, you would be offering scientific
criticisms. Mainstream evolutionary science, like all sciences, offers
a testable model that fits the facts. For you to scientifically
criticize it in any significant way, please:
1. Show where at least one class of the data is wrong, or
2. Show how evolutionary theory doesn't fit the facts, or
3. Offer an alternative, testable model that does fit all the facts.
Until you do one of these, you are just complaining about scientific
methodology. Whether you do it because you don't like the conclusions,
or just need to be contrary, or some unsavory or uncommon motive, it's
not skepticism.
>
> Even so, if there are grounds for doubt, it there are serious
> difficulties about evolution, why not talk about them? Since there is
> never any basis for doubt and there are no difficulties, I'm told,
> it's perverse to say there are. Since the only people who would make
> such a claim are creationists, I must be a creationist. It makes any
> kind of progress pretty hopeless which is, I assume, the whole point.
Well, refusing to be specific is one common tactic of Creationism. I
suppose that you could be some sort of New Ager, for example. But
science, as the devil, is in the details. Have one?
>
> My doubts center on the persuasiveness of the arguments for design. It
> seems that there are some versions of the argument that are at least
> as plausible as evolution. If there are religious implications, so
> what? Which is more important that the world is the way we want it to
> be or that we discover the way the world really is? While there maybe
> nothing designed in nature, the point is that there appears to be
> design.
>
> Bill
If two or more teams of researchers were to look at any of the known
evolutionary data (genomes, fossils sequences, etc.), how would they
recognize design? How would they independently see it, what
specifically would they look for, and how would they test it?
Anthropologists sometimes have trouble when they look at very old
paleolithic rocks: are they tools, or accidents of nature? They have
things to look for, such as microscopic traces of use, or statistical
analyses of certain kinds of rock fractures, or perhaps lone rocks of
a type not found naturally in the area. What would we look for in
nonhuman design?
Kermit
Kermit
> On Mon, 2 Jun 2008 11:26:26 +1000, j.wilki...@uq.edu.au (John Wilkins)
> wrote:
>
> >In short, ID is an invitation to stop looking for natural explanations.
>
> Yes, for it explains everything. Or rather, the greater paradigm it is
> part of does.
>
> IMO, the main problem with ID is that it is focuses mainly on
> intelligence and more or less ignores those other factors of
> consciousness which must be understood also in order for the whole
> thing to make sense. I.e. purpose, desire and whatever other factors
> that fall into the category called mind or conscioussness.
Why would the human mind have to be understood for current theories in
interstellar physics to make sense?
Or meteorology?
>
> There is a reason for this however, and that is that intelligence is
> the easiest of these factors to deal with and find evidence for
> scientifically, because intelligence is always rational and logical in
> its methods and expressions,
I have heard that definition of intelligence before (and that is what
you are doing). Not everyone would define it so.
I believe it was John Locke who said "If Man is the Rational Animal,
then most of the people I know aren't Men."
> just like science is. Whereas purpose and
> desire, though well known by most of us as expressions of our own
> consciousness, are difficult to deal with and explain scientifically
> because they are irrational in their expressions.
Sexual lust, hunger, pain, social hierarchies are all explicable in
the broad sense. Are you claiming that you (or somebody) understands
the human capacity for sporadic logic in detail? Please provide a
link.
>
> Ultimately, if you understand consciousness and the relationship
> between mind and matter and the logical relationship between rational
> and irrational expression, you'll understand everything that it is
> possible to understand, scientifically and philosophically.
Really... Please explain rain in terms of the logical relationship
between rational and irrational expression.
>
> That's why the old Greeks said "Know Thyself" and the Hindus "Tat Twam
> Asi" ("Thou art that"), for mind/consciousness is our true identity
> which ultimately represents God which again is the ultimate and
> eternal cause of all the effects called physical phenomena.
When "know thyself" has no verifiable corroborating evidence, it is an
open invitation for self-deception. Stop making stuff up and study
something real, outside yourself.
Kermit
Bill
> On Jun 2, 2:37 pm, Bill <b...@billconner.com> wrote:
>
> <snip>
>
>
> > devoted to the latest rendition of some theory of evolution or I'm a
> > creationist. Simple solutions for simple minds, as usual.
>
> If you are not anti-science, you would be offering scientific
> criticisms. Mainstream evolutionary science, like all sciences, offers
> a testable model that fits the facts. For you to scientifically
> criticize it in any significant way, please:
> 1. Show where at least one class of the data is wrong, or
The issue isn't the data but how it's interpreted. I've posted
numerous times in the thread, "What is Intelligent Design" which is
still current in t.o. explaining some of the phenomena that I believe
are problematic to a theory of evolution. These posts provide enough
detail to make my point. One aspect of my skepticism is that some of
the fundamental assumptions on which the interpretations depend may be
flawed. The data is not the issue, how the data is understood often
is.
> 2. Show how evolutionary theory doesn't fit the facts, or
Since evolutionary theory is the explanatory framework for
interpreting all facts, the facts will always fit. There is no other
framework in which the facts will be interpreted so no other is
considered. It's just the way evolutionary science defines itself.
> 3. Offer an alternative, testable model that does fit all the facts.
See above.
>
> > Even so, if there are grounds for doubt, it there are serious
> > difficulties about evolution, why not talk about them? Since there is
> > never any basis for doubt and there are no difficulties, I'm told,
> > it's perverse to say there are. Since the only people who would make
> > such a claim are creationists, I must be a creationist. It makes any
> > kind of progress pretty hopeless which is, I assume, the whole point.
>
> Well, refusing to be specific is one common tactic of Creationism. I
> suppose that you could be some sort of New Ager, for example. But
> science, as the devil, is in the details. Have one?
What has your opinion of me or my motives got to do with anything? If
your intent is simply to discredit me I suppose you've succeeded (in
t.o. at least).
>
> > My doubts center on the persuasiveness of the arguments for design. It
> > seems that there are some versions of the argument that are at least
> > as plausible as evolution. If there are religious implications, so
> > what? Which is more important that the world is the way we want it to
> > be or that we discover the way the world really is? While there maybe
> > nothing designed in nature, the point is that there appears to be
> > design.
>
> > Bill
>
> If two or more teams of researchers were to look at any of the known
> evolutionary data (genomes, fossils sequences, etc.), how would they
> recognize design? How would they independently see it, what
> specifically would they look for, and how would they test it?
Design is apparent is anything having purpose, a specific complex of
specific functions, an interdependence with other similar entities.
The best evidence is any living organism where numerous complex
structures interact and interdepend with other structures such that
each is necessary for the other. While not necessarily designed they
do very definitely appear designed by any rational definition of
design.
There are structures that can easily be understood as design as a
reasonable first guess. DNA, the skeleton and the musculature of, say,
humans, stereoscopic vision in humans, flight in birds or insects,
self-replication and just about every other structure or function in
any organism. Whether designed or not, the very strong appearance of
design is obvious.
Bill
Ken Denny
wrote:
> There are also a small number of self-identified
> IDers who believe in extraterrestrial, not supernatural, origins.
I doubt that. I know that there are some who use the possibility of
extraterrestrial designers as a way of denying the religiosity of ID,
but it fails the logical test. If life on earth wasn't possible
without an intelligent designer then how are the extraterrestrials
possible without an intelligent designer? At some point the designer
has to be supernatural.
Don Cates
Not necessarily.
>>> In short, ID is an invitation to stop looking for natural explanations.
>>> At least the older cosmological arguments had some backbone and honesty.
>
>
--
Ye Old One
enriched this group when s/he wrote:
>On Jun 3, 10:33 am, Kermit <unrestrained_h...@hotmail.com> wrote:
>> On Jun 2, 2:37 pm, Bill <b...@billconner.com> wrote:
>>
>> <snip>
>>
>>
>> > It's either or, either I am 100%
>> > devoted to the latest rendition of some theory of evolution or I'm a
>> > creationist. Simple solutions for simple minds, as usual.
>>
>> If you are not anti-science, you would be offering scientific
>> criticisms. Mainstream evolutionary science, like all sciences, offers
>> a testable model that fits the facts. For you to scientifically
>> criticize it in any significant way, please:
>> 1. Show where at least one class of the data is wrong, or
>
>The issue isn't the data but how it's interpreted. I've posted
>numerous times in the thread, "What is Intelligent Design" which is
>still current in t.o. explaining some of the phenomena that I believe
>are problematic to a theory of evolution.
And every time you get shot down.
>These posts provide enough
>detail to make my point. One aspect of my skepticism is that some of
>the fundamental assumptions on which the interpretations depend may be
>flawed. The data is not the issue, how the data is understood often
>is.
>
>> 2. Show how evolutionary theory doesn't fit the facts, or
>
>Since evolutionary theory is the explanatory framework for
>interpreting all facts, the facts will always fit. There is no other
>framework in which the facts will be interpreted so no other is
>considered. It's just the way evolutionary science defines itself.
But you can't come up with an alternative.
Wrong.
>The best evidence is any living organism where numerous complex
>structures interact and interdepend with other structures such that
>each is necessary for the other. While not necessarily designed they
>do very definitely appear designed by any rational definition of
>design.
Nope.
>
>There are structures that can easily be understood as design as a
>reasonable first guess. DNA, the skeleton and the musculature of, say,
>humans, stereoscopic vision in humans, flight in birds or insects,
>self-replication and just about every other structure or function in
>any organism. Whether designed or not, the very strong appearance of
>design is obvious.
Nope.
What is clear from most that you list is that design is NOT involved.
>
>Bill
--
Bob.
noctiluca
> On Jun 3, 10:33 am, Kermit <unrestrained_h...@hotmail.com> wrote:
>
> > On Jun 2, 2:37 pm, Bill <b...@billconner.com> wrote:
<snip>
> Design is apparent is anything having purpose, a specific complex of
> specific functions, an interdependence with other similar entities.
> The best evidence is any living organism where numerous complex
> structures interact and interdepend with other structures such that
> each is necessary for the other. While not necessarily designed they
> do very definitely appear designed by any rational definition of
> design.
Interesting. Okay let's address this. Here are some definitions of
design from Dictionary.com,
9. an outline, sketch, or plan, as of the form and structure of a work
of art, an edifice, or a machine to be executed or constructed.
10. organization or structure of formal elements in a work of art;
composition.
11. the combination of details or features of a picture, building,
etc.; the pattern or motif of artistic work: the design on a bracelet.
12. the art of designing: a school of design.
13. a plan or project: a design for a new process.
14. a plot or intrigue, esp. an underhand, deceitful, or treacherous
one: His political rivals formulated a design to unseat him.
15. designs, a hostile or aggressive project or scheme having evil or
selfish motives: He had designs on his partner's stock.
16. intention; purpose; end.
17. adaptation of means to a preconceived end.
Although some, like #16, are particularly overt about it, all of these
definitions infer directly or assume the need for the purposeful
activity of an intelligent agent.
Here are some from Merriam-Webster online,
1: to create, fashion, execute, or construct according to plan :
devise, contrive
2 a: to conceive and plan out in the mind b: to have as a purpose :
intend c: to devise for a specific function or end
3 archaic : to indicate with a distinctive mark, sign, or name
4 a: to make a drawing, pattern, or sketch of b: to draw the plans for
These obviously depend as well upon knowledge of intent, of a
purposeful agency.
Here are some more,
1 a plan; scheme; project
2 purpose; intention; aim
3 a thing planned for or outcome aimed at
4 development according to a plan to find a design in history
5 a secret, usually dishonest or selfish scheme: often with on or upon
to have designs on another's property
6 a plan or sketch to work from; pattern a design for a house
7 the art of making designs or patterns
Seems pretty clear, according to all of these "rational" definitions
of design, that what one *must* have knowledge of or evidence for in
the case of an inference to design (or an appearance to design) is the
involvement of the designing agent. There can be no inference to
design without something that connects putative design to the source
of intent, the designer.
Getting back to your point above then, it will be possible to accept
that "any living organism where numerous complex structures interact
and interdepend with other structures such that each is necessary for
the other" is, or appears, designed only when you provide the logic or
evidence that unambiguously establishes a causal connection to the
author of the design. Until you do so your assertions are without
content.
How many times do we have to ask you to either fulfill this
requirement or demonstrate why doing so is unnecessary?
RLC
Ernest Major
<35a66402-3e30-4f43...@k30g2000hse.googlegroups.com>,
Bill <b...@billconner.com> writes
>>
>> > Even so, if there are grounds for doubt, it there are serious
>> > difficulties about evolution, why not talk about them? Since there is
>> > never any basis for doubt and there are no difficulties, I'm told,
>> > it's perverse to say there are. Since the only people who would make
>> > such a claim are creationists, I must be a creationist. It makes any
>> > kind of progress pretty hopeless which is, I assume, the whole point.
>>
>> Well, refusing to be specific is one common tactic of Creationism. I
>> suppose that you could be some sort of New Ager, for example. But
>> science, as the devil, is in the details. Have one?
>
>What has your opinion of me or my motives got to do with anything? If
>your intent is simply to discredit me I suppose you've succeeded (in
>t.o. at least).
>
--
alias Ernest Major
Ernest Major
>
>Since evolutionary theory is the explanatory framework for interpreting
>all facts, the facts will always fit. There is no other framework in
>which the facts will be interpreted so no other is considered. It's
>just the way evolutionary science defines itself.
>
the process of identifying the gene contents of the genomes of various
species. If it turns out the set of genes in genomes doesn't form a
nested hierarchy correlated with that already inferred from other data
then that would be a large set of facts that didn't fit.
When you claim that the facts will always fit you are effectively
conceding the factuality of evolution,
>> 3. Offer an alternative, testable model that does fit all the facts.
>
>See above.
Even if you were correct in claiming that all conceivable facts can be
fitted to an evolutionary framework, that does not preclude you offering
an alternative testable model that does fit all the facts.
--
alias Ernest Major
Rupert Morrish
They're apparently quite serious, and it's no sillier than any other
religion.
>
-----------------
www.Newsgroup-Binaries.com - *Completion*Retention*Speed*
Access your favorite newsgroups from home or on the road
-----------------
Foucaultian
> I doubt that. I know that there are some who use the possibility of
> extraterrestrial designers as a way of denying the religiosity of ID,
> but it fails the logical test.
There are ET ID folks, but their ideas are as unusual as the stuff put
out by the Discovery Institute. For instance:
http://controlled-hominization.com/
Robert Carnegie
Not really. You've only mentioned one type of possible identifiable
design, "where numerous complex structures interact and interdepend
with other structures such that each is necessary for the other." In
other words "irreducible complexity" - independent entities that co-
operate with a particular effect in the organism that we will call
"useful" unless there is a better word, and which with one of the
entities missing would not be "useful".
It is rather unreasonable to suppose that truly independent entities
appear and are preserved in the variation and naturally selective
evolution of a species by being jointly but not individually "useful"
- most variations are neutral or anti-useful, single useful variations
are real, two simultaneous variations adding up to usefulness is
improbable. However, that is not the only way for "irreducible
complexity" to come about naturally.
Well, anyway, let's look at your list of possible designed things.
- DNA. How are you saying that DNA is irreducibly complex?
(Shh! No one help him!)
- The skeleton. How are you saying that it is irreducibly complex?
You should know that some simple organisms have only the backbone on
its own, and useful bones can be added one at a time.
- Musculature of, say, humans. Well, it's very simple to musculature
of chimpanzees. Again, some species have very simple musculature.
Having just one muscle can be useful.
- Stereoscopic vision in humans. What, you think having one eye would
not be useful?
- Flight in birds or insects. How is that irreducibly complex?
- Self-replication. How is that irreducibly complex? It is a
fundamental function of the simplest living things that they multiply
themselves. They are not so much a living thing with a reproductive
system added, more they are a reproductive system with a living thing
wrapped around it.
- "Just about every other structure or function in any organism."
Well, you've given up trying now, I think.
TomS
<657ec474-6faa-4ca5...@r66g2000hsg.googlegroups.com>, Robert
Carnegie stated..."
It seems to me that the original use of the concept of
"irreducible complexity" was *not* as an indication of
"design", but rather as an indication that there could
not be a path leading to that state: An intermediate
situtation would be non-functional. IC is present when
there are functioning parts X and Y, where the function
of X depends on the functioning of Y, and Y on X, so
that both have to be there, or neither.
There is no particular reason to think that a designer
would design something to be "irreducibly complex", or
that a non-design process would not result in that.
It is a comment on the path from "no X and no Y" to
"both X and Y". It is not about what kind of agency
produces the path. It is not about "design" or the lack
of "design".
To take examples of things that we might wonder about
whether or not they were designed, we can see that
"irreducible complexity" doesn't give us much help in
determining that:
* A rock that looks like it might have been shaped
deliberately to be a cutting tool; or maybe it was
just formed by frost or a landslide.
* A radio signal from outer space which might be sent
by an intelligent alien civilization; or maybe it is
just a special kind of rotating star.
--
---Tom S.
"As scarce as truth is, the supply has always been in excess of the demand."
attributed to Josh Billings
Bill
I'm not sure that, "Wrong", "Nope" or mere assertion of any kind is
very helpful. All you show is that you disagree without saying why.
Bill
Bill
Mainly because of a refusal to even admit to a possibility of design
in the first place. Somewhere else I did suggest that, if the
possibility of design is granted (even provisionally), characteristics
of a probable designer can be inferred from the design itself. From
these inferences it would be possible to further infer intent and
maybe purpose. All of this of course only if design is possible. Since
design is deemed impossible and, most likely absurd, why bother
talking about a designer?
Bill
Bill
You brought up the irreducibly complex hypothesis so you can say
whatever you want about it. I neither cited nor depend on it so its
application to my points is only coincidental. As you've demonstrated,
every phenomenon will be interpreted in the explanatory framework of a
theory of evolution. That framework maybe flawed but we'll never know
since it's never examined.
Bill
noctiluca
I try very hard to avoid going to the liar card, but you're making it
extraordinarily difficult. As far as I can tell, virtually everyone
who has discussed this issue with you has not only admitted to the
possibility of design but been quite willing to be convinced of it
should you at some point deign to deal in specifics. You have flayed
this strawman often enough that it would now be perverse to believe
you are unaware of its disingenuousness.
The evidence suggests that admitting the possibility of design is
*not* really what you are after, for one who admits that possibility
is still not obligated to accepting its assumption as part of an
argument. What you seem to want is that your ideas regarding design
are swallowed whole without any critical analysis because, well, you
just know them to be true.
But I will once again act as if you mean what you say, and offer
another chance to deal with the issue honestly. You said,
"...if the possibility of design is granted (even provisionally),
characteristics of a probable designer can be inferred from the design
itself. From these inferences it would be possible to further infer
intent and maybe purpose."
Let me state this as plainly as I can. I unequivocally grant the
possibility of design. I deal with design every day (as do we all). I
recognize its existence, I accept its influence. And in saying so I am
not disallowing the possibility of supernatural design. I am willing
to address this phenomenon using the same critical faculties I try to
bring to every object of my interest.
That approach, however, obliges me to ask you now to go ahead and
identify the characteristics of design you see in living organisms and/
or those qualities of a designer you infer from the appearance of
living organisms. You should be able to understand that while we are
quite capable of accepting a premise for argument's sake, it would be
foolish of us to assume the very conclusion that is at issue. You
infer design. We grant that design is possible. The rest is simple,
it's time for you to delineate your argument.
I accept the possibility of a designer of life, and I am willing to be
persuaded by the evidence you will now present.
RLC
> Bill
Ye Old One
I replied "wrong" because the statement you made was incorrect.
I replied "nope" because the statements you made were incorrect.
Three incorrect statements in a row like that means that you really
need to go away and learn something about science in general and
biology/evolution in particular. It is not my place to educate you,
especially when your other posts indicate you do not take education at
all.
>
>Bill
--
Bob.
Bill
Maybe so. I resort to generalities from time to time so I may have
been hasty. There have been many posts that have effectively dismissed
the possibility of design based on a supposedly better explanation of
the creation and development of life by wholly natural processes. This
is a superficial acceptance of a concept of design yet a denial of any
possibility of actual design. The more I see the standard objections,
the more interesting the whole question becomes.
While we can agree that design is possible, the requirement that
everything in nature must always have a wholly natural origin and be
explained in wholly natural terms that agrees with wholly naturalistic
theory, is pretty much the same as saying design will always be
impossible. The entire question is reduced to a kind of literalistic
materialism whereby everything that exists must conform to
philosophical assumptions about nature itself. Accepting that design
is possible while explaining everything in a context that excludes
design, is meaningless.
All of that is the philosophical problem that keeps getting in the
way. To accept design in nature implies a designer and this designer
doesn't seem to fit the philosophical requirement that everything in
nature is wholly natural. Therefore a designer is impossible and there
can be no design. The whole thing just wraps back in on itself.
>
> The evidence suggests that admitting the possibility of design is
> *not* really what you are after, for one who admits that possibility
> is still not obligated to accepting its assumption as part of an
> argument. What you seem to want is that your ideas regarding design
> are swallowed whole without any critical analysis because, well, you
> just know them to be true.
>
> But I will once again act as if you mean what you say, and offer
> another chance to deal with the issue honestly. You said,
>
> "...if the possibility of design is granted (even provisionally),
> characteristics of a probable designer can be inferred from the design
> itself. From these inferences it would be possible to further infer
> intent and maybe purpose."
>
> Let me state this as plainly as I can. I unequivocally grant the
> possibility of design. I deal with design every day (as do we all). I
> recognize its existence, I accept its influence. And in saying so I am
> not disallowing the possibility of supernatural design. I am willing
> to address this phenomenon using the same critical faculties I try to
> bring to every object of my interest.
>
> That approach, however, obliges me to ask you now to go ahead and
> identify the characteristics of design you see in living organisms and/
> or those qualities of a designer you infer from the appearance of
> living organisms.
I've done that. The response is, usually, that everything that can be
understood as a product of design is better explained as -only- the
consequence of natural processes. Since the assumption is that
everything in nature is fully explained by nature, there's no need to
posit a design. But the logic is convoluted. If we decide that nature
fully explains itself, then that's what we'll see; everything will
always be understood in that context. All philosophies tend to that
kind of error. It's no different than having a Marxist explain
economics.
>You should be able to understand that while we are
> quite capable of accepting a premise for argument's sake, it would be
> foolish of us to assume the very conclusion that is at issue. You
> infer design. We grant that design is possible. The rest is simple,
> it's time for you to delineate your argument.
What about my comments regarding DNA? It's as good an example as any
of design. There are arguments against it of course, but they depend
on the assumption that a natural explanation is always superior
because it's natural. This, to me, is just a philosophical proposition
and one, ironically, that cannot be demonstrated by natural science.
It's just a starting place, a working hypothesis that many here
mistake as established fact. I tend toward the more rational
conclusion that the whole question is open, even if not openly
discussed.
Bill
Bill
So all you have to do is say you disagree without saying why and
everything is settled. Well that's certainly nice and tidy. Wish my
world were that simple.
Bill
Ye Old One
enriched this group when s/he wrote:
There is no evidence for that.
> Somewhere else I did suggest that, if the
>possibility of design is granted (even provisionally), characteristics
>of a probable designer can be inferred from the design itself.
But there is no evidence for design or a designer.
> From
>these inferences it would be possible to further infer intent and
>maybe purpose.
But as there is no evidence for design you don't even get started.
>All of this of course only if design is possible. Since
>design is deemed impossible and, most likely absurd, why bother
>talking about a designer?
Yet you seem to. Is that down to ignorance or stupidity?
>
>Bill
>
--
Bob.
noctiluca
> On Jun 4, 2:32 pm, noctiluca <robertlc...@hotmail.com> wrote:
>
>
>
> > On Jun 4, 10:21 am, Bill <b...@billconner.com> wrote:
>
> > > On Jun 3, 3:05 pm, noctiluca <robertlc...@hotmail.com> wrote:
>
> > > > On Jun 3, 10:08 am, Bill <b...@billconner.com> wrote:
>
> > > > > On Jun 3, 10:33 am, Kermit <unrestrained_h...@hotmail.com> wrote:
>
> > > > > > On Jun 2, 2:37 pm, Bill <b...@billconner.com> wrote:
<snip>
> > > > Getting back to your point above then, it will be possible to accept
This is not a dismissal of the possibility of design, this is a
provisional conclusion based upon available evidence. That is how
critical thinking works, that is how Ockham's Razor, which you claim
some familiarity with, works. We go where the evidence points, not
where our wishfulness (or yours) pulls.
> This is a superficial acceptance of a concept of design yet a denial of any
> possibility of actual design. The more I see the standard objections,
> the more interesting the whole question becomes.
Yet the less you seem to understand. Apparently acceptance of the
possibility of design, in your parlance, means an utterly credulous
willingness to see it wherever its existence or appearance has been
blithely alleged. It's not only scientists who do not operate in that
fashion, it's most reasonable, thinking people (and I include many
theists in that group).
> While we can agree that design is possible, the requirement that
> everything in nature must always have a wholly natural origin and be
> explained in wholly natural terms that agrees with wholly naturalistic
> theory, is pretty much the same as saying design will always be
> impossible.
No, it's not. It's pretty much the same as saying the non-natural
hypothesis has proven impotent throughout the history of science to
the degree that it's going to take hard evidence, as opposed to some
believer's assurance, for it to be considered a productive area of
pursuit.
The surest indication of your irrationality is that what you are
really saying is: People need to believe the evidence is there in
order to perceive it. If this is the kind of ordering principle upon
which you base your logic it's no surprise that it goes so wildly
awry.
> The entire question is reduced to a kind of literalistic
> materialism whereby everything that exists must conform to
> philosophical assumptions about nature itself. Accepting that design
> is possible while explaining everything in a context that excludes
> design, is meaningless.
It's hard for me to believe that anyone can actually write this kind
of nonsense without being (intentionally) satirical. Your statement
above is virtually indistinguishable in form and content from:
"Accepting that God is possible while explaining everything in a
context that excludes God, is meaningless." Would you agree with this
sentiment? Certainly most theists, especially those who are
scientists, wouldn't. Or do you invoke God's influence when trying to
fix a leaky faucet?
> All of that is the philosophical problem that keeps getting in the
> way. To accept design in nature implies a designer and this designer
> doesn't seem to fit the philosophical requirement that everything in
> nature is wholly natural. Therefore a designer is impossible and there
> can be no design. The whole thing just wraps back in on itself.
No, your circuitous and painful "logic" wraps your own philosophical
assumptions into weak arguments.
Which should give you a clue that all you have offered is unevidenced
assertions. You have given us nothing specific, and where you've
submitted some vague generalized character it has been without any
kind of evidential connection to your proposed designer or design
process. When natural processes can account for a phenomenon we don't
usually go out of our way to look for a non-natural explanation. When
my faucet leaks, I look for a loose gasket.
>Since the assumption is that
> everything in nature is fully explained by nature, there's no need to
> posit a design. But the logic is convoluted. If we decide that nature
> fully explains itself, then that's what we'll see; everything will
> always be understood in that context. All philosophies tend to that
> kind of error. It's no different than having a Marxist explain
> economics.
I am, at this point, pretty well convinced that this will be my last
post in response to you. The reason is that you think these things
through so poorly that it's clear, to me at least, you cannot hold up
your end of a reasoned discussion. The above is a perfect example so
let's look at it briefly.
You compare naturalist explanation of empirical reality to Marxist
explanation of economics, saying they're no different. The suggestion
is, of course that the naturalist's approach is but one of multiple
equivalent paths to an empirical understanding of reality. But there
are obviously plenty of other recognizable, documentable, investigable
political approaches to economics besides Marxism. Everyone, including
Marxists, will acknowlege this. On the other hand, there is currently
no other approach to the study of natural reality that produces the
repeatably reliable empirical results (regardless of philosophical
affiliation) that naturalistic science does. Your analogy is utterly
flawed.
You are still in damage control mode. You don't seem capable of
rational discourse that goes beyond repetition of post-modern
platitudes, I'm just not sure whether you believe them or not.
> >You should be able to understand that while we are
> > quite capable of accepting a premise for argument's sake, it would be
> > foolish of us to assume the very conclusion that is at issue. You
> > infer design. We grant that design is possible. The rest is simple,
> > it's time for you to delineate your argument.
>
> What about my comments regarding DNA? It's as good an example as any
> of design.
I'm not going to torture myself with this profitless exchange any
longer, but perhaps someone with more fortitude than I will pick up on
this if you answer the following question (posed for the umpteenth
time),
What specifically about DNA appears designed to you?*
[*This means we are looking for some discrete character the qualities
of which lead a rational observer to prefer an explanation that
invokes purposeful agency over one that depends entirely upon
undirected processes. "Complexity," for example, doesn't qualify
because there is ample evidence that natural processes can and do lead
to complexity. "Interactivity," "structural interrelatedness" and all
other such gossamer notions suffer from the same difficulty.]
RLC
> Bill
Ye Old One
No. All I did was to point out you were in error - three times. Stop
making errors and I'll stop pointing them out to you.
>
>Bill
--
Bob.
Bill
You haven't pointed any out yet. I'm still waiting.
Bill
Bill
>
Since you're not going to read this, I declare myself the winner. This
entire exchange has been about appearances not about what the
appearances imply or even if they are correctly understood. Things
appear this way or that based, mostly, on what we already believe
about they way they should be. The catalog of errors far exceeds that
of (apparently) correct conclusions, so the odds always favor error in
whatever we believe.
You seem to believe I have some nefarious agenda. Maybe I'm in league
with the demented creationists or maybe the ID guys pay a commission
for each fence straddler I send their way. Maybe I just find the
question interesting. Based on the arguments I've seen here everything
about the question of design is deserving of more thought, by me and
everyone else posting here.
Bill
Bill
Maybe there's been no really useful answers one way or the other. That
covers the ignorance part, the stupidity part is that we keep
hammering away, getting nowhere. Since everyone is 100% right about
everything, we'll keep getting nowhere.
Bill
Mark Isaak
> [...]
> Since evolutionary theory is the explanatory framework for
> interpreting all facts, the facts will always fit.
That is not quite true. Like everything in science, the facts only fit
until they don't. Evolutionary theory has been changed before when new
facts didn't fit. It may very well change again.
> There is no other
> framework in which the facts will be interpreted so no other is
> considered. It's just the way evolutionary science defines itself.
Are those sentences suppose to mean anything?
> Design is apparent is anything having purpose, a specific complex of
> specific functions, an interdependence with other similar entities.
Shrug. If that's what you want to call design, go ahead.
> The best evidence is any living organism where numerous complex
> structures interact and interdepend with other structures such that
> each is necessary for the other. While not necessarily designed they
> do very definitely appear designed by any rational definition of
> design.
>
> There are structures that can easily be understood as design as a
> reasonable first guess. DNA, the skeleton and the musculature of, say,
> humans, stereoscopic vision in humans, flight in birds or insects,
> self-replication and just about every other structure or function in
> any organism.
As you know by now, most of those can be entirely explained by evolution
without any purposeful intervention, and there is no indication anywhere
that DNA or self-replication should be exceptions. Furthermore, we know
that evolution does occur. Since we know that mindless evolution occurs
and that it can explain design, why should we bother considering any
other desinger?
--
Mark Isaak eciton (at) earthlink (dot) net
"Voice or no voice, the people can always be brought to the bidding of
the leaders. That is easy. All you have to do is tell them they are
being attacked, and denounce the pacifists for lack of patriotism and
exposing the country to danger." -- Hermann Goering
Robert Carnegie
You're putting words in my mouth. I want to make it clear that your
model of typical design of "numerous complex structures interact and
interdepend with other structures such that each is necessary for the
other" is, as far as I can tell, merely the well-understood concept of
"irreducible complexity". Multiple structures interdepend:
complexity. Each is necessary for the other to be useful:
irreducible.
If natural evolution is a sufficient explanation for the history of
life on earth, then evolution holds no further interest for non-
specialists. But a hypothesis or theory of natural evolution
represents a choice to exclude intentional design in nature from our
worldview. That is an appropriate choice if it leaves you with a
sufficient explanation for the history of life on earth. It is
inappropriate if there is evidence of design in life. That's the
simple truth: correct science and incorrect science are discriminated
by evidence.
To make a design hypothesis worth looking at, you need to provide an
argument for distinguishing design from natural evolution, and a case
with evidence that can be justified as a case of design by such an
argument. As the former, I repeat, you have proposed irreducible
complexity. That is a good argument, although there are feasible
developments that produce a situation of irreducible complexity
without passing through a stage where useless features that will be
useful later are preserved. It may be not the only possible argument,
but it's up to you to make any others. I don't see that your cases of
evidence have irreducible complexity, however.
And for someone who claims not to have a stake in the intelligent
design doctrine, you are spending a lot of time trying to find a
defence for it. Can't you just accept that folks who know have a
rational basis to reject it - or, if you don't accept that, can you
provide an argument of your reason for not accepting it?
Robert Carnegie
Perhaps we could turn this around and consider reasons to /doubt/ that
DNA is a /good/ design.
For one thing, there are distinct DNA "word" codes that do nothing, or
that do the same thing. That's wasteful.
For another, having similar DNA in different species means that one
species can catch a virus from another. Stop me if I'm wrong, but
having a different DNA code alphabet in humans and in animals would
make animal rabies ineffective in humans?
And so on.
Robert Carnegie
> On Jun 2, 3:12�pm, Foucaultian <drfosternotfromglouces...@gmail.com>
> wrote:
>
> > There are also a small number of self-identified
> > IDers who believe in extraterrestrial, not supernatural, origins.
>
> extraterrestrial designers as a way of denying the religiosity of ID,
> without an intelligent designer then how are the extraterrestrials
> possible without an intelligent designer? At some point the designer
> has to be supernatural.
But we should not be discussing whether life can't evolve as it has
without a designer, but whether life /did/ evolve as it has without a
designer. If life on Earth was designed by ancient flying saucer men,
it is acceptable to suppose that the flying saucer men are a product
of natural evolution on their own planet. And so the flying saucer
hypothesis of life on Earth needs to be shot down some other way.
Ye Old One
noctiluca
> noctiluca wrote:
> > On Jun 4, 2:18�pm, Bill <b...@billconner.com> wrote:
> > > What about my comments regarding DNA? It's as good an example as any
> > > of design.
>
> > I'm not going to torture myself with this profitless exchange any
> > longer, but perhaps someone with more fortitude than I will pick up on
> > this if you answer the following question (posed for the umpteenth
> > time),
>
> > What specifically about DNA appears designed to you?*
>
> > [*This means we are looking for some discrete character the qualities
> > of which lead a rational observer to prefer an explanation that
> > invokes purposeful agency over one that depends entirely upon
> > undirected processes. "Complexity," for example, doesn't qualify
> > because there is ample evidence that natural processes can and do lead
> > to complexity. "Interactivity," "structural interrelatedness" and all
> > other such gossamer notions suffer from the same difficulty.]
>
> Perhaps we could turn this around and consider reasons to /doubt/ that
> DNA is a /good/ design.
Well I would normally quibble here about whether there are any reasons
to even think in terms of design, good or bad. But the upshot seems to
be that Bill doesn't think "design" as an hypothesis requires any
corroborating observations or arguments whatsoever. For Bill, the word
design - which is in his usage a euphemism for God - loses those
referents that distinguish it from anything that is not-design.
I don't think Bill is substantially different from most ID proponents
in this (though he doesn't hide it nearly as well). It is a strong
theme running through much of the ID worldview that all one has to do
is mention "design" and normal semantic and rhetorical questions just
disappear. There are no empirical or logical obligations one has to
meet beyond asserting something isn't natural. All one has to do is
say "This is designed" and apparently all the burden immediately falls
upon those who disagree.
As I've opined before, I think this is more than simple
disingenuousness and thoughtlessness. I think the nature of God as
permeating everything internal and external is so strong in some
people's worldview that they simply cannot conceive of a world without
his influence. This inability to see things as the rest of us do
reflects in the consequent illogic of their arguments.
> For one thing, there are distinct DNA "word" codes that do nothing, or
> that do the same thing. That's wasteful.
>
> For another, having similar DNA in different species means that one
> species can catch a virus from another. Stop me if I'm wrong, but
> having a different DNA code alphabet in humans and in animals would
> make animal rabies ineffective in humans?
>
> And so on.
I don't suppose any "so ons" would really matter to Bill. Anything
observations of that kind simply indicate that you are unwilling to
accept the possibility of design, regardless of whether you accept the
possibility of design.
RLC
Bill
You agree that DNA is a code that determines features in an organism,
that one organic structure depends on another for its development.
This code then, is critical for the development of the entire organism
yet you see no design. There is no design, you seem to be saying,
because there are instances where the code or its effects appear
flawed. The point to me, is that the code itself is a very good
indicator of design. Whether it's a "good" code or produces "good"
results in every case is completely irrelevant to a question of
design. There may not be any deliberate design in nature but until
there are viable counter-arguments, it remains a persuasive
alternative. Your's is not a viable counter-argument.
Bill
Bill
I don't get the snide hostility part. I've tried to keep the whole
question of design to mere appearance, nothing more. I have not
dogmatically asserted that anything actually is designed, only that
some things have the appearance of design. Dogmatically asserting that
these appearances do not exist is pretty useless and gets us nowhere.
In the simplest case I cited DNA as a very good example of something
having this appearance of design. No one has really refuted that
except to say either that there is no such appearance or that, if
designed it's a very poor design. Yet what else in nature has arranged
molecules into a code that stores and transfers information? This
transfer of information determines the characteristics of other
organic structures which, ultimately organize into living, self-
replicating and survivable organisms. The whole complex of
interdependent structures is determined by the coding in the DNA. This
certainly appears as a consequence of design by any rational
understanding of the word design.
There's nothing to read between the lines, no need to impute some
hidden agenda, just a straightforward observation that has been
dismissed without being refuted. Most often this appearance is denied
since it implies a designer, to which I say, so what? Other quibbles
concern how to best distort the meaning of the word design so it can't
possibly apply to anything in nature. All of that is beside the point.
Follow what I have said and there is something interesting to discuss
that is worthy of more thought than any here are willing to think
about.
Bill
hersheyh
DNA is a chemical polymer whose sequence is *sometimes* used as a code
in living organisms (most of the DNA in many organisms has no sequence-
relevant coding property, and even less has protein encoding
sequence). Outside of a living organism, DNA is nothing but a
chemical polymer.
> that one organic structure depends on another for its development.
> This code then, is critical for the development of the entire organism
> yet you see no design.
DNA without an organism is dead, or in the case of some viruses, in
chemical stasis.
> There is no design, you seem to be saying,
> because there are instances where the code or its effects appear
> flawed. The point to me, is that the code itself is a very good
> indicator of design.
It would if genes had to evolve by starting from random monomers and
were assembled by random synthesis. But 'new' gene sequences evolve
by modification of pre-existing *functional* genes or duplicates of
those genes. Real novelties often involve chimeric duplicates. Since
new genes arise by modification of pre-existing sequences, that is an
*evolutionary* descent with modification process, not a made-from-raw-
materials manufacturing process from some hypothetical design
blueprints. If you want to talk about the evidence that says that
genes in organisms are derived by common descent, we can do so.
> Whether it's a "good" code or produces "good"
> results in every case is completely irrelevant to a question of
> design. There may not be any deliberate design in nature but until
> there are viable counter-arguments, it remains a persuasive
> alternative. Your's is not a viable counter-argument.
Since you keep insisting that if genes are *designed* they cannot be
the product of 'descent with modification', perhaps you could point
out the evidence that says that genes must be magically poofed
together from some imaginary blueprint. You know, evidence like where
and when this "design' was produced or manufactured.
>
> Bill
Bill
Isn't this what is observed? Call by whatever term you like, the
phenomenon is real, is it not? While the irreducible part may be
arguable, the serendipitous arrangement of these structures can't just
be waved away as trivial.
>
> If natural evolution is a sufficient explanation for the history of
> life on earth, then evolution holds no further interest for non-
> specialists. But a hypothesis or theory of natural evolution
> represents a choice to exclude intentional design in nature from our
> worldview. That is an appropriate choice if it leaves you with a
> sufficient explanation for the history of life on earth. It is
> inappropriate if there is evidence of design in life. That's the
> simple truth: correct science and incorrect science are discriminated
> by evidence.
I agree. And, as I've said, there is a choice as to how data is
understood. The choice of what to include and exclude is determined by
how one first decides nature is, prior to a study of how nature is. A
useful hypothesis for science obviously, but somewhat arbitrary. It
also creates a category of incorrect science that could very well be
true even if not science. It all seems very artificial. The choice to
exclude design will guarantee that nothing will ever appear designed
because design itself is impossible. This is fundamentally a
philosophical choice. My only objection is that many posting here
claim that the choice is data driven when it's obvious that's it's the
other around.
>
> To make a design hypothesis worth looking at, you need to provide an
> argument for distinguishing design from natural evolution, and a case
> with evidence that can be justified as a case of design by such an
> argument. As the former, I repeat, you have proposed irreducible
> complexity. That is a good argument, although there are feasible
> developments that produce a situation of irreducible complexity
> without passing through a stage where useless features that will be
> useful later are preserved. It may be not the only possible argument,
> but it's up to you to make any others. I don't see that your cases of
> evidence have irreducible complexity, however.
Again, I do not propose irreducible complexity though it does seem
applicable in some cases. Since we are agreed that science, especially
biology, has determined that nothing is designed, then design cannot
be valid even if true. That's the risk of doing science as it's
presently defined and I have no major objections since it seems to
work. My main objection is that many here don't make the distinction
between a working hypothesis for the study of nature and nature
itself.
>
> And for someone who claims not to have a stake in the intelligent
> design doctrine, you are spending a lot of time trying to find a
> defence for it. Can't you just accept that folks who know have a
> rational basis to reject it - or, if you don't accept that, can you
> provide an argument of your reason for not accepting it?
Since my meager contributions are routinely dismissed, there's no
point in offering them again. If some of my observations coincide with
observations from some other group, it's accidental; I only speak for
myself. We agree that the interpretive framework of evolution will
determine how we understand nature which really says it all.
Bill
Greg Guarino
wrote:
>Yet what else in nature has arranged
>molecules into a code that stores and transfers information?
I think we refer to the DNA "code" too easily. A code, as it is
usually understood, is a symbolic representation of something else.
For example, the letters on this page are a visual code for spoken
syllables, words and the concepts the words represent. "P-I-P-E" is
not a pipe, it is an encoded representation of the English (and
French, with apologies to Magritte) language vocal and written
symbols for a smoking gadget, among other things.
ACCATAGGATCTGGACAGTAGTCCAGA is code, and carries information to human
beings who designed the code, and know how to glean information from
it. Information is something human beings (and possibly other
creatures) can know and learn, sometimes from symbolic
representations. It is not obvious to me that DNA is "code" or that it
transfers information. Who does it "transfer" the information to?
DNA is not representative of something else, it is the "thing" itself.
It is a chemical whose properties cause it to, under certain
circumstances, react with other chemicals, producing more chemicals.
If it is a code, then in a sense every chemical is, but we don't
usually call H2O a "code" for ice, even though its properties
determine ice's crystal geometry.
None of this proves that our universe was not "designed" to produce
fun things like stars, chemicals and life, but it does show the
weakness of the argument that labels DNA a "code" and then asserts
that a code must have an author.
Greg Guarino
Paul J Gans
Yeah. These arguments are either circular or unprovable. The
only way out of *something* way back when being naturally evolved
is the notion that there was a first living thing that always was.
Or, put in a less supernatural way, to posit a living entity about
which one is not allowed to ask quesition.
That, of course, is the Rule of Authority. *I* say that thou shalt
not ask certain questions OR ELSE.
It certainly isn't science and certainly forecloses all discussion.
Thus if we rule out "and you can't ask questions", we are left with
the natural origin of life at some point somewhere -- and you *are*
allowed to ask questions about it, do experiments, etc., etc.
--
--- Paul J. Gans
Mark Isaak
> There's nothing to read between the lines, no need to impute some
> hidden agenda, just a straightforward observation that has been
> dismissed without being refuted.
You're not listening. It *has* been refuted. First, DNA looks
undesigned, for a variety of reasons which I won't repeat yet again.
Second, there is no *evidence* for design except your word, and with all
due respect, your word does not mean much to scientists. Scientists will
be more than happy to propose design as a hypothesis as soon as there is
evidence for design which is not just as easily explained by previously
known processes.
hersheyh
The operative phrase is "in an organism". DNA, by itself, is nothing
but a polymer that looks like snot. And that should be *some*
sequences within the polymer, since not all DNA encodes anything. The
*function* you ascribe to DNA only occurs under specific
circumstances: within an organism that is chemically active in the
sense of "being alive". You cannot then claim that life is designed
because DNA's properties that only exist when a system is alive show
that DNA is designed.
> that one organic structure depends on another for its development.
It isn't *structure* that makes something "alive". If I were to
freeze you, you would still have almost all the *structure* of life,
but not the chemical reactions. You would, despite having the
*structure* of life, be very much dead. Structure is important, but
structure is not what defines something as "alive".
> This code then, is critical for the development of the entire organism
> yet you see no design. There is no design, you seem to be saying,
> because there are instances where the code or its effects appear
> flawed.
He is saying that there are clear examples where any half-way
intelligent designer (aka, a human) would not have made the code the
way it is *if* one were to design it from scratch. For example, the
genetic code (the match of 3-letter nucleotide run to amino acid) is
degenerate, which means one is not taking full advantage of the
available code space, even though there are some potentially useful
amino acids that could be coded for that now must be modified by
changing a 'universal' amino acid after it gets incorporated.
Selenocysteine comes to mind. Also the code, although canonical, is
not universal. There are organisms who do very well with a non-
canonical code, thank you. Ciliated protozoans, for example. If
humans had a more drastically non-canonical code, we would likely have
fewer viral infections, if the viruses had the canonical code.
Of course, the nature of the code (as well as the changes seen) make
perfect sense if they were the consequence of common descent.
> The point to me, is that the code itself is a very good
> indicator of design.
I, as I keep pointing out, think that the evidence supports the idea
that the canonical code is, largely, a 'frozen accident of history'.
Very early history since the canonical code is primary and variants
from it are secondary. But since any observation that is consistent
with natural explanation is also consistent with a designer that works
through or produces that observation, *any* observation can be
*believed* to be due to design.
I presume that you think that, when you say "design", it necessarily
means that it is done by supernatural rather than natural processes
and that all the evidence for the natural processes of common descent
by modification are lies intended to deceive us. Rather that
something about life (still not sure just what) must have been
magically poofed into existence by some magical poofer.
> Whether it's a "good" code or produces "good"
> results in every case is completely irrelevant to a question of
> design.
But does raise questions about the "intelligence" of the designer,
unless one is positing a designer who chooses to work through natural
processes and mechanisms.
> There may not be any deliberate design in nature but until
> there are viable counter-arguments, it remains a persuasive
> alternative. Your's is not a viable counter-argument.
Isn't the ball in your court? You have to present some reason why the
designer did not work through common descent by modification, as the
evidence of nature supports, but by some other (as yet unspecified)
mechanism that somehow at some time and some place did something (as
yet unspecified) somehow (as yet unspecified) to produce something
different than what would be produced by common descent with
modification.
>
> Bill
Mark Isaak
> On Jun 4, 9:35 pm, Robert Carnegie <rja.carne...@excite.com> wrote:
>> [...] Multiple structures interdepend:
>> complexity. Each is necessary for the other to be useful:
>> irreducible.
>
> Isn't this what is observed? Call by whatever term you like, the
> phenomenon is real, is it not? While the irreducible part may be
> arguable, the serendipitous arrangement of these structures can't just
> be waved away as trivial.
Yes, multiple interedependent structures, mutually functional, do exist.
What more evidence for evolution could you want?
You seem to have the impression that evolution just sits around on the
beach doing nothing more than posing for pictures when the
scientist-pavarottsi come by. Not hardly. Evolution has been busy.
Evolution can accomplish things that boggle the most intelligent of
intelligent designers. Ever heard of evolutionary algorithms? They get
used by designers where other design methods fail. And among other
things, they can produce complex mutually interdependent functional
structures. In fact, they are ideal for producing complex mutually
interdependent functional structures.
> The choice to
> exclude design will guarantee that nothing will ever appear designed
> because design itself is impossible.
The only one talking about excluding design is you. Scientists routinely
accept design when evidence indicates it.
Bill
Let's not do the, "re-define words to fit new circumstances" trick
just yet. Code in the sense I used it means information is the same
way that it's used in programming a computer. Pretty straightforward.
The, "It is not obvious to me that DNA is "code" or that it transfers
information. Who does it "transfer" the information to?", is an odd
twist. You are saying that information transfer is only possible
between intelligent entities which sounds a lot like yet another re-
definition. What is it that astronomers study? Isn't it starlight and
doesn't that starlight contain information? Isn't that information
encoded in its spectra? Little wonder that most of the responses I see
seem merely argumentative as if there's some imperative to say
something even when there's nothing to say.
Maybe I just misunderstood.
Bill
Bill
> On Thu, 05 Jun 2008 08:35:30 -0700, Bill wrote:
> > There's nothing to read between the lines, no need to impute some
> > hidden agenda, just a straightforward observation that has been
> > dismissed without being refuted.
>
> You're not listening. It *has* been refuted. First, DNA looks
> undesigned, for a variety of reasons which I won't repeat yet again.
> Second, there is no *evidence* for design except your word, and with all
> due respect, your word does not mean much to scientists. Scientists will
> be more than happy to propose design as a hypothesis as soon as there is
> evidence for design which is not just as easily explained by previously
> known processes.
>
Do scientists post in t.o.? I know there are no logicians posting here
although the philosophers are well represented. Since no evidence for
design will ever be seen as evidence, I suppose there can be no
designer.
Bill
Max
Why? You yourself wrote that intelligence is not necessary for the
transfer of information.That it is complex and important for
development says nothing about design. It is constructed trillions of
times in each individual with no need for intelligent intervention.
All other searches for design in scientific circles (seti,
anthropology) start with at least a hypothetical understanding of the
theorized designers.
Rupert Morrish
> noctiluca wrote:
>> On Jun 4, 2:18�pm, Bill <b...@billconner.com> wrote:
>>> What about my comments regarding DNA? It's as good an example as any
>>> of design.
>> I'm not going to torture myself with this profitless exchange any
>> longer, but perhaps someone with more fortitude than I will pick up on
>> this if you answer the following question (posed for the umpteenth
>> time),
>>
>> What specifically about DNA appears designed to you?*
>>
>> [*This means we are looking for some discrete character the qualities
>> of which lead a rational observer to prefer an explanation that
>> invokes purposeful agency over one that depends entirely upon
>> undirected processes. "Complexity," for example, doesn't qualify
>> because there is ample evidence that natural processes can and do lead
>> to complexity. "Interactivity," "structural interrelatedness" and all
>> other such gossamer notions suffer from the same difficulty.]
>
> Perhaps we could turn this around and consider reasons to /doubt/ that
> DNA is a /good/ design.
>
> For one thing, there are distinct DNA "word" codes that do nothing, or
> that do the same thing. That's wasteful.
Here's another: life on Earth only uses four DNA "letters", but there
are at least 20 other chemicals that work as "letters" (i.e. DNA will
replicate those letters in the right conditions).
>
> For another, having similar DNA in different species means that one
> species can catch a virus from another. Stop me if I'm wrong, but
> having a different DNA code alphabet in humans and in animals would
> make animal rabies ineffective in humans?
>
> And so on.
>
-----------------
www.Newsgroup-Binaries.com - *Completion*Retention*Speed*
Access your favorite newsgroups from home or on the road
-----------------
DuhIdiot
news:1107eb18-4850-4720...@y38g2000hsy.googlegroups.com
decided this was a worthy use of a keyboard:
The few vague examples of such "evidence" you offer--when you can stop
handwaving and whining about how mean the bad old evolutionists are long
enough to offer anything--are better explained by natural common descent than
by the meddling of a magic sky wizard.
The noise little Johnny hears in his closet at night is similarly better
explained as the pile of toys he crammed in there falling over, however much
more exciting Johnny himself might find his boogey-man theory.
--
ВВВВВВВВВВВВВВВВВВВВВВВ
No S-P-A-M in my email.
.
Greg Guarino
wrote:
I think that information is pretty difficult to define, as do most
people who have thought about it very much. You treat it as if it is
simply obvious.
And let's not do the "don't answer any of the specifics in the other
post" either, OK? What about the water example? What about "code" as
something that is symbolic of something else? That seems to be
necessary component of any definition of "code".
>Code in the sense I used it means information is the same
>way that it's used in programming a computer. Pretty straightforward.
More simplistic than straightforward. Now "code" and "information" are
roughly the same thing? Does DNA really seem like a computer program
to you? Or is it more like the computer? To me neither seems a very
good analogy.
>The, "It is not obvious to me that DNA is "code" or that it transfers
>information. Who does it "transfer" the information to?", is an odd
>twist.
Explain why.
>You are saying that information transfer is only possible
>between intelligent entities which sounds a lot like yet another re-
>definition.
OK. What is YOUR definition of information? I won't pull a Backspace
on you. Just try to express what you think it is. If information is
not a mental phenomenon, what is it? And what is it NOT? Unles we
reference human perspective, how can we tell information from
non-information, or more from less?
>What is it that astronomers study? Isn't it starlight and
>doesn't that starlight contain information? Isn't that information
>encoded in its spectra? Little wonder that most of the responses I see
>seem merely argumentative as if there's some imperative to say
>something even when there's nothing to say.
>
>Maybe I just misunderstood.
I think so.
Does starlight "contain" information? How would we answer that
exactly? Have you really thought about it? Does the starlight from a
galaxy contain more information than the starlight from a single star?
What about the light from a flashlight? Would any of them contain
information if there were no sentient observers to receive it?
Is information "encoded" in starlight spectra? Think about that a bit.
Can you see that the spectrum lines we study are themselves mental
representations? In what way could the word "encoded" be used in this
situation?
Does a rock contain information? If the same rock is found near a dead
body and its shape matches the dent in the poor victim's head, has it
now acquired new information? After all, what is that Crime Scene
Investigators study?
To continue the CSI analogy, do traces of body tissues not provide
more information now than they used to? Does a fingerprint whose match
is already in police files not provide more information than an
otherwise similar print from an unknown person?
I see information as a concept related to intelligent beings. It
exists in our minds, and can be encoded in some of our creations.
Analyzing starlight can allow us to make inferences about the stars
that produce it. That is a different thing than saying there is
information "in" starlight, especially "encoded" information. Our CSIs
can *glean* what we call information from the stone, but does the
stone "contain" it?
Some questions are more difficult than they first appear.
Greg Guarino
Rupert Morrish
Programmers generally don't talk about information. We talk about data.
It's not information until you present to something capable of being
informed.
However, there is a subset of mathematics (surprisingly enough called
information theory) which deals with the concept of information. There
appear to be as many different definitions of information as there are
researchers, plus one. Again, it would be useful to know which of the
definitions you are using (they have names), or if you are using your own.
> Pretty straightforward.
Until you actually try and work out what it is you mean by
"information". It's obvious that you haven't done this.
> The, "It is not obvious to me that DNA is "code" or that it transfers
> information. Who does it "transfer" the information to?", is an odd
> twist.
It's a reasonable question, and one that requires you to work out what
it is that you mean.
> You are saying that information transfer is only possible
> between intelligent entities which sounds a lot like yet another re-
> definition.
No. It's an idea common to many definitions of information.
> What is it that astronomers study? Isn't it starlight and
> doesn't that starlight contain information? Isn't that information
> encoded in its spectra?
It's information about the chemistry of the star, converted into light
by the star by entirely non-intelligent means. Is that the analogy you'd
like to draw?
> Little wonder that most of the responses I see
> seem merely argumentative as if there's some imperative to say
> something even when there's nothing to say.
>
> Maybe I just misunderstood.
Maybe you did. You almost certainly *are* misunderstood, but that's
because you confuse repetition with clarification.
>
> Bill
Bill
I said nothing of intervention. In fact I believe I said a one time
design is sufficient. Even so, I'm beginning to see that the whole
thing is a dead end. I'm mostly interested in the possibility of
design only because there is an appearance of design. I'm told that
evolution explains this appearance using the mechanism of natural
selection and that skepticism is perverse.
You prefer an evolutionary explanation and consider the matter closed.
I prefer a more interesting universe. While there may be no designer,
there has to be something more intellectually satisfying than just
dead matter bouncing around, congealing into the occasional sentient
being from time to time. Puts me to sleep just thinking about it.
> All other searches for design in scientific circles (seti,
> anthropology) start with at least a hypothetical understanding of the
> theorized designers.
If there is design, then a whole new suite of possibilities emerges.
Since I'm not attached to any particular rendition of any particular
theology, design would be new territory for me, regardless of how
anyone else has understood it. Right now, I prefer to keep it an open
question. It obviously is after all.
Bill
Rupert Morrish
That's odd, because anthropologists and arson investigators (amongst
others) deal with evidence of design all the time. The difference is
that they actually *have* evidence of design, and you don't.
What would you consider evidence of design?
(other than "I know it when I see it")
Tom McDonald
> On Jun 4, 3:53 pm, Ye Old One <use...@mcsuk.net> wrote:
>> On Wed, 4 Jun 2008 10:14:01 -0700 (PDT), Bill <b...@billconner.com>
>> enriched this group when s/he wrote:
>>
>>
>>
>>> On Jun 3, 2:49 pm, Ye Old One <use...@mcsuk.net> wrote:
>>>> On Tue, 3 Jun 2008 10:08:22 -0700 (PDT), Bill <b...@billconner.com>
>>>>> On Jun 3, 10:33 am, Kermit <unrestrained_h...@hotmail.com> wrote:
>>>>>> On Jun 2, 2:37 pm, Bill <b...@billconner.com> wrote:
>>>>> specific functions, an interdependence with other similar entities.
>>>>> The best evidence is any living organism where numerous complex
>>>>> structures interact and interdepend with other structures such that
>>>>> each is necessary for the other. While not necessarily designed they
>>>>> do very definitely appear designed by any rational definition of
>>>>> design.
>>>>> There are structures that can easily be understood as design as a
>>>>> reasonable first guess. DNA, the skeleton and the musculature of, say,
>>>>> humans, stereoscopic vision in humans, flight in birds or insects,
>>>>> self-replication and just about every other structure or function in
>>>>> any organism. Whether designed or not, the very strong appearance of
>>>>> design is obvious.
>>>> What is clear from most that you list is that design is NOT involved.
>>>>> Bill
>>>> --
>>>> Bob.
>>> I'm not sure that, "Wrong", "Nope" or mere assertion of any kind is
>>> very helpful. All you show is that you disagree without saying why.
>> I replied "wrong" because the statement you made was incorrect.
>>
>> I replied "nope" because the statements you made were incorrect.
>>
>> Three incorrect statements in a row like that means that you really
>> need to go away and learn something about science in general and
>> biology/evolution in particular. It is not my place to educate you,
>> especially when your other posts indicate you do not take education at
>> all.
>>
>>> Bill
>> --
>> Bob.
>
> So all you have to do is say you disagree without saying why and
> everything is settled. Well that's certainly nice and tidy. Wish my
> world were that simple.
So far as I can see, your world is at least that simple. It
certainly does not display the complexity one might expect of a
mind that has gotten beyond bitching about methodological
naturalism to begin, at least, to define a, oh, let's say,
hypothesis of design in nature caused by intelligence.
Why not just ignore the howler monkeys, and produce some solid,
scientific thinking of your own on this subject you appear to
take quite seriously--or at least appear to wish others to take
seriously?
It might complex-up your world a little; but it would at least
have the virtue of you showing willing to do something more than
bitching and demands for mind-reading.
Rupert Morrish
The universe does not exist for your amusement. You're only capable of
living in about 10^-63 of it*. You may think there needs to be more to
it than that, but that only matters inside your head (10^-81 of the
universe).
* Wasn't someone claiming recently that things with a probability of
less than 10^-50 were impossible? So it's impossible for humans to exist
because the chances of us ending up on the surface of the earth are much
less than that.
>
>> All other searches for design in scientific circles (seti,
>> anthropology) start with at least a hypothetical understanding of the
>> theorized designers.
>
> If there is design, then a whole new suite of possibilities emerges.
> Since I'm not attached to any particular rendition of any particular
> theology, design would be new territory for me, regardless of how
> anyone else has understood it. Right now, I prefer to keep it an open
> question. It obviously is after all.
>
> Bill
>
>
>
Ernest Major
<3752569c-7f8e-4878...@c58g2000hsc.googlegroups.com>,
Bill <b...@billconner.com> writes
>> Why? You yourself wrote that intelligence is not necessary for the
>> transfer of information.That it is complex and important for
>> development says nothing about design. It is constructed trillions of
>> times in each individual with no need for intelligent intervention.
>
>I said nothing of intervention. In fact I believe I said a one time
>design is sufficient. Even so, I'm beginning to see that the whole
>thing is a dead end. I'm mostly interested in the possibility of design
>only because there is an appearance of design. I'm told that evolution
>explains this appearance using the mechanism of natural selection and
>that skepticism is perverse.
You earlier mentioned the skeleton as something with the appearance of
design. If you also believe in a one time design being sufficient, there
appear to be three ways to reconcile this.
1) You're a young earth or young life creationist who believes that the
biosphere was recently created in pretty much its current configuration,
or possibly a vedic creationist who believes it an ancient static
biosphere. The problems with that position should be well known to you.
2) You're a deistic creationist who believes that the design of current
life was "front-loaded" into the earliest common ancestor of terrestrial
life. The problem with that position is it requires miracles to prevent
the front-loaded information from being eroded by drift (and selection
for efficient replication) before the time it is needed.
3) You believe that either the universe or the earliest common ancestor
of terrestrial life were designed and created in such form that the
current biosphere results from the operation of natural processes in a
deterministic universe.
--
alias Ernest Major
Robert Carnegie
> Robert Carnegie <rja.ca...@excite.com> wrote:
> >Ken Denny wrote:
> >> On Jun 2, 3:12�pm, Foucaultian <drfosternotfromglouces...@gmail.com>
> >> wrote:
> >>
> >> > There are also a small number of self-identified
> >> > IDers who believe in extraterrestrial, not supernatural, origins.
> >>
> >> I doubt that. I know that there are some who use the possibility of
> >> extraterrestrial designers as a way of denying the religiosity of ID,
> >> but it fails the logical test. If life on earth wasn't possible
> >> without an intelligent designer then how are the extraterrestrials
> >> possible without an intelligent designer? At some point the designer
> >> has to be supernatural.
>
> >But we should not be discussing whether life can't evolve as it has
> >without a designer, but whether life /did/ evolve as it has without a
> >designer. If life on Earth was designed by ancient flying saucer men,
> >it is acceptable to suppose that the flying saucer men are a product
> >of natural evolution on their own planet. And so the flying saucer
> >hypothesis of life on Earth needs to be shot down some other way.
>
> Yeah. These arguments are either circular or unprovable. The
> only way out of *something* way back when being naturally evolved
> is the notion that there was a first living thing that always was.
Perhaps - but the question is whether living things on Earth, and
human beings in particular, are the result of mere natural evolution.
If we were fiddled with by flying saucer people, then we are not only
naturally evolved - whatever is the origin of the flying saucer
people.
Furthermore, our own intelligence in recent history allows for
eugenics to be introduced into our descent, quite early. For
instance, we developed speech; what if ancient tribe chiefs ordered
the women to give themselves to the best talkers in the tribe, so that
they would give birth to better talkers in the next generation? Well
- maybe the best talkers /are/ the women. I expect I could concoct a
better example. Maybe the women were to give themselves to the
tallest men, so that the tribe basketball team in the next generation
would be better than the others in the tournament.
TomS
<4848a169$0$14390$8d2e...@news.newsgroup-binaries.com>, Rupert Morrish
stated..."
>
>Bill wrote:
>> On Jun 5, 2:37 pm, Mark Isaak <eci...@earthlink.net> wrote:
>>> On Thu, 05 Jun 2008 08:35:30 -0700, Bill wrote:
>>>> There's nothing to read between the lines, no need to impute some
>>>> hidden agenda, just a straightforward observation that has been
>>>> dismissed without being refuted.
>>> You're not listening. It *has* been refuted. First, DNA looks
>>> undesigned, for a variety of reasons which I won't repeat yet again.
>>> Second, there is no *evidence* for design except your word, and with all
>>> due respect, your word does not mean much to scientists. Scientists will
>>> be more than happy to propose design as a hypothesis as soon as there is
>>> evidence for design which is not just as easily explained by previously
>>> known processes.
>>>
>>
>> Do scientists post in t.o.? I know there are no logicians posting here
>> although the philosophers are well represented. Since no evidence for
>> design will ever be seen as evidence, I suppose there can be no
>> designer.
>
>That's odd, because anthropologists and arson investigators (amongst
>others) deal with evidence of design all the time. The difference is
>that they actually *have* evidence of design, and you don't.
>
>What would you consider evidence of design?
>
>(other than "I know it when I see it")
I haven't been reading thoroughly in this thread, so I'd
like to know whether anyone gave a *description* of what
design is. That seems to be an important pre-requisite
for understanding what might be evidence.
Even a partial description, such as "what sorts of things
are the product of design" (individuals, their parts,
groups of them, relationships between them, ...); "what
are the constraints that design operates under, or is it
totally unconstrained", "when did/does/will design take
place", "what sort of agency is responsible for design",
and so on.
--
---Tom S.
"As scarce as truth is, the supply has always been in excess of the demand."
attributed to Josh Billings
Robert Carnegie
> On Jun 4, 9:35 pm, Robert Carnegie <rja.carne...@excite.com> wrote:
> > If natural evolution is a sufficient explanation for the history of
> > life on earth, then evolution holds no further interest for non-
> > specialists. But a hypothesis or theory of natural evolution
> > represents a choice to exclude intentional design in nature from our
> > worldview. That is an appropriate choice if it leaves you with a
> > sufficient explanation for the history of life on earth. It is
> > inappropriate if there is evidence of design in life. That's the
> > simple truth: correct science and incorrect science are discriminated
> > by evidence.
>
> I agree. And, as I've said, there is a choice as to how data is
> understood. The choice of what to include and exclude is determined by
> how one first decides nature is, prior to a study of how nature is. A
> useful hypothesis for science obviously, but somewhat arbitrary. It
> also creates a category of incorrect science that could very well be
> true even if not science. It all seems very artificial. The choice to
> exclude design will guarantee that nothing will ever appear designed
> because design itself is impossible. This is fundamentally a
> philosophical choice. My only objection is that many posting here
> claim that the choice is data driven when it's obvious that's it's the
> other around.
Not true. There is always the possibility of new evidence that
requires a change of mind. It was mentioned in a recent radio
programme about Lysenko - perhaps contentiously - that there is good
evidence of a Lamarckian relationship between life experiences of one
generation and the natural development of the next generation, and of
the next after that - looking at human social statistics where food
wasn't always available but good record-keeping was. Although I
perceive a problem here, that it should be easy to reproduce the
effect in laboratory animals, which would be more convincing. But
anyway, there seems to be an anomaly in real results compared to
theoretical prediction, that needs to be explained, quite possibly by
changing or adjusting the prediction mechanism - the theory.
> > To make a design hypothesis worth looking at, you need to provide an
> > argument for distinguishing design from natural evolution, and a case
> > with evidence that can be justified as a case of design by such an
> > argument. As the former, I repeat, you have proposed irreducible
> > complexity. That is a good argument, although there are feasible
> > developments that produce a situation of irreducible complexity
> > without passing through a stage where useless features that will be
> > useful later are preserved. It may be not the only possible argument,
> > but it's up to you to make any others. I don't see that your cases of
> > evidence have irreducible complexity, however.
>
> Again, I do not propose irreducible complexity though it does seem
> applicable in some cases. Since we are agreed that science, especially
> biology, has determined that nothing is designed, then design cannot
> be valid even if true. That's the risk of doing science as it's
> presently defined and I have no major objections since it seems to
> work. My main objection is that many here don't make the distinction
> between a working hypothesis for the study of nature and nature
> itself.
Well, now - there are living things in the world that are designed.
For thousands of years, as pointed out, we have bred plants and bred
animals, choosing the ones that pla!eased us and breeding more with
the pleasing characteristics. Cows with mighty udders that give milk
for months. Beautiful, monstrously large rose-heads. We have bred
hybrid wheat. And now we can add genes of our choice or even our
design into the genome of a living thing.
If science can't tell these products apart from nature, and discover
design in them that we put there ourselves, then science isn't doing
very well. But, in fact, it can.
> > And for someone who claims not to have a stake in the intelligent
> > design doctrine, you are spending a lot of time trying to find a
> > defence for it. Can't you just accept that folks who know have a
> > rational basis to reject it - or, if you don't accept that, can you
> > provide an argument of your reason for not accepting it?
>
> Since my meager contributions are routinely dismissed, there's no
> point in offering them again. If some of my observations coincide with
> observations from some other group, it's accidental; I only speak for
> myself. We agree that the interpretive framework of evolution will
> determine how we understand nature which really says it all.
In t.o perople arguing the natural case are used to repeating
themselves to newcomers. You could do likewise. I think that what
you've said so far isn't very much, and so either you are holding some
good stuff back, or you do not have any. I think that you do not have
any. I don't think I've missed anything very special.
Bill
> In message
> <3752569c-7f8e-4878-a275-2c0660208...@c58g2000hsc.googlegroups.com>,
It's also possible that my opinions are in flux. Maybe I'm not
attached to any particular conclusion. Maybe I just find the whole
question interesting and worthy of further thought. Maybe the smug
certainties of both the evolutionists and creationists offend me
equally. About the only thing I'm sure of is that being sure of things
is probably a mistake. Given the history of science and the much
longer history of theology, missed guesses are common.
Evolution is one way of approaching questions of existence but its
answers have a limited scope. Theology is likewise unsatisfactory
since it is of limited depth. In a universe of at least three
dimensions, two dimensional answers aren't very satisfying. Regardless
of what is assumed about my reasons for posting, the simpler
explanation is that I want to know what others believe is important.
Since my queries are rarely addressed directly, progress has been
slow.
Bill
hersheyh
Design without intervention is a meaningless concept. I can have the
most beautiful ideas and designs in my head. If they stay there,
there is nothing to observe and assert as being the product of
design. You have been repeatedly claiming that you can observe
'design' from your observation of what you assert to be a *product of
design*, namely current living organisms. Design without manufacture
is NOT what you have been arguing about. You have been claiming that
something about current living organisms tells you that that aspect of
life (whatever it is) was 'designed'. That is, you claim that the
manufactured (or evolved, since that is the open question) object is
the evidence of design. The object (a current living organism?) is,
because it exists in the material world, a product that must, if
designed and manufactured by some mechanism *other than* evolution,
been produced by the designer's intervention in the material world by
a mechanism other than evolution. [Again, it is also possible for a
supernatural designer to 'intervene' in the material world by the
process of evolution, but you do seem to reject that consilience
between the evidence of how current organisms came to be and
theological views of a supernatural designer. That is, you are
constraining your omnipotent supernatural designer to mechanisms that
do not involve evolution.]
> Even so, I'm beginning to see that the whole
> thing is a dead end. I'm mostly interested in the possibility of
> design only because there is an appearance of design. I'm told that
> evolution explains this appearance using the mechanism of natural
> selection and that skepticism is perverse.
Scientific skepticism requires you to provide *evidence* to support
your skepticism. Your level of 'disbelief' or 'ignorance of the
evidence' is not evidence. And, again, you only seem to be interested
in supernatural designers that work by mechanisms other than
naturalistic processes like common descent. But without bothering to
provide an alternative mechanism (way of 'intervening' in the material
world to produce that which you claim was 'designed') to common
descent that is also consistent with the evidence for that process.
Aside from Gosse's belly button defense of a dishonest history I
cannot think of one. You seem to think you don't need to have one.
> You prefer an evolutionary explanation and consider the matter closed.
> I prefer a more interesting universe.
Evolutionary explanations do not exclude the possibility of a
'designer'. They exclude magical poofing mechanisms of 'intervention'
in making 'design' materially observable. Your preference for magical
explanations (and that seems to be what you are interested in when you
posit a supernatural designer working by magical or unknowable
mechnisms to poof whatever it is you think is impossible for the known
process of common descent that is supported by the evidence) is
irrelevant.
> While there may be no designer,
> there has to be something more intellectually satisfying than just
> dead matter bouncing around, congealing into the occasional sentient
> being from time to time. Puts me to sleep just thinking about it.
That is why there is a field called "theology" that doesn't have the
methodological constraints of natural science. That is why the words
"faith" and "belief" exist in theology but not in science.
> > All other searches for design in scientific circles (seti,
> > anthropology) start with at least a hypothetical understanding of the
> > theorized designers.
>
> If there is design, then a whole new suite of possibilities emerges.
Well, I only see the Gosse belly button defense as a logically
consistent non-scientific alternative if you also accept the evidence
of nature. What other possibilities do you see? If you don't accept
material evidence, of course, you have just thrown out the very
objects you claim as evidence of design. You cannot pick-and-choose
the evidence for the patterns of change that support common descent.
> Since I'm not attached to any particular rendition of any particular
> theology, design would be new territory for me, regardless of how
> anyone else has understood it. Right now, I prefer to keep it an open
> question. It obviously is after all.
Only if you can accept a designer that manufactures or generates the
material evidence of his/her/its/their design in ways consistent with
the material evidence. Or accept the possibility of the Gossean
deceiver god.
>
> Bill
Bill
I used to think it odd that Lysenko was taken seriously until I
factored in the philosophy of the Stalinist take on Marxism. The whole
idea of the Soviet system was that human behavior could be modified to
accept and willingly practice communism. Lysenko provided the
scientific justification. The Soviets understood husbandry as well as
anyone and practiced plant and animal breeding same as everyone else
so the only tangible benefit to Lysenkoism was to impart some
scientific respectability to Soviet Marxism.
What a lot of people don't realize is that the materialism that's
basis of science is also a philosophy. While useful for establishing a
working hypothesis for the practice of science, it's often, maybe
inevitably, extended to include everything. In the limited context of
science, materialism is valid and useful, but it regularly fails in
any other context. What does materialism mean in politics or
economics, ethics or social organization? If you've seen the movie,
"Brazil", you've seen the future. We worship the absurd, it seems, and
Monty Python is our prophet.
All this means that I am suspicious of any philosophy that can, even
potentially, affect my life. While I have no reservations about the
value of science itself, I can't ignore its philosophical provenance
simply because others take it so seriously.
> In t.o perople arguing the natural case are used to repeating
> themselves to newcomers. You could do likewise. I think that what
> you've said so far isn't very much, and so either you are holding some
> good stuff back, or you do not have any. I think that you do not have
> any. I don't think I've missed anything very special.
I clarified that someplace. I am neither for nor against design or
even evolution, I believe that there's stuff that appear designed. I'm
told either that there is no such appearance or that it's fully
explained by natural selection or that I have some devious religious
agenda. As far as I can tell, no one has gotten any satisfaction from
any of this, certainly not me.
Bill
Greg Guarino
wrote:
>Maybe the smug
>certainties of both the evolutionists and creationists offend me
>equally.
Which evolutionists? Catholic evolutionists? Protestant evolutionists?
Jewish evolutionsists? Atheist evolutionists? Agnostic evolutionists?
>About the only thing I'm sure of is that being sure of things
>is probably a mistake.
As is the conclusion that since complete certainty is unattainable,
all ideas about science are of equal merit.
>Given the history of science and the much
>longer history of theology, missed guesses are common.
>Evolution is one way of approaching questions of existence but its
>answers have a limited scope.
All scientific questions are of limited scope. That's what makes them
useful, by the way. Evolution, for instance, is a way of approaching
the question, "How do we explain the diversity of life on Earth?"; a
very successful approach. People who accept evolution as the
explanation for life's diversity differ on the ultimate question of
existence, which is a very different question.
>Theology is likewise unsatisfactory
>since it is of limited depth.
I don't know what that means. Theology seems to be an approach to
dealing with the unknowable, which is OK with me. It is only when it
strays into the knowable realm, *and* runs afoul of the observable
evidence, that I find theology a problem. Even then, I generally only
worry about it when the intrusion threatens to reach my (and
everyone's) daughter's science classes, or disrupts research.
>Since my queries are rarely addressed directly, progress has been
>slow.
From the exchanges I have read (admittedly only part of the thread),
many people have tried to address your points, questioning assumptions
that you hadn't thought to examine in the process. Maybe that makes
for slow "progress", but it's better than none.
Greg Guarino
TomS
<i6pi44hu8kgj0ej8r...@4ax.com>, Greg Guarino stated..."
>
>On Fri, 6 Jun 2008 08:38:51 -0700 (PDT), Bill <b...@billconner.com>
>wrote:
>
>>Maybe the smug
>>certainties of both the evolutionists and creationists offend me
>>equally.
>
>Which evolutionists? Catholic evolutionists? Protestant evolutionists?
>Jewish evolutionsists? Atheist evolutionists? Agnostic evolutionists?
>
>>About the only thing I'm sure of is that being sure of things
>>is probably a mistake.
>
>As is the conclusion that since complete certainty is unattainable,
>all ideas about science are of equal merit.
What offends me is the smugness of the person who says
that nobody knows anything any better than he does; the
person who pretends to be above all certainties, yet
does not doubt the efficacy of networked computers,
elevators and traffic lights, breathing and eating.
And note that I do not try to weasel out of expressing
my feeling with a prefixed "maybe".
hersheyh
And ID or creationism also is a equally invalid attempt to
scientifically justify a philosophical preference. Like Lysenkoism,
these are not derived from the evidence, but are attempts to impose a
philosophical assertion onto the evidence.
> What a lot of people don't realize is that the materialism that's
> basis of science is also a philosophy.
Science, *all* science, derives its theories and explanations via
methodological materialism. That is what makes science useful in
understanding how the material world works (what science restricts
itself to). Science has no comment on philosophical materialism.
Allowing supernatural explanation would destroy the usefulness of
science. In fact, it would stop science in its tracks. After you
assert "God did it the way it says in the Bible.", what is left for
science?
> While useful for establishing a
> working hypothesis for the practice of science, it's often, maybe
> inevitably, extended to include everything.
*Some* scientists are philosophical materialists. *Some* aren't.
Science can be done by both. *All*, when they are doing science, are
methodological materialists.
> In the limited context of
> science, materialism is valid and useful, but it regularly fails in
> any other context. What does materialism mean in politics or
> economics, ethics or social organization? If you've seen the movie,
> "Brazil", you've seen the future. We worship the absurd, it seems, and
> Monty Python is our prophet.
That is your problem, not science's. Natural science is
epistimologically a-moral and a-theistic. It cannot supply you with
the answers you apparently want. All the more so because the answers
you seem to want science to provide you with are contrary to material
reality. Whatever nature says is what is as far as science is
concerned. That science can be subverted by frauds and charlatans
like Lysenko or Ken Ham or Dembski or Behe is simply because science
is an imperfect human enterprise done by imperfect humans.
> All this means that I am suspicious of any philosophy that can, even
> potentially, affect my life. While I have no reservations about the
> value of science itself, I can't ignore its philosophical provenance
> simply because others take it so seriously.
The very reason science is valuable and useful is because of its
methodological constraints. That the explanations that science
provides do not meet your emotional needs is not a reason for science
to go outside those constraints in search of explanations that satisfy
your emotional needs.
> > In t.o perople arguing the natural case are used to repeating
> > themselves to newcomers. You could do likewise. I think that what
> > you've said so far isn't very much, and so either you are holding some
> > good stuff back, or you do not have any. I think that you do not have
> > any. I don't think I've missed anything very special.
>
> I clarified that someplace. I am neither for nor against design or
> even evolution, I believe that there's stuff that appear designed.
Your personal belief is scientifically uninteresting until you can
provide material evidence to support that belief. At the moment you
cannot even say exactly what makes something "designed" nor exactly
what feature of "life" has the appearance of design. Gut feelings are
not scientific evidence.
> I'm
> told either that there is no such appearance or that it's fully
> explained by natural selection or that I have some devious religious
> agenda. As far as I can tell, no one has gotten any satisfaction from
> any of this, certainly not me.
Blame yourself. You have made assertions and used terms that need to
be clarified and operationalized in a meaningful way without making
any effort to clarify what you mean. I mean, answering the question
"How do you identify design?" with "DNA is designed." is, well, not a
very useful answer. One might even call it a non sequitur.
>
> Bill
Mark Isaak
> On Jun 5, 2:37 pm, Mark Isaak <eci...@earthlink.net> wrote:
>> On Thu, 05 Jun 2008 08:35:30 -0700, Bill wrote:
>> > There's nothing to read between the lines, no need to impute some
>> > hidden agenda, just a straightforward observation that has been
>> > dismissed without being refuted.
>>
>> You're not listening. It *has* been refuted. First, DNA looks
>> undesigned, for a variety of reasons which I won't repeat yet again.
>> Second, there is no *evidence* for design except your word, and with all
>> due respect, your word does not mean much to scientists. Scientists will
>> be more than happy to propose design as a hypothesis as soon as there is
>> evidence for design which is not just as easily explained by previously
>> known processes.
>>
>
> Do scientists post in t.o.? I know there are no logicians posting here
> although the philosophers are well represented.
Logic is a subset of philosophy. (At least, the course I took was in the
philosophy department.) And yes, scientists post here. I have briefly
been a scientist myself. Regardless, what you are reading here is not
different from what you read from scientists.
> Since no evidence for design will ever be seen as evidence, I suppose
> there can be no designer.
False premise. Scientists see evidence for design routinely,
particluarly in the fields of archaeology and forensics. Not long ago,
SETI researchers discovered strong evidence of intelligent design. (It
turned out that it was coming from a human-made space probe.) The
concept of design is not the problem.
Bill
> "On Fri, 06 Jun 2008 16:59:10 GMT, in article
>
>
>
> >On Fri, 6 Jun 2008 08:38:51 -0700 (PDT), Bill <b...@billconner.com>
> >wrote:
>
> >>Maybe the smug
> >>certainties of both the evolutionists and creationists offend me
> >>equally.
>
> >Which evolutionists? Catholic evolutionists? Protestant evolutionists?
> >Jewish evolutionsists? Atheist evolutionists? Agnostic evolutionists?
>
> >>About the only thing I'm sure of is that being sure of things
> >>is probably a mistake.
>
> >As is the conclusion that since complete certainty is unattainable,
> >all ideas about science are of equal merit.
>
> [...snip...]
>
> What offends me is the smugness of the person who says
> that nobody knows anything any better than he does; the
> person who pretends to be above all certainties, yet
> does not doubt the efficacy of networked computers,
> elevators and traffic lights, breathing and eating.
Or confusing efficacy with knowledge.
> And note that I do not try to weasel out of expressing
> my feeling with a prefixed "maybe".
While our feelings feel certain, their causes might not be. You feel
certain that I should feel certain, yet I'm certainly wrong so I'm a
weasel either way.
Bill
John Wilkins
> On Thu, 05 Jun 2008 14:28:52 -0700, Bill wrote:
>
> > On Jun 5, 2:37 pm, Mark Isaak <eci...@earthlink.net> wrote:
> >> On Thu, 05 Jun 2008 08:35:30 -0700, Bill wrote:
> >> > There's nothing to read between the lines, no need to impute some
> >> > hidden agenda, just a straightforward observation that has been
> >> > dismissed without being refuted.
> >>
> >> You're not listening. It *has* been refuted. First, DNA looks
> >> undesigned, for a variety of reasons which I won't repeat yet again.
> >> Second, there is no *evidence* for design except your word, and with all
> >> due respect, your word does not mean much to scientists. Scientists will
> >> be more than happy to propose design as a hypothesis as soon as there is
> >> evidence for design which is not just as easily explained by previously
> >> known processes.
> >>
> >
> > Do scientists post in t.o.? I know there are no logicians posting here
> > although the philosophers are well represented.
>
> Logic is a subset of philosophy. (At least, the course I took was in the
> philosophy department.) And yes, scientists post here. I have briefly
> been a scientist myself. Regardless, what you are reading here is not
> different from what you read from scientists.
Well yes it is, but actually logic is a separate domain - like topology
is WRT meth in general. Logicians have to wear odd clothes and be
unaware of their physical surrounds, especially if they do modal logic.
>
> > Since no evidence for design will ever be seen as evidence, I suppose
> > there can be no designer.
>
> False premise. Scientists see evidence for design routinely,
> particluarly in the fields of archaeology and forensics. Not long ago,
> SETI researchers discovered strong evidence of intelligent design. (It
> turned out that it was coming from a human-made space probe.) The
> concept of design is not the problem.
--
John S. Wilkins, Postdoctoral Research Fellow, Philosophy
University of Queensland - Blog: scienceblogs.com/evolvingthoughts
"He used... sarcasm. He knew all the tricks, dramatic irony, metaphor,
bathos, puns, parody, litotes and... satire. He was vicious."
Robert Carnegie
> On Jun 6, 6:37 am, Robert Carnegie <rja.carne...@excite.com> wrote:
> > Not true. There is always the possibility of new evidence that
> > requires a change of mind. It was mentioned in a recent radio
> > programme about Lysenko - perhaps contentiously - that there is good
> > evidence of a Lamarckian relationship between life experiences of one
> > generation and the natural development of the next generation, and of
> > the next after that - looking at human social statistics where food
> > wasn't always available but good record-keeping was.
>
> I used to think it odd that Lysenko was taken seriously until I
> factored in the philosophy of the Stalinist take on Marxism. The whole
> idea of the Soviet system was that human behavior could be modified to
> accept and willingly practice communism. Lysenko provided the
> scientific justification. The Soviets understood husbandry as well as
> anyone and practiced plant and animal breeding same as everyone else
> so the only tangible benefit to Lysenkoism was to impart some
> scientific respectability to Soviet Marxism.
If you're only counting "benefit"... according to the programme
contributors, Lysenko's mistaken ideas replaced existing farming
methods - by force f you didn't agree.
noctiluca
> On Jun 6, 12:35 pm, Bill <b...@billconner.com> wrote:
>
>
>
> > On Jun 6, 6:37 am, Robert Carnegie <rja.carne...@excite.com> wrote:
>
> > > Bill wrote:
> > > > On Jun 4, 9:35 pm, Robert Carnegie <rja.carne...@excite.com> wrote:
<snip>
> > I'm
> > told either that there is no such appearance or that it's fully
> > explained by natural selection or that I have some devious religious
> > agenda. As far as I can tell, no one has gotten any satisfaction from
> > any of this, certainly not me.
>
> Blame yourself.
Actually I'm going to go ahead and take a (very small) bit of the
blame here. I did accuse Bill of being a shill for God and that was
presumptuous. I jumped to conclusions about his philosophy that were
unwarranted. To be sure, there seem to be elements of postmodernism,
pseudo-science, and new agey woo in his rather scattered arguments.
And he may yet be covering for a more traditional perspective on God,
but my charge to that effect was premature and I was wrong to make it.
Sorry for the momentary post-hijack. Just wanted to set the record
straight.
RLC
Michael Siemon
j.wil...@uq.edu.au (John Wilkins) wrote:
> Mark Isaak <eci...@earthlink.net> wrote:
...
> > Logic is a subset of philosophy. (At least, the course I took was in the
> > philosophy department.) And yes, scientists post here. I have briefly
> > been a scientist myself. Regardless, what you are reading here is not
> > different from what you read from scientists.
...
When I was an undergraduate in Chicago (some 40+ years ago; gack!!!),
there was no course in the Math Department that treated the Goedel
incompleteness theorems (there _was_ a small residue of earlier stuff
on "foundations", though most work in that directions was in the new
and exciting "general abstract nonsense" (in Saunders MacLane's words,
as a major participant :-)) of category theory.
So, I took a "logic" course in the Philosophy Department to get a
treatment of this (I should have just read the damn papers...)
It was _truly_ weird. We spent most of a quarter laboriously inching
our way through what _should_ have been about two lectures... with a
lot of the students too goggle-eyed about the whole procedure of a
straightforward (if somewhat clever/funky) formal argument that could
deal with the theorem statement.
Robert Carnegie
> On Jun 6, 10:34�am, hersheyh <hershe...@yahoo.com> wrote:
> > On Jun 6, 12:35 pm, Bill <b...@billconner.com> wrote:
> >
> >
> >
> > > On Jun 6, 6:37 am, Robert Carnegie <rja.carne...@excite.com> wrote:
> >
> > > > Bill wrote:
> > > > > On Jun 4, 9:35 pm, Robert Carnegie <rja.carne...@excite.com> wrote:
>
> <snip>
>
> > > I'm
> > > told either that there is no such appearance or that it's fully
> > > explained by natural selection or that I have some devious religious
> > > agenda. As far as I can tell, no one has gotten any satisfaction from
> > > any of this, certainly not me.
> >
> > Blame yourself. �
>
> Actually I'm going to go ahead and take a (very small) bit of the
> blame here. I did accuse Bill of being a shill for God and that was
> presumptuous. I jumped to conclusions about his philosophy that were
> unwarranted. To be sure, there seem to be elements of postmodernism,
> pseudo-science, and new agey woo in his rather scattered arguments.
> And he may yet be covering for a more traditional perspective on God,
> but my charge to that effect was premature and I was wrong to make it.
>
> Sorry for the momentary post-hijack. Just wanted to set the record
> straight.
I'm suspicious of Bill - but that doesn't mean we can't have a
conversation. In the past, talk.origins has had participants who
claimed to hold a neutral view but turned out to be dogmatic
creationists, and they sounded like Bill sounds - surprisingly
resistant to reasonable arguments and evidence. That may be just
accident, and I think some of us started just tearing Bill down even
before that indication was in.
Bill seems to be hung up on the "appearance of design". Maybe we need
to nail down what the /fact/ of design would be. Off the cuff, I'd
call a thing designed if it was intelligently imagined and planned
before it was made. And for an example of something that looks like a
design but is not, how about a snowflake? Any one /particular/
snowflake. They look like elegant creations, close up, but really
they just grew that way naturally.
We also need to consider that the actual word "design" was barely
heard in the context of evolution until "scientific creationism" was
shown in a law court to be not scientific, but merely religious
doctrine, and so Christians who were so inclined needed /another/ fake
science to try to feed into tax-funded public schools.
So as soon as you /start/ talking about "design", you are dressed in
creationist clothes.
Bill
I just finished Richard Dawkin's book, "The God Delusion" which made
the case fairly well about why he, and others no doubt, is an atheist.
I have to agree that based on his arguments, religion itself is
malignant because of its affects on those who take it seriously. I was
disappointed with his arguments for the non-existence of gods however.
His main reason for his disbelief seems to be that gods are too
improbable to be possible. I was hoping for something more
substantial. Something that would apply to this thread since we're
involved in a related discussion.
I post because I want to test my opinions to see if they're worth
tacking up on the walls or whether they're just useless and probably
embarrassing. Sometimes my remarks are more as a devil's advocate than
what I personally believe, sometimes plain curiosity, sometimes just
to piss people off. I rarely express my opinions directly since they
are rarely complete.
I argue for design because it seems a credible interpretation of
material phenomena. It doesn't follow that I'm committed to it, just
that I find it plausible enough to talk about. I'm told by just about
everyone that, even if superficially plausible, it's absurd because,
1) there is no such appearance and 2) since there is no designer there
can be design and 3) natural selection fully accounts for the
appearance. Some religious agenda is imputed to my posts when I
disagree, which prompts me to impute to others some equally irrelevant
motive. Everyone goes home dissatisfied.
When we say that some proposition is absurd or incredible, we should
ask, "to whom?". Obviously the human psyche is capable of rooting
around in all manner of impossibilities and devising impossibly
convoluted explanations of what they find there. We can quite easily
become comfortable with concepts that we can neither fully define nor
explain to anyone else, yet they remain convincing to us. While it
would be far more productive to strip away most of these notions, we
instead continually add to them.
Knowing this about human intelligence, I start from skepticism. My
experience suggests that human intelligence is very specific. We are
very good at building bridges and buildings and machines and anything
else requiring detailed preparation and precise manufacture that
depend only on unambiguous physical laws. We are, in short, excellent
engineers. Beyond that, human intelligence doesn't seem to have much
value. We are spectacularly inept at philosophy, theology, politics
and anything else not firmly nailed down by natural laws.
Since the question of design falls somewhere outside our engineering
expertise, its resolution seems unlikely. The best anyone can do is
compare that question to others they believe have been answered to see
if any ugly contradictions float to the top. Design is partly an
engineering problem but mostly philosophical so it's unlikely to ever
be completely resolved given the nature of human intelligence. My
purpose has been to juggle probabilities and see if there's anything I
can add to my own suite of possible Truths. So far, no luck either
way.
Bill
TomS
<cced62df-b597-40e0...@z66g2000hsc.googlegroups.com>, Robert
Carnegie stated..."
If we could get an admission that it is worthwhile to consider
what a "design event" might be like. How is it possible even
to talk about evidence for something, when it is out of bounds
to determine what that something might be?
For example, what is the product of a design event? Is it an
individual living thing? Is it a new organ or function put into
an already existing thing? Is it a whole population, or even a
community of various animals, plants, and physical environment?
And it would be interesting to think about what immediately
preceeded the design event. Was it some undesigned material?
How did it manage to persist as long as it did, without being
designed to fit its environment?
>
>We also need to consider that the actual word "design" was barely
>heard in the context of evolution until "scientific creationism" was
>shown in a law court to be not scientific, but merely religious
>doctrine, and so Christians who were so inclined needed /another/ fake
>science to try to feed into tax-funded public schools.
>
>So as soon as you /start/ talking about "design", you are dressed in
>creationist clothes.
>
hersheyh
As would I. But that means that the crucial identifying factor in
"design" is not the object itself, but the necessity of a designer.
Unless, of course, one can demonstrate that some subset of objects
with certain identifiable properties *must* be designed. The only way
I can see doing that is by analyzing the method of manufacture of the
object to identify the necessity of a manufacturer (and, by inference,
a designer). Unfortunately, the "method of manufacture" of living
organisms is self-reproduction and not manufacture from raw materials
by an outside agent, so there is no evidence of "design and
manufacture" by the tell-tale sign of manufacture by an outside agent
from raw materials.
Humans, a detectable quasi-intelligent designer, can intentionally
change the genotypic (typically those that produce phenotypic
difference) properties of living organisms ('designing' animal or
plant breeds), but they do it by *modifying* (until recently this was
accomplished by merely looking for naturally-occurring randomly-
generated mutations) the genomes of currently living organisms and
using self-reproduction and selection to fix in the traits humans
desire. These same processes, of course, occur in nature, but in
nature the process fixes in traits that are optimal for the
reproductive success of the organism rather than retaining traits
humans desire. It is quite telling that when a known intelligent
agent intentionally interferes with and changes the 'design' of a
living organism, they use the methodology of descent with modification
and differential selection that nature itself uses.
> And for an example of something that looks like a
> design but is not, how about a snowflake? Any one /particular/
> snowflake. They look like elegant creations, close up, but really
> they just grew that way naturally.
>
> We also need to consider that the actual word "design" was barely
> heard in the context of evolution until "scientific creationism" was
> shown in a law court to be not scientific, but merely religious
> doctrine, and so Christians who were so inclined needed /another/ fake
> science to try to feed into tax-funded public schools.
>
> So as soon as you /start/ talking about "design", you are dressed in
> creationist clothes.
Especially when you talk about design but don't want to even attempt
to identify the only real evidence of design: evidence of an
appropriate designer. Design without evidence of a designer (in fact,
an unwillingness to even discuss how a designer would work) is not
evidence of design at all. It is merely a word standing in for "god
of the gaps ignorance".
noctiluca
I think your comments are well taken as they apply to the general
case. But as they apply to Bill, well, I'm not so sure. I think most
of us tried very hard to get Bill to expound upon his views. But it
became clear (at least to me) that he was either so wedded to his
supernatural credulousness that he couldn't think in concrete terms or
he was a troll getting his jollies from non-responsive equivocation.
Either way my conclusion was that I couldn't have a productive
conversation with him. It remains my hope that others might, but so
far I don't see it happening.
> Bill seems to be hung up on the "appearance of design". Maybe we need
> to nail down what the /fact/ of design would be. Off the cuff, I'd
> call a thing designed if it was intelligently imagined and planned
> before it was made. And for an example of something that looks like a
> design but is not, how about a snowflake? Any one /particular/
> snowflake. They look like elegant creations, close up, but really
> they just grew that way naturally.
>
> We also need to consider that the actual word "design" was barely
> heard in the context of evolution until "scientific creationism" was
> shown in a law court to be not scientific, but merely religious
> doctrine, and so Christians who were so inclined needed /another/ fake
> science to try to feed into tax-funded public schools.
This is a good point as well. And it's the reason I try to take the
time to get most ideologues to think more deeply about what "design"
actually entails. All one has to do is read Mark's and Howard's and
Tom's and Rupert's and others posts on this phenomenon here and in the
"What is intelligent design" thread to realize that the scope of the
design act, as well as our experience with it, obliges far more
empirical responsibility and understanding than the blithe invocation
of ID proponents reflects. Why Bill cannot get past his dizzy ideas
about a priori rejection of design by our side and see the value of
thinking these things through still puzzles me, but one can beat one's
head against the wall for only so long (and my head is not nearly as
tough or patient as it used to be).
RLC
Ernest Major
<9cd703a3-b433-447f...@z66g2000hsc.googlegroups.com>,
Bill <b...@billconner.com> writes
>I argue for design because it seems a credible interpretation of
>material phenomena. It doesn't follow that I'm committed to it, just
>that I find it plausible enough to talk about. I'm told by just about
>everyone that, even if superficially plausible, it's absurd because,
>1) there is no such appearance and 2) since there is no designer there
>can be design and 3) natural selection fully accounts for the
>appearance. Some religious agenda is imputed to my posts when I
>disagree, which prompts me to impute to others some equally irrelevant
>motive. Everyone goes home dissatisfied.
I think you need to read what people here are telling you more
carefully, as the paraphrase you present above is strikingly inaccurate.
1) People here seem to be of two opinions as to whether life has the
*appearance* of design. Some people, myself included, don't agree that
life has the appearance of design; others think that it does have the
appearance of design, but that the appearance is an illusion, or at
least any actual element of design has not been substantiated.
2) Very few people (one?) has said that there can be no design because
there's no designer. However the one constant of your position, other
than your insistence that life has the appearance of design, has been
the ad-hominem claim the design is rejected because of an a priori
assumption that there is no designer. You've stuck to this, in spite of
being repeatedly told otherwise, to the considerable detriment to your
credibility.
--
alias Ernest Major
Vernon Balbert
produced this interesting bit of text:
>>>> On Jun 6, 12:35 pm, Bill <b...@billconner.com> wrote:
>>>>> On Jun 6, 6:37 am, Robert Carnegie <rja.carne...@excite.com> wrote:
>>>>>> Bill wrote:
>>>>>>> On Jun 4, 9:35 pm, Robert Carnegie <rja.carne...@excite.com> wrote:
>>> <snip>
>>>>> I'm
>>>>> told either that there is no such appearance or that it's fully
>>>>> explained by natural selection or that I have some devious religious
>>>>> agenda. As far as I can tell, no one has gotten any satisfaction from
>>>>> any of this, certainly not me.
That's all well and good, but it still lacks what is fundamentally
needed: you have to define what design is and how to recognize it in
order to argue in favor for it. I haven't seen anybody actually say
design is impossible, ridiculous or a flat-out lie. What I have seen is
people saying, "Fine, you want to argue in favor of design? Then define
it so we have a starting place with which to argue." Science doesn't
work just by somebody claiming that it could be something else. If you
think of an alternative hypothesis then you'll have to make some
predictions based on it. In order to make those predictions you need to
define what you're looking for. In science "I know it when I see it"
simply isn't good enough because now are other people supposed to
attempt to reproduce your results?
All we're asking is, "How do we recognize design so we can verify it?"
In science nobody takes anyone's word until they can repeat the experiment.
--
Rule of Acquisition number 13: Anything worth doing is worth doing for
money.
Mark Isaak
> [...]
> What a lot of people don't realize is that the materialism that's
> basis of science is also a philosophy. While useful for establishing a
> working hypothesis for the practice of science, it's often, maybe
> inevitably, extended to include everything. In the limited context of
> science, materialism is valid and useful, but it regularly fails in
> any other context. What does materialism mean in politics or
> economics, ethics or social organization? If you've seen the movie,
> "Brazil", you've seen the future. We worship the absurd, it seems, and
> Monty Python is our prophet.
What a lot of anti-materialists don't understand is that the materialist
philosophy that is a basis of science is also the basis of, among other
things, agriculture, engineering, plumbing, cooking, transportation, law,
sports, the military, communications, manufacturing, pet grooming, stamp
collecting, medicine (at least the effective sort), politics, economics,
and most of ethics and social organization. Speaking of Monty Python,
your dismissal of materialism has very close parallels to the "What have
the Romans ever done for us?" scene in "Life of Brian."
TomS
Ernest Major stated..."
>
>In message
><9cd703a3-b433-447f...@z66g2000hsc.googlegroups.com>,
>Bill <b...@billconner.com> writes
>>I argue for design because it seems a credible interpretation of
>>material phenomena. It doesn't follow that I'm committed to it, just
>>that I find it plausible enough to talk about. I'm told by just about
>>everyone that, even if superficially plausible, it's absurd because,
>>1) there is no such appearance and 2) since there is no designer there
>>can be design and 3) natural selection fully accounts for the
>>appearance. Some religious agenda is imputed to my posts when I
>>disagree, which prompts me to impute to others some equally irrelevant
>>motive. Everyone goes home dissatisfied.
>
>I think you need to read what people here are telling you more
>carefully, as the paraphrase you present above is strikingly inaccurate.
>
>1) People here seem to be of two opinions as to whether life has the
>*appearance* of design. Some people, myself included, don't agree that
>life has the appearance of design; others think that it does have the
>appearance of design, but that the appearance is an illusion, or at
>least any actual element of design has not been substantiated.
One other opinion: The concept "design" has not been adequately
described, nor has it been specified what it is that is being
considered as "designed". We don't know what we're supposed to
do, if we did accept "design" (it doesn't suggest any experiments,
any progress in solving puzzles, or whatever).
In brief: It's pointless.
>
>2) Very few people (one?) has said that there can be no design because
>there's no designer. However the one constant of your position, other
>than your insistence that life has the appearance of design, has been
>the ad-hominem claim the design is rejected because of an a priori
>assumption that there is no designer. You've stuck to this, in spite of
>being repeatedly told otherwise, to the considerable detriment to your
>credibility.
>
--