Darwinian Indoctrination 101 - Part 2

[Steady Eddie]

Okay, here is Mo Noor's second preview lecture on his course "Introduction to Genetics and Evolution" -

Lecture 2 - Basic Principles and Evidence For Evolution
https://www.coursera.org/learn/genetics-evolution/lecture/K8SDd/basic-principles-and-evidence-for-evolution-g

Here, Mo begins to carefully "extend" his definition of evolution from examples of micro-evolution, or
adaptation, such as the peppered moth and asphalt-phobic squirrels, to macro-evolution.

He begins by showing the 60-million year lineage of the modern horse.
He uses the iconic horse lineage, even though this has been exposed as a hoax - there ARE NO
FOSSILS OF HORSE ANCESTORS!

Mo adroitly acknowledges this fact, then keeps right on going, as if it is a minor technicality!

His words are:
"These pictures, by the way, don't NECESSARILY depict ACTUAL HORSE ANCESTORS..."
LOL!
"...BUT, they show FOSSILS THAT WERE PRESENT AT THE SAME TIME as the PRESUMED HORSE
ANCESTORS"
LOL!

So, what is such an admitted IMAGINARY LINEAGE doing in an introductory evolution course?
What does it demonstrate, other than the hubris of Darwinists who think the student will
passively accept ANYTHING they say as fact?

[Vincent Maycock]

On Wed, 4 May 2016 06:54:37 -0700 (PDT), Steady Eddie
<1914o...@gmail.com> wrote:

>Okay, here is Mo Noor's second preview lecture on his course "Introduction to Genetics and Evolution" -
>
>Lecture 2 - Basic Principles and Evidence For Evolution
>https://www.coursera.org/learn/genetics-evolution/lecture/K8SDd/basic-principles-and-evidence-for-evolution-g
>
>Here, Mo begins to carefully "extend" his definition of evolution from examples of micro-evolution, or
>adaptation, such as the peppered moth and asphalt-phobic squirrels, to macro-evolution.
>
>He begins by showing the 60-million year lineage of the modern horse.
>He uses the iconic horse lineage, even though this has been exposed as a hoax - there ARE NO
>FOSSILS OF HORSE ANCESTORS!

That's because exact ancestors are unlikely to be preserved. But
certainly many of the horses in the series evolved from forms that are
much like the ones that are preserved.

Also, the only thing that could remotely be considered a "hoax" is
the arrangement of the horse series into a linear chain of evolution,
when in fact the actual evolution was more like a bush than a ladder
or linear chain of horses.

>Mo adroitly acknowledges this fact, then keeps right on going, as if it is a minor technicality!
>
>His words are:
>"These pictures, by the way, don't NECESSARILY depict ACTUAL HORSE ANCESTORS..."
>LOL!
>"...BUT, they show FOSSILS THAT WERE PRESENT AT THE SAME TIME as the PRESUMED HORSE
>ANCESTORS"
>LOL!

The overall trend -- towards more horse-like creatures -- is there,
though.

[John Harshman]

On 5/4/16 6:54 AM, Steady Eddie wrote:
> Okay, here is Mo Noor's second preview lecture on his course "Introduction to Genetics and Evolution" -
>
> Lecture 2 - Basic Principles and Evidence For Evolution
> https://www.coursera.org/learn/genetics-evolution/lecture/K8SDd/basic-principles-and-evidence-for-evolution-g
>
> Here, Mo begins to carefully "extend" his definition of evolution from examples of micro-evolution, or
> adaptation, such as the peppered moth and asphalt-phobic squirrels, to macro-evolution.
>
> He begins by showing the 60-million year lineage of the modern horse.
> He uses the iconic horse lineage, even though this has been exposed as a hoax - there ARE NO
> FOSSILS OF HORSE ANCESTORS!

Explain.

> Mo adroitly acknowledges this fact, then keeps right on going, as if it is a minor technicality!
>
> His words are:
> "These pictures, by the way, don't NECESSARILY depict ACTUAL HORSE ANCESTORS..."
> LOL!
> "...BUT, they show FOSSILS THAT WERE PRESENT AT THE SAME TIME as the PRESUMED HORSE
> ANCESTORS"
> LOL!
>
> So, what is such an admitted IMAGINARY LINEAGE doing in an introductory evolution course?
> What does it demonstrate, other than the hubris of Darwinists who think the student will
> passively accept ANYTHING they say as fact?

He's referring to the fact that we can't tell whether a given fossil is
an ancestor or the ancestor's cousin (and I mean that at the species
level, not just the individual level). There may well be fossils of
horse ancestors; in fact it's quite likely. But there's no way to be
sure which fossils are or are not.

And he's also right that it doesn't matter. Even collateral relatives
are good evidence for a family tree, just as one could get a good idea
of your relationships by studying your uncles, aunts, and siblings.

Your problem is that you passively reject everything he says. If you
took your fingers out of your ears you might actually learn something.
And, by the way, you don't have to yell.

[jillery]

On Wed, 4 May 2016 06:54:37 -0700 (PDT), Steady Eddie
<1914o...@gmail.com> wrote:

>Okay, here is Mo Noor's second preview lecture on his course "Introduction to Genetics and Evolution" -
>
>Lecture 2 - Basic Principles and Evidence For Evolution
>https://www.coursera.org/learn/genetics-evolution/lecture/K8SDd/basic-principles-and-evidence-for-evolution-g
>
>Here, Mo begins to carefully "extend" his definition of evolution from examples of micro-evolution, or
>adaptation, such as the peppered moth and asphalt-phobic squirrels, to macro-evolution.
>
>He begins by showing the 60-million year lineage of the modern horse.
>He uses the iconic horse lineage, even though this has been exposed as a hoax - there ARE NO
>FOSSILS OF HORSE ANCESTORS!
>
>Mo adroitly acknowledges this fact, then keeps right on going, as if it is a minor technicality!
>
>His words are:
>"These pictures, by the way, don't NECESSARILY depict ACTUAL HORSE ANCESTORS..."
>LOL!
>"...BUT, they show FOSSILS THAT WERE PRESENT AT THE SAME TIME as the PRESUMED HORSE
>ANCESTORS"
>LOL!

You're playing word games again. Noor's statement does not mean the
same thing as your statement. That we can't know for certain which
fossils are of actual horse ancestors, as opposed to a branch which
died out, does not mean there are no fossils of horse ancestors. The
lineage is not imaginary, but is instead uncertain. Most grownups
understand the difference.

>So, what is such an admitted IMAGINARY LINEAGE doing in an introductory evolution course?
>What does it demonstrate, other than the hubris of Darwinists who think the student will
>passively accept ANYTHING they say as fact?

You can assume that horses had no ancestors, but instead were >poofed<
into existence by a creative deity. But that doesn't explain a
feature of the fossil record. These fossil species appear in a
general progression through time, with the forms more distantly
related to modern horses appearing in older strata, and the forms more
similar to modern horses appearing in more recent strata.

One can assume that a whimsically devious deity just happened to
create new species in just the right order so that they appeared to
have evolved from each other. But one can as easily assume that such
a deity would create new species in some other order, or in no order
at all.

But the more parsimonious explanation, and one that actually explains
the progression of features documented in the fossils, is that these
fossils in fact represent an evolutionary progression. It's not
necessary to know exactly which fossil species is ancestral to another
fossil species in order to accept Evolution.
--
This space is intentionally not blank.

[Mark Isaak]

Yes, he does need to yell. The person he is trying to convince is
himself, and his ears are obstructed by his fingers.

--
Mark Isaak eciton (at) curioustaxonomy (dot) net
"The evil that is in the world always comes of ignorance, and good
intentions may do as much harm as malevolence, if they lack
understanding." - Albert Camus, _The Plague_

[Oxyaena]

Steady Eddie wrote:
> Okay, here is Mo Noor's second preview lecture on his course "Introduction to Genetics and Evolution" -
>
> Lecture 2 - Basic Principles and Evidence For Evolution
> https://www.coursera.org/learn/genetics-evolution/lecture/K8SDd/basic-principles-and-evidence-for-evolution-g
>
> Here, Mo begins to carefully "extend" his definition of evolution from examples of micro-evolution, or
> adaptation, such as the peppered moth and asphalt-phobic squirrels, to macro-evolution.

There's no difference between "micro-evolution" and "macro-evolution",
how do you explain the evolution of five new mouse species in just 260
years on this one island I admittedly forget the name of (wasn't it
somewhere in the Faroe Islands?

>
> He begins by showing the 60-million year lineage of the modern horse.
> He uses the iconic horse lineage, even though this has been exposed as a hoax - there ARE NO
> FOSSILS OF HORSE ANCESTORS!




>
> Mo adroitly acknowledges this fact, then keeps right on going, as if it is a minor technicality!
>
> His words are:
> "These pictures, by the way, don't NECESSARILY depict ACTUAL HORSE ANCESTORS..."
> LOL!
> "...BUT, they show FOSSILS THAT WERE PRESENT AT THE SAME TIME as the PRESUMED HORSE
> ANCESTORS"
> LOL!

Quote mine and ignorance of the fossil record in one sentence! LOL!
Look, all those artworks are depictions of fossils that are horse
ancestors, unless one takes cladistics, and realizes the horses are not
necessarily ancestors to the modern horse, but the closest thing to the
horse ancestors we have. Not everything gets fossilized, fossilization
is a rare process, there are specific requirements in order to be
fossilized. The horse ancestor is presumed to have lived in the deep,
dark, damp forests that covered the Eocene Earth, and since rainforests
aren't the best places for fossilization, since organisms tend to decay
quickly in the rain forest, the conditions in the rainforest isn't the
requisite for fossilization.

>
> So, what is such an admitted IMAGINARY LINEAGE doing in an introductory evolution course?
> What does it demonstrate, other than the hubris of Darwinists who think the student will
> passively accept ANYTHING they say as fact?
>

He didn't say anything about an "IMAGINARY LINEAGE", but given that
you're a Jehovah's Witness, you accept anything the Watchtower Society
says as fact, which means you are promoting double standards, a la
hypocrisy.

--
"I would rather betray the whole world than let the whole world betray
me." - Cao Cao

http://oxyaena.org/

also see: http://thrinaxodon.org/

oxyaena (at) oxyaena.org

[Rolf]

"jillery" <69jp...@gmail.com> wrote in message
news:84bkibliv7gabu1er...@4ax.com...

On the first page of "The First Cimpanzee" by Jeremy Cherfas and John
Gribbin, a Vincent Sarich quoute reads:

I know my molecules had ancestors, the paleontologist can only hope that his
fossils had descendants.

[jillery]

On Thu, 5 May 2016 12:45:09 +0200, "Rolf" <rolf.a...@gmail.com>
wrote:

>On the first page of "The First Cimpanzee" by Jeremy Cherfas and John
>Gribbin, a Vincent Sarich quoute reads:
>
>I know my molecules had ancestors, the paleontologist can only hope that his
>fossils had descendants.

Snarky combined with full-bodied veracity and undertones of irony. I
like it.

[jillery]

On Wed, 4 May 2016 20:51:54 -0400, Oxyaena <oxy...@oxyaena.org>
wrote:

>Steady Eddie wrote:
>> Okay, here is Mo Noor's second preview lecture on his course "Introduction to Genetics and Evolution" -
>>
>> Lecture 2 - Basic Principles and Evidence For Evolution
>> https://www.coursera.org/learn/genetics-evolution/lecture/K8SDd/basic-principles-and-evidence-for-evolution-g
>>
>> Here, Mo begins to carefully "extend" his definition of evolution from examples of micro-evolution, or
>> adaptation, such as the peppered moth and asphalt-phobic squirrels, to macro-evolution.
>
>There's no difference between "micro-evolution" and "macro-evolution",
>how do you explain the evolution of five new mouse species in just 260
>years on this one island I admittedly forget the name of (wasn't it
>somewhere in the Faroe Islands?

Of course, they're all still mice (rnorman isn't the only one who
tests Poe's Law).

>> He begins by showing the 60-million year lineage of the modern horse.
>> He uses the iconic horse lineage, even though this has been exposed as a hoax - there ARE NO
>> FOSSILS OF HORSE ANCESTORS!
>
>
>
>
>>
>> Mo adroitly acknowledges this fact, then keeps right on going, as if it is a minor technicality!
>>
>> His words are:
>> "These pictures, by the way, don't NECESSARILY depict ACTUAL HORSE ANCESTORS..."
>> LOL!
>> "...BUT, they show FOSSILS THAT WERE PRESENT AT THE SAME TIME as the PRESUMED HORSE
>> ANCESTORS"
>> LOL!
>
>Quote mine and ignorance of the fossil record in one sentence! LOL!

Noting the unintended twofer; on account. Posting the ironic LOL!;
priceless. Mastercard.

>Look, all those artworks are depictions of fossils that are horse
>ancestors, unless one takes cladistics, and realizes the horses are not
>necessarily ancestors to the modern horse, but the closest thing to the
>horse ancestors we have. Not everything gets fossilized, fossilization
>is a rare process, there are specific requirements in order to be
>fossilized. The horse ancestor is presumed to have lived in the deep,
>dark, damp forests that covered the Eocene Earth, and since rainforests
>aren't the best places for fossilization, since organisms tend to decay
>quickly in the rain forest, the conditions in the rainforest isn't the
>requisite for fossilization.
>
>>
>> So, what is such an admitted IMAGINARY LINEAGE doing in an introductory evolution course?
>> What does it demonstrate, other than the hubris of Darwinists who think the student will
>> passively accept ANYTHING they say as fact?
>>
>He didn't say anything about an "IMAGINARY LINEAGE", but given that
>you're a Jehovah's Witness, you accept anything the Watchtower Society
>says as fact, which means you are promoting double standards, a la
>hypocrisy.
--

[Steady Eddie]

On Wednesday, 4 May 2016 09:58:22 UTC-6, John Harshman wrote:
> On 5/4/16 6:54 AM, Steady Eddie wrote:
> > Okay, here is Mo Noor's second preview lecture on his course "Introduction to Genetics and Evolution" -
> >
> > Lecture 2 - Basic Principles and Evidence For Evolution
> > https://www.coursera.org/learn/genetics-evolution/lecture/K8SDd/basic-principles-and-evidence-for-evolution-g
> >
> > Here, Mo begins to carefully "extend" his definition of evolution from examples of micro-evolution, or
> > adaptation, such as the peppered moth and asphalt-phobic squirrels, to macro-evolution.
> >
> > He begins by showing the 60-million year lineage of the modern horse.
> > He uses the iconic horse lineage, even though this has been exposed as a hoax - there ARE NO
> > FOSSILS OF HORSE ANCESTORS!
>
> Explain.

Read the next sentence.

> > Mo adroitly acknowledges this fact, then keeps right on going, as if it is a minor technicality!
> >
> > His words are:
> > "These pictures, by the way, don't NECESSARILY depict ACTUAL HORSE ANCESTORS..."
> > LOL!
> > "...BUT, they show FOSSILS THAT WERE PRESENT AT THE SAME TIME as the PRESUMED HORSE
> > ANCESTORS"
> > LOL!
> >
> > So, what is such an admitted IMAGINARY LINEAGE doing in an introductory evolution course?
> > What does it demonstrate, other than the hubris of Darwinists who think the student will
> > passively accept ANYTHING they say as fact?
>
> He's referring to the fact that we can't tell whether a given fossil is
> an ancestor or the ancestor's cousin (and I mean that at the species
> level, not just the individual level). There may well be fossils of
> horse ancestors; in fact it's quite likely. But there's no way to be
> sure which fossils are or are not.
>
> And he's also right that it doesn't matter. Even collateral relatives
> are good evidence for a family tree, just as one could get a good idea
> of your relationships by studying your uncles, aunts, and siblings.

You mean PRESUMED "collateral relatives".
LOL!

> Your problem is that you passively reject everything he says. If you
> took your fingers out of your ears you might actually learn something.
> And, by the way, you don't have to yell.

LOL!

[Steady Eddie]

LOL!

[John Harshman]

On 5/5/16 7:00 AM, Steady Eddie wrote:
> On Wednesday, 4 May 2016 09:58:22 UTC-6, John Harshman wrote:
>> On 5/4/16 6:54 AM, Steady Eddie wrote:
>>> Okay, here is Mo Noor's second preview lecture on his course "Introduction to Genetics and Evolution" -
>>>
>>> Lecture 2 - Basic Principles and Evidence For Evolution
>>> https://www.coursera.org/learn/genetics-evolution/lecture/K8SDd/basic-principles-and-evidence-for-evolution-g
>>>
>>> Here, Mo begins to carefully "extend" his definition of evolution from examples of micro-evolution, or
>>> adaptation, such as the peppered moth and asphalt-phobic squirrels, to macro-evolution.
>>>
>>> He begins by showing the 60-million year lineage of the modern horse.
>>> He uses the iconic horse lineage, even though this has been exposed as a hoax - there ARE NO
>>> FOSSILS OF HORSE ANCESTORS!
>>
>> Explain.
>
> Read the next sentence.

Only a misunderstanding of what Mo said makes your interpretation possible.

>>> Mo adroitly acknowledges this fact, then keeps right on going, as if it is a minor technicality!
>>>
>>> His words are:
>>> "These pictures, by the way, don't NECESSARILY depict ACTUAL HORSE ANCESTORS..."
>>> LOL!
>>> "...BUT, they show FOSSILS THAT WERE PRESENT AT THE SAME TIME as the PRESUMED HORSE
>>> ANCESTORS"
>>> LOL!
>>>
>>> So, what is such an admitted IMAGINARY LINEAGE doing in an introductory evolution course?
>>> What does it demonstrate, other than the hubris of Darwinists who think the student will
>>> passively accept ANYTHING they say as fact?
>>
>> He's referring to the fact that we can't tell whether a given fossil is
>> an ancestor or the ancestor's cousin (and I mean that at the species
>> level, not just the individual level). There may well be fossils of
>> horse ancestors; in fact it's quite likely. But there's no way to be
>> sure which fossils are or are not.
>>
>> And he's also right that it doesn't matter. Even collateral relatives
>> are good evidence for a family tree, just as one could get a good idea
>> of your relationships by studying your uncles, aunts, and siblings.
>
> You mean PRESUMED "collateral relatives".
> LOL!

If it looks like a duck and quacks like a duck you have reason to
believe it's related to a duck. Take your fingers out of your ears.

[Bob Casanova]

On Thu, 5 May 2016 07:02:27 -0700 (PDT), the following
appeared in talk.origins, posted by Steady Eddie
<1914o...@gmail.com>:

[Ignored by Eddie...]

>> One can assume that a whimsically devious deity just happened to
>> create new species in just the right order so that they appeared to
>> have evolved from each other. But one can as easily assume that such
>> a deity would create new species in some other order, or in no order
>> at all.

[Ignored by Eddie...]

>> But the more parsimonious explanation, and one that actually explains
>> the progression of features documented in the fossils, is that these
>> fossils in fact represent an evolutionary progression. It's not
>> necessary to know exactly which fossil species is ancestral to another
>> fossil species in order to accept Evolution.

[Ignored by Eddie...]

>LOL!

Just a note: Laughing at a valid post doesn't even come
close to refutation. Just sayin'...

Stop lolling around and listen for a change, and, if you
detect errors, post a response/refutation which addresses
those particular errors.
--

Bob C.

"The most exciting phrase to hear in science,
the one that heralds new discoveries, is not
'Eureka!' but 'That's funny...'"

- Isaac Asimov

[jillery]

On Thu, 5 May 2016 07:02:27 -0700 (PDT), Steady Eddie

>LOL!


The above is the kind of reply some posters think is worthy of their
support. Is anybody surprised?

You would have been better off saying nothing and let others think
you're an idiot, instead of posting the above and proving it.

[Rolf]

"jillery" <69jp...@gmail.com> wrote in message

news:bs5nibdfg8gfpqbrk...@4ax.com...

2nd.

Rolf

[Steady Eddie]

On Thursday, 5 May 2016 08:58:19 UTC-6, John Harshman wrote:
> On 5/5/16 7:00 AM, Steady Eddie wrote:
> > On Wednesday, 4 May 2016 09:58:22 UTC-6, John Harshman wrote:
> >> On 5/4/16 6:54 AM, Steady Eddie wrote:
> >>> Okay, here is Mo Noor's second preview lecture on his course "Introduction to Genetics and Evolution" -
> >>>
> >>> Lecture 2 - Basic Principles and Evidence For Evolution
> >>> https://www.coursera.org/learn/genetics-evolution/lecture/K8SDd/basic-principles-and-evidence-for-evolution-g
> >>>
> >>> Here, Mo begins to carefully "extend" his definition of evolution from examples of micro-evolution, or
> >>> adaptation, such as the peppered moth and asphalt-phobic squirrels, to macro-evolution.
> >>>
> >>> He begins by showing the 60-million year lineage of the modern horse.
> >>> He uses the iconic horse lineage, even though this has been exposed as a hoax - there ARE NO
> >>> FOSSILS OF HORSE ANCESTORS!
> >>
> >> Explain.
> >
> > Read the next sentence.
>
> Only a misunderstanding of what Mo said makes your interpretation possible.

Please explain.

> >>> Mo adroitly acknowledges this fact, then keeps right on going, as if it is a minor technicality!
> >>>
> >>> His words are:
> >>> "These pictures, by the way, don't NECESSARILY depict ACTUAL HORSE ANCESTORS..."
> >>> LOL!
> >>> "...BUT, they show FOSSILS THAT WERE PRESENT AT THE SAME TIME as the PRESUMED HORSE
> >>> ANCESTORS"
> >>> LOL!
> >>>
> >>> So, what is such an admitted IMAGINARY LINEAGE doing in an introductory evolution course?
> >>> What does it demonstrate, other than the hubris of Darwinists who think the student will
> >>> passively accept ANYTHING they say as fact?
> >>
> >> He's referring to the fact that we can't tell whether a given fossil is
> >> an ancestor or the ancestor's cousin (and I mean that at the species
> >> level, not just the individual level). There may well be fossils of
> >> horse ancestors; in fact it's quite likely. But there's no way to be
> >> sure which fossils are or are not.
> >>
> >> And he's also right that it doesn't matter. Even collateral relatives
> >> are good evidence for a family tree, just as one could get a good idea
> >> of your relationships by studying your uncles, aunts, and siblings.
> >
> > You mean PRESUMED "collateral relatives".
> > LOL!
>
> If it looks like a duck and quacks like a duck you have reason to
> believe it's related to a duck. Take your fingers out of your ears.

That's the same thing I said about the obvious appearance of design in life...

[Kalkidas]

Zing!

Looks like it's designed, sounds like it's designed, walks like it's
designed...

It's designed.

[Robert Camp]

Problem is it neither looks, sounds or walks like it's designed.

Other than that, you've got a killer argument.

[John Harshman]

On 5/5/16 5:12 PM, Steady Eddie wrote:
> On Thursday, 5 May 2016 08:58:19 UTC-6, John Harshman wrote:
>> On 5/5/16 7:00 AM, Steady Eddie wrote:
>>> On Wednesday, 4 May 2016 09:58:22 UTC-6, John Harshman wrote:
>>>> On 5/4/16 6:54 AM, Steady Eddie wrote:
>>>>> Okay, here is Mo Noor's second preview lecture on his course "Introduction to Genetics and Evolution" -
>>>>>
>>>>> Lecture 2 - Basic Principles and Evidence For Evolution
>>>>> https://www.coursera.org/learn/genetics-evolution/lecture/K8SDd/basic-principles-and-evidence-for-evolution-g
>>>>>
>>>>> Here, Mo begins to carefully "extend" his definition of evolution from examples of micro-evolution, or
>>>>> adaptation, such as the peppered moth and asphalt-phobic squirrels, to macro-evolution.
>>>>>
>>>>> He begins by showing the 60-million year lineage of the modern horse.
>>>>> He uses the iconic horse lineage, even though this has been exposed as a hoax - there ARE NO
>>>>> FOSSILS OF HORSE ANCESTORS!
>>>>
>>>> Explain.
>>>
>>> Read the next sentence.
>>
>> Only a misunderstanding of what Mo said makes your interpretation possible.
>
> Please explain.

Already there below, about three posts ago. Start with "He's referring...".

>>>>> Mo adroitly acknowledges this fact, then keeps right on going, as if it is a minor technicality!
>>>>>
>>>>> His words are:
>>>>> "These pictures, by the way, don't NECESSARILY depict ACTUAL HORSE ANCESTORS..."
>>>>> LOL!
>>>>> "...BUT, they show FOSSILS THAT WERE PRESENT AT THE SAME TIME as the PRESUMED HORSE
>>>>> ANCESTORS"
>>>>> LOL!
>>>>>
>>>>> So, what is such an admitted IMAGINARY LINEAGE doing in an introductory evolution course?
>>>>> What does it demonstrate, other than the hubris of Darwinists who think the student will
>>>>> passively accept ANYTHING they say as fact?
>>>>
>>>> He's referring to the fact that we can't tell whether a given fossil is
>>>> an ancestor or the ancestor's cousin (and I mean that at the species
>>>> level, not just the individual level). There may well be fossils of
>>>> horse ancestors; in fact it's quite likely. But there's no way to be
>>>> sure which fossils are or are not.
>>>>
>>>> And he's also right that it doesn't matter. Even collateral relatives
>>>> are good evidence for a family tree, just as one could get a good idea
>>>> of your relationships by studying your uncles, aunts, and siblings.
>>>
>>> You mean PRESUMED "collateral relatives".
>>> LOL!
>>
>> If it looks like a duck and quacks like a duck you have reason to
>> believe it's related to a duck. Take your fingers out of your ears.
>
> That's the same thing I said about the obvious appearance of design in life...

That's a kindergarten retort. As usual.

[Steady Eddie]

On Thursday, 5 May 2016 19:58:17 UTC-6, John Harshman wrote:
> On 5/5/16 5:12 PM, Steady Eddie wrote:
> > On Thursday, 5 May 2016 08:58:19 UTC-6, John Harshman wrote:
> >> On 5/5/16 7:00 AM, Steady Eddie wrote:
> >>> On Wednesday, 4 May 2016 09:58:22 UTC-6, John Harshman wrote:
> >>>> On 5/4/16 6:54 AM, Steady Eddie wrote:
> >>>>> Okay, here is Mo Noor's second preview lecture on his course "Introduction to Genetics and Evolution" -
> >>>>>
> >>>>> Lecture 2 - Basic Principles and Evidence For Evolution
> >>>>> https://www.coursera.org/learn/genetics-evolution/lecture/K8SDd/basic-principles-and-evidence-for-evolution-g
> >>>>>
> >>>>> Here, Mo begins to carefully "extend" his definition of evolution from examples of micro-evolution, or
> >>>>> adaptation, such as the peppered moth and asphalt-phobic squirrels, to macro-evolution.
> >>>>>
> >>>>> He begins by showing the 60-million year lineage of the modern horse.
> >>>>> He uses the iconic horse lineage, even though this has been exposed as a hoax - there ARE NO
> >>>>> FOSSILS OF HORSE ANCESTORS!
> >>>>
> >>>> Explain.
> >>>
> >>> Read the next sentence.
> >>
> >> Only a misunderstanding of what Mo said makes your interpretation possible.
> >
> > Please explain.
>
> Already there below, about three posts ago. Start with "He's referring...".

Seriously?
Are you blind, deaf, or mentally 'challenged'?
Do I need to rub your nose in Mo shit? He explicitly said that the fossils
were 'NOT part of the horse lineage', not "Well... we can't tell for sure..."

[Steady Eddie]

Do you really need me to rub your nose in your own shit, or do you admit
that Dawkins explicitly stated that life 'looks, sounds, and walks like
it's designed', probably many times?

[Steady Eddie]

The careful reader can judge for himself who's in kindergarten.

[John Harshman]

On 5/5/16 7:37 PM, Steady Eddie wrote:
> On Thursday, 5 May 2016 19:58:17 UTC-6, John Harshman wrote:
>> On 5/5/16 5:12 PM, Steady Eddie wrote:
>>> On Thursday, 5 May 2016 08:58:19 UTC-6, John Harshman wrote:
>>>> On 5/5/16 7:00 AM, Steady Eddie wrote:
>>>>> On Wednesday, 4 May 2016 09:58:22 UTC-6, John Harshman wrote:
>>>>>> On 5/4/16 6:54 AM, Steady Eddie wrote:
>>>>>>> Okay, here is Mo Noor's second preview lecture on his course "Introduction to Genetics and Evolution" -
>>>>>>>
>>>>>>> Lecture 2 - Basic Principles and Evidence For Evolution
>>>>>>> https://www.coursera.org/learn/genetics-evolution/lecture/K8SDd/basic-principles-and-evidence-for-evolution-g
>>>>>>>
>>>>>>> Here, Mo begins to carefully "extend" his definition of evolution from examples of micro-evolution, or
>>>>>>> adaptation, such as the peppered moth and asphalt-phobic squirrels, to macro-evolution.
>>>>>>>
>>>>>>> He begins by showing the 60-million year lineage of the modern horse.
>>>>>>> He uses the iconic horse lineage, even though this has been exposed as a hoax - there ARE NO
>>>>>>> FOSSILS OF HORSE ANCESTORS!
>>>>>>
>>>>>> Explain.
>>>>>
>>>>> Read the next sentence.
>>>>
>>>> Only a misunderstanding of what Mo said makes your interpretation possible.
>>>
>>> Please explain.
>>
>> Already there below, about three posts ago. Start with "He's referring...".
>
> Seriously?
> Are you blind, deaf, or mentally 'challenged'?
> Do I need to rub your nose in Mo shit? He explicitly said that the fossils
> were 'NOT part of the horse lineage', not "Well... we can't tell for sure..."

Apparently you have a problem noticing the word "necessarily", even when
you put it in all caps. Go figure.

[John Harshman]

Agreed. Oops, sorry. How about "I know you are but what am I?"

[Steady Eddie]

Every charlatan keeps his options open...

> >>>>>>> Mo adroitly acknowledges this fact, then keeps right on going, as if it is a minor technicality!
> >>>>>>>
> >>>>>>> His words are:
> >>>>>>> "These pictures, by the way, don't NECESSARILY depict ACTUAL HORSE ANCESTORS..."
> >>>>>>> LOL!
> >>>>>>> "...BUT, they show FOSSILS THAT WERE PRESENT AT THE SAME TIME as the PRESUMED HORSE
> >>>>>>> ANCESTORS"
> >>>>>>> LOL!
> >>>>>>>
> >>>>>>> So, what is such an admitted IMAGINARY LINEAGE doing in an introductory evolution course?
> >>>>>>> What does it demonstrate, other than the hubris of Darwinists who think the student will
> >>>>>>> passively accept ANYTHING they say as fact?
> >>>>>>
> >>>>>> He's referring to the fact that we can't tell whether a given fossil is
> >>>>>> an ancestor or the ancestor's cousin (and I mean that at the species
> >>>>>> level, not just the individual level). There may well be fossils of
> >>>>>> horse ancestors; in fact it's quite likely. But there's no way to be
> >>>>>> sure which fossils are or are not.
> >>>>>>
> >>>>>> And he's also right that it doesn't matter. Even collateral relatives
> >>>>>> are good evidence for a family tree, just as one could get a good idea
> >>>>>> of your relationships by studying your uncles, aunts, and siblings.
> >>>>>
> >>>>> You mean PRESUMED "collateral relatives".
> >>>>> LOL!
> >>>>
> >>>> If it looks like a duck and quacks like a duck you have reason to
> >>>> believe it's related to a duck. Take your fingers out of your ears.
> >>>
> >>> That's the same thing I said about the obvious appearance of design in life...
> >>
> >> That's a kindergarten retort. As usual.

We'll see...

[Robert Camp]

On 5/5/16 7:33 PM, Steady Eddie wrote:
> On Thursday, 5 May 2016 19:43:18 UTC-6, Robert Camp wrote:
>> On 5/5/16 5:19 PM, Kalkidas wrote:
>>> On 5/5/2016 5:12 PM, Steady Eddie wrote:
>>>> On Thursday, 5 May 2016 08:58:19 UTC-6, John Harshman wrote:
>>>>> On 5/5/16 7:00 AM, Steady Eddie wrote:
>>>>>> On Wednesday, 4 May 2016 09:58:22 UTC-6, John Harshman wrote:
>>>>>>> On 5/4/16 6:54 AM, Steady Eddie wrote:

<snip>

>>>>> If it looks like a duck and quacks like a duck you have reason to
>>>>> believe it's related to a duck. Take your fingers out of your ears.
>>>>
>>>> That's the same thing I said about the obvious appearance of design in
>>>> life...
>>>
>>> Zing!
>>>
>>> Looks like it's designed, sounds like it's designed, walks like it's
>>> designed...
>>>
>>> It's designed.
>>
>> Problem is it neither looks, sounds or walks like it's designed.
>>
>> Other than that, you've got a killer argument.
>
> Do you really need me to rub your nose in your own shit, or do you admit
> that Dawkins explicitly stated that life 'looks, sounds, and walks like
> it's designed', probably many times?

Once again, I am under no delusions that Mr. Eddie has either the
capacity or the inclination to examine and understand these issues. But
anyone else who might want to know my answer to the above question can
read this,

http://www.csicop.org/specialarticles/show/design_by_any_other_name

Should someone who actually has the grey matter to "rub my nose" in
these opinions be moved to respond I will happily expound upon my position.

[Steady Eddie]

Your writing is WAY too boring to read through your whole blog.
You're a buffoon.

[jillery]

And Steadly continues to audition for the role of the unenlightened
Helen Keller:

<https://www.youtube.com/watch?v=EHwoRFe70jk>

[jillery]

How many people are you going to ignore this time, as they tell you
that what you say Noor says is clearly and unambiguously not what he
said?

>> >>>>> Mo adroitly acknowledges this fact, then keeps right on going, as if it is a minor technicality!
>> >>>>>
>> >>>>> His words are:
>> >>>>> "These pictures, by the way, don't NECESSARILY depict ACTUAL HORSE ANCESTORS..."
>> >>>>> LOL!
>> >>>>> "...BUT, they show FOSSILS THAT WERE PRESENT AT THE SAME TIME as the PRESUMED HORSE
>> >>>>> ANCESTORS"
>> >>>>> LOL!
>> >>>>>
>> >>>>> So, what is such an admitted IMAGINARY LINEAGE doing in an introductory evolution course?
>> >>>>> What does it demonstrate, other than the hubris of Darwinists who think the student will
>> >>>>> passively accept ANYTHING they say as fact?
>> >>>>
>> >>>> He's referring to the fact that we can't tell whether a given fossil is
>> >>>> an ancestor or the ancestor's cousin (and I mean that at the species
>> >>>> level, not just the individual level). There may well be fossils of
>> >>>> horse ancestors; in fact it's quite likely. But there's no way to be
>> >>>> sure which fossils are or are not.
>> >>>>
>> >>>> And he's also right that it doesn't matter. Even collateral relatives
>> >>>> are good evidence for a family tree, just as one could get a good idea
>> >>>> of your relationships by studying your uncles, aunts, and siblings.
>> >>>
>> >>> You mean PRESUMED "collateral relatives".
>> >>> LOL!
>> >>
>> >> If it looks like a duck and quacks like a duck you have reason to
>> >> believe it's related to a duck. Take your fingers out of your ears.
>> >
>> > That's the same thing I said about the obvious appearance of design in life...
>>
>> That's a kindergarten retort. As usual.

[jillery]

Too bad for you that Dawkins doesn't mean "designed" the way you mean
it.

And for those pedant police who pretend that it hasn't been clearly
addressed before, Dawkins believes that design refers to a pattern,
and does not assume design implies an unseen, unknown, undefined
Designer like Steadly does.

[jillery]

Of course, the careful reader knows you haven't yet qualified for
kindergarten.

[jillery]

Your article moves the field of battle, from a metaphysical question
on whether life is designed, to a semantic question on the use of the
word itself. IIUC you hope to short-circuit IDiots' claims by arguing
against the use of the word "design" itself.

To that I make three points. First, to imagine that IDiots would drop
their illogical claim that life is designed, any more than they would
drop their illogical claim that design necessarily implies a designer,
simply because "Darwinists" don't use the word, is a false hope. But
we all tilt against the windmills of our own choosing.

Second, the point you make is similar to one recently expressed in
T.O., against the use of metaphorical language in general. To which I
repeat now the point I made then; in the rhetorical battle to
persuade, to disarm oneself of metaphors is to choose to take a nerf
bat to a gunfight; you hobble yourself unnecessarily. It may be that
you find metaphors unpersuasive and/or worse than useless, but my
impression is that's not the case for most people.

Worse, you would disarm yourself on yet another false hope, that by
not using metaphors like "design", that would remove from IDiots those
opportunities to quote mine, obfuscate, and misrepresent. But as we
have seen in T.O. too often, they don't just seek out those
opportunities. Instead, they create them, by simply ignoring what is
plainly written, and/or substituting their own "egregioiusly
polemical" words and phrases. My impression is most IDiots are
well-practiced advocates of a paraphrase of the old saying: when both
facts and logic are against you, pound on the table.

Third, to argue against apparent design of life is a fool's errand.
Design as a noun can simply refer to any pattern, whether real or
illusory. But even disregarding IDiots' illusory claims, life is
replete with real patterns, from the DNA code, to molecular
structures, to multi-cellular life, to the radiation of morphologies
within and without species. To deny those patterns would give IDiots a
new suite of weapons, to say that "Darwinists" deny their own
scientific evidence.

Whether one chooses specifically to use "design" or not, to use
generally metaphors or not, the real argument here is not a semantic
one. It is instead an objective one, whether designs necessarily are
designed with intent by a designer. They are not, and that moots your
objections.

When last you lowered yourself to reply to me, you merely tossed in
your two pence of peanut shells and then willfully ran away. Now you
have loaded both barrels not with buckshot, but instead with rock
salt, presumably to baldly assert that anyone who disagrees with you
lacks sufficient gray matter, a behavior you share with Steadly. Let's
see if this time, instead of accommodating your base nature, you rise
above it.

[John Harshman]

So you agree that Mo didn't say what you just alleged, and in fact said
what I did.

[Robert Camp]

On 5/6/16 5:19 AM, jillery wrote:
> On Thu, 5 May 2016 21:09:23 -0700, Robert Camp
> <rober...@hotmail.com> wrote:
>
>> On 5/5/16 7:33 PM, Steady Eddie wrote:
>>> On Thursday, 5 May 2016 19:43:18 UTC-6, Robert Camp wrote:
>>>> On 5/5/16 5:19 PM, Kalkidas wrote:
>>>>> On 5/5/2016 5:12 PM, Steady Eddie wrote:
>>>>>> On Thursday, 5 May 2016 08:58:19 UTC-6, John Harshman wrote:
>>>>>>> On 5/5/16 7:00 AM, Steady Eddie wrote:
>>>>>>>> On Wednesday, 4 May 2016 09:58:22 UTC-6, John Harshman wrote:
>>>>>>>>> On 5/4/16 6:54 AM, Steady Eddie wrote:

<snip>

> When last you lowered yourself to reply to me, you merely tossed in
> your two pence of peanut shells and then willfully ran away. Now you
> have loaded both barrels not with buckshot, but instead with rock
> salt, presumably to baldly assert that anyone who disagrees with you
> lacks sufficient gray matter, a behavior you share with Steadly. Let's
> see if this time, instead of accommodating your base nature, you rise
> above it.

I have a habit of reading through a reply before responding. In has,
once again, saved me a lot of time, confirming my instinct that you are
far too querulous to indulge (e.g., my remark about grey matter was
obviously directed at SE and no one else).

In this, and so much else, you are like the object of your obsession.
And in keeping, you may now content yourself (as he does) that anyone
not wishing to satisfy your need for endless, juvenile back-and-forth is
running away.

[jillery]

On Fri, 6 May 2016 08:10:08 -0700, Robert Camp

<rober...@hotmail.com> wrote:

>On 5/6/16 5:19 AM, jillery wrote:
>> On Thu, 5 May 2016 21:09:23 -0700, Robert Camp
>> <rober...@hotmail.com> wrote:
>>
>>> On 5/5/16 7:33 PM, Steady Eddie wrote:
>>>> On Thursday, 5 May 2016 19:43:18 UTC-6, Robert Camp wrote:
>>>>> On 5/5/16 5:19 PM, Kalkidas wrote:
>>>>>> On 5/5/2016 5:12 PM, Steady Eddie wrote:
>>>>>>> On Thursday, 5 May 2016 08:58:19 UTC-6, John Harshman wrote:
>>>>>>>> On 5/5/16 7:00 AM, Steady Eddie wrote:
>>>>>>>>> On Wednesday, 4 May 2016 09:58:22 UTC-6, John Harshman wrote:
>>>>>>>>>> On 5/4/16 6:54 AM, Steady Eddie wrote:
>
><snip>

<restored>

>> When last you lowered yourself to reply to me, you merely tossed in
>> your two pence of peanut shells and then willfully ran away. Now you
>> have loaded both barrels not with buckshot, but instead with rock
>> salt, presumably to baldly assert that anyone who disagrees with you
>> lacks sufficient gray matter, a behavior you share with Steadly. Let's
>> see if this time, instead of accommodating your base nature, you rise
>> above it.

Apparently not.

>I have a habit of reading through a reply before responding. In has,
>once again, saved me a lot of time, confirming my instinct that you are
>far too querulous to indulge (e.g., my remark about grey matter was
>obviously directed at SE and no one else).
>
>In this, and so much else, you are like the object of your obsession.
>And in keeping, you may now content yourself (as he does) that anyone
>not wishing to satisfy your need for endless, juvenile back-and-forth is
>running away.

So much for your promise to "happily expound on your position".
Apparently you think it makes you look clever to act just like the
village idiot. You don't even have that as an excuse.

[jillery]

On Fri, 6 May 2016 08:10:08 -0700, Robert Camp

<rober...@hotmail.com> wrote:

>On 5/6/16 5:19 AM, jillery wrote:
>> On Thu, 5 May 2016 21:09:23 -0700, Robert Camp
>> <rober...@hotmail.com> wrote:
>>
>>> On 5/5/16 7:33 PM, Steady Eddie wrote:
>>>> On Thursday, 5 May 2016 19:43:18 UTC-6, Robert Camp wrote:
>>>>> On 5/5/16 5:19 PM, Kalkidas wrote:
>>>>>> On 5/5/2016 5:12 PM, Steady Eddie wrote:
>>>>>>> On Thursday, 5 May 2016 08:58:19 UTC-6, John Harshman wrote:
>>>>>>>> On 5/5/16 7:00 AM, Steady Eddie wrote:
>>>>>>>>> On Wednesday, 4 May 2016 09:58:22 UTC-6, John Harshman wrote:
>>>>>>>>>> On 5/4/16 6:54 AM, Steady Eddie wrote:
>
>>>
>>><snip>
>>>

>>>>>>>> If it looks like a duck and quacks like a duck you have reason to
>>>>>>>> believe it's related to a duck. Take your fingers out of your ears.
>>>>>>>
>>>>>>> That's the same thing I said about the obvious appearance of design in
>>>>>>> life...
>>>>>>
>>>>>> Zing!
>>>>>>
>>>>>> Looks like it's designed, sounds like it's designed, walks like it's
>>>>>> designed...
>>>>>>
>>>>>> It's designed.
>>>>>
>>>>> Problem is it neither looks, sounds or walks like it's designed.
>>>>>
>>>>> Other than that, you've got a killer argument.
>>>>
>>>> Do you really need me to rub your nose in your own shit, or do you admit
>>>> that Dawkins explicitly stated that life 'looks, sounds, and walks like
>>>> it's designed', probably many times?
>>>
>>>Once again, I am under no delusions that Mr. Eddie has either the
>>>capacity or the inclination to examine and understand these issues. But
>>>anyone else who might want to know my answer to the above question can
>>>read this,
>>>
>>>http://www.csicop.org/specialarticles/show/design_by_any_other_name
>>>
>>>Should someone who actually has the grey matter to "rub my nose" in
>>>these opinions be moved to respond I will happily expound upon my position.

<your snip of relevant content restored>

>> When last you lowered yourself to reply to me, you merely tossed in
>> your two pence of peanut shells and then willfully ran away. Now you
>> have loaded both barrels not with buckshot, but instead with rock
>> salt, presumably to baldly assert that anyone who disagrees with you
>> lacks sufficient gray matter, a behavior you share with Steadly. Let's
>> see if this time, instead of accommodating your base nature, you rise
>> above it.
>
>I have a habit of reading through a reply before responding. In has,
>once again, saved me a lot of time, confirming my instinct that you are
>far too querulous to indulge (e.g., my remark about grey matter was
>obviously directed at SE and no one else).
>
>In this, and so much else, you are like the object of your obsession.
>And in keeping, you may now content yourself (as he does) that anyone
>not wishing to satisfy your need for endless, juvenile back-and-forth is
>running away.

There's something wrong with your emotional development, that you
openly challenge Steadly, who appears to be mentally defective, while
in the very next iteration you openly run away from your own
invitation for anyone to reply to you.

Your own querulous reply to Steadly makes it obvious that you have no
problem being querulous yourself. My post above is cogent, coherent,
and to-the-point. That you consider it "too querulous" to merit at
least a civil reply from you is mitigated by the kind of inane and
incoherent replies you post to me.

[Steady Eddie]

Where did you get that idea?

[Kalkidas]

"In his book The Blind Watchmaker, Dawkins wrote: “Biology is the study
of complicated things that give the appearance of having been designed
for a purpose”..."

Obviously, Dawkins means "designed" exactly the way you mean it.

[jillery]

And Kalkidas posts yet another Creationist quote-mine.

Steadly has made it very clear on many occasions that he believes life
was created as described in Watchtower comic books.

[jillery]

On Fri, 6 May 2016 17:07:08 -0700 (PDT), Steady Eddie

>> Designer like Steadly does.

>>
>Where did you get that idea?

Since you asked, I read and understand his books, instead of looking
for quote mines, like you and Kalky do.

HTH but I doubt it.

[Steady Eddie]

I already QUOTED what Mo said.
So, then, what's the story behind how a "possible" horse lineage got accepted as 'real' evidence for anything, and for generations?
And, especially, how it got included as evidence of a horse's ancestry in a 2016 course by an expert in the
field?

[Steady Eddie]

Spoken by The Bard himself...whatever he said.

[Steady Eddie]

Yep, she's on a Jillery Jiggle.
Documented.

[Steady Eddie]

So, Jillery, which part of:

"Biology is the study of complicated things that give the appearance of having been designed
for a purpose"

Did Dawkins actually mean?

[jillery]

On Fri, 6 May 2016 19:43:06 -0700 (PDT), Steady Eddie

>So, Jillery, which part of:
>"Biology is the study of complicated things that give the appearance of having been designed
>for a purpose"
>Did Dawkins actually mean?

It's bad enough that you rely on quote-mines, but you didn't even look
this one up for yourself. And if you read the book, you would know
that Dawkins doesn't equate "appearance of design" with "actual
design".

[jillery]

On Fri, 6 May 2016 19:39:15 -0700 (PDT), Steady Eddie

>Yep, she's on a Jillery Jiggle.
>Documented.

In order for your false equivalence to work, you have to actually know
what the words mean. Just sayin'.

[John Harshman]

Yes, but then you tried to paraphrase it and got it all wrong, which
shows you didn't understand it very well.

> So, then, what's the story behind how a "possible" horse lineage got accepted as 'real' evidence for anything, and for generations?
> And, especially, how it got included as evidence of a horse's ancestry in a 2016 course by an expert in the
> field?

I don't think you will ever understand any of this until you decide to
listen to what people are saying and stop accusing everyone of lying to
you. Open your ears and turn on your brain.

Some of the horses probably are ancestral to others. We just can't tell
which. What we can tell is that they all relate in a tree structure and
that the most primitive features appear earlier in time than the more
derived ones. And that tells us we're talking about common descent. It
doesn't matter for that purpose if we have parents or uncles or cousins.
So yes, the horse tree is great evidence for evolution way past the
species level, and that's why Mo included it.

[Sean Dillon]

On Friday, May 6, 2016 at 9:48:14 PM UTC-5, Steady Eddie wrote:

>
> So, Jillery, which part of:
> "Biology is the study of complicated things that give the appearance of having been designed
> for a purpose"
> Did Dawkins actually mean?

He meant that the appearance of design was only that: an APPEARANCE, NOT A REALITY... which is clear when the quote is read in its full context, which is available at the address below.

https://books.google.com/books?id=sPpaZnZMDG0C&printsec=frontcover&dq=Blind+Watchmaker&hl=en&sa=X&ved=0ahUKEwjo8f-xksfMAhUJFx4KHSStA8EQ6AEIJTAB#v=onepage&q=Blind%20Watchmaker&f=false

The book was written in 1996, before internet quote-miners were common, so it probably didn't occur to Dawkins that anyone would be morally bankrupt enough to selectively quote his work so as to give the appearance that he meant the opposite of what his text, when actually read, was clearly arguing.

[Burkhard]

Because quite often, this is the only evidence that is needed. If you
trawl through a big box of ancient family photographs, you might find
that say a large number of males share a characteristic feature, say an
unusually shaped birthmark. On that basis, you can form a well supported
theory that the males with that mark are blood relatives, while the
others married into your family.

If you then find a photograph without names, a male dressed in the
traditional clothing of an orthodox priest and in the background you see
St Petersburg, you can build quite well supported theories of your
ancestors: it would then seem that you are descendant from Russians,
that at one point your ancestors were Russian orthodox, and maybe that
at that time, they were o average much smaller and more heavy set than
your folks are these days.

This is possible even if it is impossible to say if the person on the
image is your great-great-great....grandfather, i.e. a direct ancestor,
or his brother, cousin etc - so really your great-great-great...greatuncle.

[Steady Eddie]

LOL!
You and Trollery think I claim that Dawkins thinks the appearance of design is real?
Give your heads a shake.
The point is that Dawkins was admitting the appearance of PURPOSEFUL DESIGN BY AN INTELLIGENT
AGENT, not design as in 'A PATTERN', which Trollery claims.

If you were reading this thread, you'd know that I was responding to JH's claim that 'if it looks like a duck...
it's probably a duck'.
The same applies to the appearance of purposeful design by an intelligent agent.

Try to keep up,people.

[Steady Eddie]

...Of course, "this is the only evidence that is needed" if you already believe Darwinism in the first place.
But, in a course explaining 'WHY evolution is true', it is an embarrassingly weak argument.

[Steady Eddie]

I don't think you will ever understand any of this until you decide to apply critical thinking to your
own cherished notion.

> Some of the horses probably are ancestral to others.

Yes, "probably".
Close enough for the rubes Mo thinks he is talking to...
LOL!

> We just can't tell
> which. What we can tell is that they all relate in a tree structure and
> that the most primitive features appear earlier in time than the more
> derived ones. And that tells us we're talking about common descent.

It actually tells us nothing of the sort. The evidence that more 'basic' forms appear earlier than 'modern'
forms is simply a tautology used to infer common descent.
There is no reason why the Creator wouldn't have chosen to proceed from more apparently 'primitive' life
forms to 'modern' life. In fact, it was probably necessary for 'primitive' life, especially microscopic, to
prepare the earth for more 'modern' species, including humans.

> It
> doesn't matter for that purpose if we have parents or uncles or cousins.
> So yes, the horse tree is great evidence for evolution way past the
> species level, and that's why Mo included it.

You and Mo really must rely on the public's lack of imagination to believe that this horse 'tree' points only
to your cherished theory.
LOL!

[Burkhard]

Shrug. As may be (and I'd like to see your math on that), but as there
is no alternative that explains the data as well, it's still more than
sufficient to accept it on rational grounds.

[jillery]

First, it's the only evidence needed if you have a mind familiar with
using logic and reason. Based on your posts, that excludes you.

Second, the purpose of the course isn't to explain WHY evolution is
true. The course is mostly about genetics. It's only the first
chapter which deals with evolution, and only then as it relates to
genetics.

If you really want to know WHY evolution is true, you should read for
comprehension Jerry Coyne's book of that title, which Noor recommends,
as do I.

HTH but I doubt it.

<snip Burkhard's well-reasoned comments, to which you did not respond>

[jillery]

On Sat, 7 May 2016 07:37:57 -0700 (PDT), Steady Eddie
<1914o...@gmail.com> wrote:

>On Friday, 6 May 2016 22:48:13 UTC-6, Sean Dillon wrote:
>> On Friday, May 6, 2016 at 9:48:14 PM UTC-5, Steady Eddie wrote:
>>
>> >
>> > So, Jillery, which part of:
>> > "Biology is the study of complicated things that give the appearance of having been designed
>> > for a purpose"
>> > Did Dawkins actually mean?
>>
>> He meant that the appearance of design was only that: an APPEARANCE, NOT A REALITY... which is clear when the quote is read in its full context, which is available at the address below.
>>
>> https://books.google.com/books?id=sPpaZnZMDG0C&printsec=frontcover&dq=Blind+Watchmaker&hl=en&sa=X&ved=0ahUKEwjo8f-xksfMAhUJFx4KHSStA8EQ6AEIJTAB#v=onepage&q=Blind%20Watchmaker&f=false
>>
>> The book was written in 1996, before internet quote-miners were common, so it probably didn't occur to Dawkins that anyone would be morally bankrupt enough to selectively quote his work so as to give the appearance that he meant the opposite of what his text, when actually read, was clearly arguing.
>
>LOL!
>You and Trollery think I claim that Dawkins thinks the appearance of design is real?
>Give your heads a shake.

That's a reasonable inference from your post. Of course, you didn't
actually say what your claim is, apparently so you could again use the
dishonest troll tactic that you do above, of claiming that's not what
you meant.

>The point is that Dawkins was admitting the appearance of PURPOSEFUL DESIGN BY AN INTELLIGENT
>AGENT, not design as in 'A PATTERN', which Trollery claims.

If you read for comprehension Dawkins' book, from which his quote was
mined, you would know that he describes design as a pattern. So your
alleged distinction is false, and your point is mooted.

>If you were reading this thread, you'd know that I was responding to JH's claim that 'if it looks like a duck...
>it's probably a duck'.

BZZT! In fact, you were responding to my post, which was a response
to your post, which was ultimately a response to Robert Camp's post,
which was a response to Kalky's post. It was Kalky's post which was a
response to Harshman's post, neither of which had anything to do with
what Dawkins claims.

Neither Harshman's point, nor Kalky's point, is the same as your point
here, whatever your actual point is.

>The same applies to the appearance of purposeful design by an intelligent agent.

BZZT! Apparently Harshman disagrees with Dawkins, that life appears
designed. And since Harshman didn't claim that life appears designed,
whether by an intelligent agent or not, the same can't apply here.


>Try to keep up,people.


You first.

[jillery]

I keep telling you, aping other people's word doesn't work when you
don't understand the meaning of those words. Write that one on your
hand.

>> Some of the horses probably are ancestral to others.
>
>Yes, "probably".
>Close enough for the rubes Mo thinks he is talking to...
>LOL!
>
>> We just can't tell
>> which. What we can tell is that they all relate in a tree structure and
>> that the most primitive features appear earlier in time than the more
>> derived ones. And that tells us we're talking about common descent.
>
>It actually tells us nothing of the sort. The evidence that more 'basic' forms appear earlier than 'modern'
>forms is simply a tautology used to infer common descent.

Apparently you have no idea what "tautology" means.

>There is no reason why the Creator wouldn't have chosen to proceed from more apparently 'primitive' life
>forms to 'modern' life. In fact, it was probably necessary for 'primitive' life, especially microscopic, to
>prepare the earth for more 'modern' species, including humans.

I agree it's possible that a Creator could have chosen to follow that
pattern. But it's also possible that said Creator could have chosen
to follow an entirely different pattern. So these hypotheses, while
possible, are also useless.

Instead, the most parsimonious explanation is that extant life derived
from earlier life. That explains the pattern that's observed in the
fossil record, that similar life forms originate in a point in time
and place and become more dissimilar as they radiate away from it.

>> It
>> doesn't matter for that purpose if we have parents or uncles or cousins.
>> So yes, the horse tree is great evidence for evolution way past the
>> species level, and that's why Mo included it.
>
>You and Mo really must rely on the public's lack of imagination to believe that this horse 'tree' points only
>to your cherished theory.
>LOL!

Imagination is not what's needed here, but logic and reason. Just
sayin'.

[Steady Eddie]

I congratulate you on your candour, Burkhard. Most refreshing.

So if it looks like a duck, quacks like a duck... that kind of scientific reasoning?
The kind I was sternly criticized for using WRT the appearance of design in life?

[Steady Eddie]

On Saturday, 7 May 2016 09:53:12 UTC-6, jillery wrote:
> On Sat, 7 May 2016 07:37:57 -0700 (PDT), Steady Eddie
> <1914o...@gmail.com> wrote:
>
> >On Friday, 6 May 2016 22:48:13 UTC-6, Sean Dillon wrote:
> >> On Friday, May 6, 2016 at 9:48:14 PM UTC-5, Steady Eddie wrote:
> >>
> >> >
> >> > So, Jillery, which part of:
> >> > "Biology is the study of complicated things that give the appearance of having been designed
> >> > for a purpose"
> >> > Did Dawkins actually mean?
> >>
> >> He meant that the appearance of design was only that: an APPEARANCE, NOT A REALITY... which is clear when the quote is read in its full context, which is available at the address below.
> >>
> >> https://books.google.com/books?id=sPpaZnZMDG0C&printsec=frontcover&dq=Blind+Watchmaker&hl=en&sa=X&ved=0ahUKEwjo8f-xksfMAhUJFx4KHSStA8EQ6AEIJTAB#v=onepage&q=Blind%20Watchmaker&f=false
> >>
> >> The book was written in 1996, before internet quote-miners were common, so it probably didn't occur to Dawkins that anyone would be morally bankrupt enough to selectively quote his work so as to give the appearance that he meant the opposite of what his text, when actually read, was clearly arguing.
> >
> >LOL!
> >You and Trollery think I claim that Dawkins thinks the appearance of design is real?
> >Give your heads a shake.
>
>
> That's a reasonable inference from your post. Of course, you didn't
> actually say what your claim is, apparently so you could again use the
> dishonest troll tactic that you do above, of claiming that's not what
> you meant.
>
>
> >The point is that Dawkins was admitting the appearance of PURPOSEFUL DESIGN BY AN INTELLIGENT
> >AGENT, not design as in 'A PATTERN', which Trollery claims.
>
>
> If you read for comprehension Dawkins' book, from which his quote was
> mined, you would know that he describes design as a pattern. So your
> alleged distinction is false, and your point is mooted.

That's OK - he can say anything else he wants.
I, DEFINITELY, did NOT claim that Dawkins believes life is designed by an intelligent designer.
I just claim that he admits that IT LOOKS LIKE life was DESIGNED BY AN INTELLIGENT DESIGNER,
hence the term "PURPOSEFULLY", which can not be affected without an intelligent agent.

So your allegation of quote-mining is fallacious.
In fact, I've rarely seen you without your head up your ass.
What's your problem with comprehension as soon as I make a point you find uncomfortable?

> >If you were reading this thread, you'd know that I was responding to JH's claim that 'if it looks like a duck...
> >it's probably a duck'.
>
>
> BZZT! In fact, you were responding to my post, which was a response
> to your post, which was ultimately a response to Robert Camp's post,
> which was a response to Kalky's post. It was Kalky's post which was a
> response to Harshman's post, neither of which had anything to do with
> what Dawkins claims.
>
> Neither Harshman's point, nor Kalky's point, is the same as your point
> here, whatever your actual point is.

No, Trollery, I wasn't responding to you. I was happily ignoring you.
It was John who used the Duck analogy on this thread.

> >The same applies to the appearance of purposeful design by an intelligent agent.
>
>
> BZZT! Apparently Harshman disagrees with Dawkins, that life appears
> designed. And since Harshman didn't claim that life appears designed,
> whether by an intelligent agent or not, the same can't apply here.

You're not funny. Go back under your bridge and get back on your meds.

[Steady Eddie]

LOL!
Okay, Trollery, I've had my fun reading your posts.
Time to ignore you awhile while I talk to the adults.
Trot along now.

[Steady Eddie]

The point is, without any way of knowing whether any of those fossilized Species materialized into each
other, all you have is a suggestion.
Is that any way to show the most compelling reasons for accepting Darwinism?

[John Harshman]

That was nothing more than repeating what I said back to me.
Kindergarten argument.

>> Some of the horses probably are ancestral to others.
>
> Yes, "probably".
> Close enough for the rubes Mo thinks he is talking to...
> LOL!

Again, you accuse him of deliberate deception. Do you really intend to
do that?

>> We just can't tell
>> which. What we can tell is that they all relate in a tree structure and
>> that the most primitive features appear earlier in time than the more
>> derived ones. And that tells us we're talking about common descent.
>
> It actually tells us nothing of the sort. The evidence that more 'basic' forms appear earlier than 'modern'
> forms is simply a tautology used to infer common descent.

No, there is no tautology. The technical term is "stratigraphic fit",
and there's no a priori reason why there should be a good fit.

> There is no reason why the Creator wouldn't have chosen to proceed from more apparently 'primitive' life
> forms to 'modern' life. In fact, it was probably necessary for 'primitive' life, especially microscopic, to
> prepare the earth for more 'modern' species, including humans.

I agree that a little bit of fit is required: if things start out very
simple, then anything more complex must happen later. But we're talking
about horses. The earliest horses are not more or less complex than the
latest horses, just different. And none of them was required to prepare
the earth for later horses or for humans. 5 toes precede 4 toes, which
precede 3 toes, which precede 1 toe. If they were all created
separately, this progression makes no sense.

>> It
>> doesn't matter for that purpose if we have parents or uncles or cousins.
>> So yes, the horse tree is great evidence for evolution way past the
>> species level, and that's why Mo included it.
>
> You and Mo really must rely on the public's lack of imagination to believe that this horse 'tree' points only
> to your cherished theory.
> LOL!

Just so you know, "LOL" makes you look like you will do anything to
avoid thinking.

[John Harshman]

That's just you not understanding science again. Inference from data is
indeed a way of knowing, not just a suggestion. There is nothing that
makes sense of the succession of horse species other than common
descent. Your preferred notion of separate creation, on the other hand,
explains none of the pattern.

[jillery]

On Sat, 7 May 2016 17:42:10 -0700 (PDT), Steady Eddie
<1914o...@gmail.com> wrote:

<mercy snip>

>LOL!
>Okay, Trollery, I've had my fun reading your posts.
>Time to ignore you awhile while I talk to the adults.
>Trot along now.

As if that make any functional difference to your replies. More to
the point, my replies are substantially similar to other posters who
reply to you. Why don't you try posting some sense, if only as a
refreshing change of pace?

[jillery]

On Sat, 7 May 2016 17:34:28 -0700 (PDT), Steady Eddie

Then you tacitly admit that your distinction above is simply
meaningless noise. Is anybody surprised?

>I, DEFINITELY, did NOT claim that Dawkins believes life is designed by an intelligent designer.
>I just claim that he admits that IT LOOKS LIKE life was DESIGNED BY AN INTELLIGENT DESIGNER,
>hence the term "PURPOSEFULLY", which can not be affected without an intelligent agent.

And your claim is completely misleading, which makes it a quote mine.
Since you don't believe me, look it up for yourself.

Dawkins does not think life is designed by an intelligent agent,
purposefully or otherwise. His point in that quote is to make a
distinction between the way thing look and the way things are. It
really isn't that hard to understand.

>So your allegation of quote-mining is fallacious.

Nope, the veracity of my allegation remains intact.

>In fact, I've rarely seen you without your head up your ass.

That's only because you're always looking in a mirror.

>What's your problem with comprehension as soon as I make a point you find uncomfortable?

The problem with comprehension here is entirely yours.

>> >If you were reading this thread, you'd know that I was responding to JH's claim that 'if it looks like a duck...
>> >it's probably a duck'.
>>
>>
>> BZZT! In fact, you were responding to my post, which was a response
>> to your post, which was ultimately a response to Robert Camp's post,
>> which was a response to Kalky's post. It was Kalky's post which was a
>> response to Harshman's post, neither of which had anything to do with
>> what Dawkins claims.
>>
>> Neither Harshman's point, nor Kalky's point, is the same as your point
>> here, whatever your actual point is.
>
>No, Trollery, I wasn't responding to you. I was happily ignoring you.

But you did reply to me, and more than once. Why do you post such
obvious lies?

>It was John who used the Duck analogy on this thread.

Irrelevant. It was Kalky who mis-used the Duck analogy in this
thread. The relevant point here is you didn't reply to John
Harshman's comment. And by the time you did reply to anybody, the
subject had shifted to what Dawkins said. Which you would know if you
had bothered to keep up.

>> >The same applies to the appearance of purposeful design by an intelligent agent.
>>
>>
>> BZZT! Apparently Harshman disagrees with Dawkins, that life appears
>> designed. And since Harshman didn't claim that life appears designed,
>> whether by an intelligent agent or not, the same can't apply here.
>
>You're not funny. Go back under your bridge and get back on your meds.

I'm not trying to be funny. I made a clear and sincere point which
directly refutes your claim. Calling me names doesn't change the
veracity of my refutation. Instead, try posting a coherent and cogent
reply, if only as a refreshing change of pace.

>> >Try to keep up,people.
>>
>>
>> You first.

The above needs repeating.

[Steady Eddie]

And that's exactly what you needed.

> Kindergarten argument.

Yes, it was. That is why It needs such a reply.

> >> Some of the horses probably are ancestral to others.
> >
> > Yes, "probably".
> > Close enough for the rubes Mo thinks he is talking to...
> > LOL!
>
> Again, you accuse him of deliberate deception. Do you really intend to
> do that?

I don't know Mo's degree of understanding the deceptive nature of the arguments he parrots.
Is the deceived guilty of deceiving?
And is Mo himself deceived?
I don't know.
I just know that his arguments thus far, largely a parroting of Jerry Coyne, are blatantly deceptive in the
context of an introductory "course" on evolution.

> >> We just can't tell
> >> which. What we can tell is that they all relate in a tree structure and
> >> that the most primitive features appear earlier in time than the more
> >> derived ones. And that tells us we're talking about common descent.
> >
> > It actually tells us nothing of the sort. The evidence that more 'basic' forms appear earlier than 'modern'
> > forms is simply a tautology used to infer common descent.
>
> No, there is no tautology. The technical term is "stratigraphic fit",
> and there's no a priori reason why there should be a good fit.

There's no a priori reason to believe one form changed into another.
And your (Darwinists') coining of the term "stratigraphic fit" is more rhetoric masquerading as science-
speak.

> > There is no reason why the Creator wouldn't have chosen to proceed from more apparently 'primitive' life
> > forms to 'modern' life. In fact, it was probably necessary for 'primitive' life, especially microscopic, to
> > prepare the earth for more 'modern' species, including humans.
>
> I agree that a little bit of fit is required: if things start out very
> simple, then anything more complex must happen later. But we're talking
> about horses. The earliest horses are not more or less complex than the
> latest horses, just different. And none of them was required to prepare
> the earth for later horses or for humans. 5 toes precede 4 toes, which
> precede 3 toes, which precede 1 toe. If they were all created
> separately, this progression makes no sense.

5 toed, 4 toed, 3 toed, and 1 toed creatures were created.
INCONCEIVABLE!

> >> It
> >> doesn't matter for that purpose if we have parents or uncles or cousins.
> >> So yes, the horse tree is great evidence for evolution way past the
> >> species level, and that's why Mo included it.
> >
> > You and Mo really must rely on the public's lack of imagination to believe that this horse 'tree' points only
> > to your cherished theory.
> > LOL!
>
> Just so you know, "LOL" makes you look like you will do anything to
> avoid thinking.

"LOL" shows that I used to be disgusted, now I'm just amused.

[John Harshman]

I know you are but what am I?

>>>> Some of the horses probably are ancestral to others.
>>>
>>> Yes, "probably".
>>> Close enough for the rubes Mo thinks he is talking to...
>>> LOL!
>>
>> Again, you accuse him of deliberate deception. Do you really intend to
>> do that?
>
> I don't know Mo's degree of understanding the deceptive nature of the arguments he parrots.
> Is the deceived guilty of deceiving?
> And is Mo himself deceived?
> I don't know.
> I just know that his arguments thus far, largely a parroting of Jerry Coyne, are blatantly deceptive in the
> context of an introductory "course" on evolution.

So you aren't sure he's lying; he could just be a moron. Great.

>>>> We just can't tell
>>>> which. What we can tell is that they all relate in a tree structure and
>>>> that the most primitive features appear earlier in time than the more
>>>> derived ones. And that tells us we're talking about common descent.
>>>
>>> It actually tells us nothing of the sort. The evidence that more 'basic' forms appear earlier than 'modern'
>>> forms is simply a tautology used to infer common descent.
>>
>> No, there is no tautology. The technical term is "stratigraphic fit",
>> and there's no a priori reason why there should be a good fit.
>
> There's no a priori reason to believe one form changed into another.
> And your (Darwinists') coining of the term "stratigraphic fit" is more rhetoric masquerading as science-
> speak.

Pride in ignorance is not a virtue.

>>> There is no reason why the Creator wouldn't have chosen to proceed from more apparently 'primitive' life
>>> forms to 'modern' life. In fact, it was probably necessary for 'primitive' life, especially microscopic, to
>>> prepare the earth for more 'modern' species, including humans.
>>
>> I agree that a little bit of fit is required: if things start out very
>> simple, then anything more complex must happen later. But we're talking
>> about horses. The earliest horses are not more or less complex than the
>> latest horses, just different. And none of them was required to prepare
>> the earth for later horses or for humans. 5 toes precede 4 toes, which
>> precede 3 toes, which precede 1 toe. If they were all created
>> separately, this progression makes no sense.
>
> 5 toed, 4 toed, 3 toed, and 1 toed creatures were created.
> INCONCEIVABLE!

I suspect you don't think that word means what you say it means. Sure
it's conceivable. But does it make sense? Why that order instead of 3,
4, 1, 5?

>>>> It
>>>> doesn't matter for that purpose if we have parents or uncles or cousins.
>>>> So yes, the horse tree is great evidence for evolution way past the
>>>> species level, and that's why Mo included it.
>>>
>>> You and Mo really must rely on the public's lack of imagination to believe that this horse 'tree' points only
>>> to your cherished theory.
>>> LOL!
>>
>> Just so you know, "LOL" makes you look like you will do anything to
>> avoid thinking.
>
> "LOL" shows that I used to be disgusted, now I'm just amused.

The term "jackass" comes to mind. It's still a substitute for thinking
or making a real argument.

[christi...@brown.edu]

" already QUOTED what Mo said.

So, then, what's the story behind how a "possible" horse lineage got accepted as 'real' evidence for anything, and for generations?
And, especially, how it got included as evidence of a horse's ancestry in a 2016 course by an expert in the
field? "

Mohammed Noor is not an expert in horse paleontology and evolution. But I am. So why don't you direct your questions to me?

[jillery]

On Sat, 7 May 2016 20:03:22 -0700 (PDT), christi...@brown.edu
wrote:

Have fun, but don't expect to get through to Steadly. His mind is
alreadly made up, don't confuse him with facts.

[Steady Eddie]

What pattern?
You think finding fossils of different animals with different forms somehow shows that they turned into each other.
That's magical thinking - you just not understanding science again.

[Burkhard]

no, not really. More: collect ALL the features you can find. Form an
explanation that explains them all. Compare to see if another
explanation covers as many or more. If yes, test them against each other
by asking what else we should observe if either is better at matching
this new data.

> The kind I was sternly criticized for using WRT the appearance of design in life?

No. First for the reasons stated above. Second because that "theory"
when offered oscillated between being vacuous and hence not explaining
anything at all, or simply failing to explain data that the alternative
has no problems with

[Burkhard]

If it walks like a duck , quacks like a duck - but on closer inspection
it turns out it's 20 times as heavy as a duck, sticks to magnets and in
the rain first fizzles, sparks and then explodes, it probably wasn't a
duck and only appeared to be one t the untutored eye.

[Steady Eddie]

One or the other, yes.

> >>>> We just can't tell
> >>>> which. What we can tell is that they all relate in a tree structure and
> >>>> that the most primitive features appear earlier in time than the more
> >>>> derived ones. And that tells us we're talking about common descent.
> >>>
> >>> It actually tells us nothing of the sort. The evidence that more 'basic' forms appear earlier than 'modern'
> >>> forms is simply a tautology used to infer common descent.
> >>
> >> No, there is no tautology. The technical term is "stratigraphic fit",
> >> and there's no a priori reason why there should be a good fit.
> >
> > There's no a priori reason to believe one form changed into another.
> > And your (Darwinists') coining of the term "stratigraphic fit" is more rhetoric masquerading as science-
> > speak.
>
> Pride in ignorance is not a virtue.

Nor is pride in falsely-called 'knowledge'.

> >>> There is no reason why the Creator wouldn't have chosen to proceed from more apparently 'primitive' life
> >>> forms to 'modern' life. In fact, it was probably necessary for 'primitive' life, especially microscopic, to
> >>> prepare the earth for more 'modern' species, including humans.
> >>
> >> I agree that a little bit of fit is required: if things start out very
> >> simple, then anything more complex must happen later. But we're talking
> >> about horses. The earliest horses are not more or less complex than the
> >> latest horses, just different. And none of them was required to prepare
> >> the earth for later horses or for humans. 5 toes precede 4 toes, which
> >> precede 3 toes, which precede 1 toe. If they were all created
> >> separately, this progression makes no sense.
> >
> > 5 toed, 4 toed, 3 toed, and 1 toed creatures were created.
> > INCONCEIVABLE!
>
> I suspect you don't think that word means what you say it means.

You suspect wrong.

Sure
> it's conceivable. But does it make sense? Why that order instead of 3,
> 4, 1, 5?

Oh, yes, such COMPELLING EVIDENCE!
You need to step back and take a look at the situation with a little common sense.

You decline to admit that the irreducibly complex, precision-fitted, integrated nature of living structures
and functions forms a "pattern" that needs explanation, while you uncritically accept that the number of
toes of land-dwelling creatures is SO COMPELLING A PATTERN that it proves that they turned into each
other - no other explanation "makes sense"!
LOL!
You have been trained to pick and choose what "patterns" you will consider compelling evidence.
Your opinion is worthless.

> >>>> It
> >>>> doesn't matter for that purpose if we have parents or uncles or cousins.
> >>>> So yes, the horse tree is great evidence for evolution way past the
> >>>> species level, and that's why Mo included it.
> >>>
> >>> You and Mo really must rely on the public's lack of imagination to believe that this horse 'tree' points only
> >>> to your cherished theory.
> >>> LOL!
> >>
> >> Just so you know, "LOL" makes you look like you will do anything to
> >> avoid thinking.
> >
> > "LOL" shows that I used to be disgusted, now I'm just amused.
>
> The term "jackass" comes to mind. It's still a substitute for thinking
> or making a real argument.

Don't like being laughed at? Try learning what scientific investigation is all about.

[Steady Eddie]

In your expert opinion, of course.

[Steady Eddie]

Agreed.
So what's your point?
It was exactly on "closer inspection" that we found the dazzling integrated complexity of life on the
molecular level, something that was unknown when the theory of evolution was first accepted by the
"untutored eye" of mainstream scientists.
Now this theory is decades overdue for reconsideration.
Darwinists are stuck in Victorian-age science.

[Burkhard]

My point is that once you stop thinking like a primitive tool maker for
whom everything is a hammer (or a club) nature looks less and less designed.

> It was exactly on "closer inspection" that we found the dazzling integrated complexity of life on the
> molecular level, something that was unknown when the theory of evolution was first accepted by the
> "untutored eye" of mainstream scientists.

And sort of provided massive independent confirmation for the ToE
precisely because of this - gave it the mechanism for change (we now
know about the inherent instability of some of these structures) and
also all the anomalies that a random walk gets you, but not a planned
design process (e.g. the onion paradox)

[jillery]

BZZT! The evidence is not "finding different animals with different
forms". Instead, the evidence is finding different animals with
similar forms, but varying in specific features over time and place.

A creative Designer could cause that kind of pattern, but it could
also cause any kind of pattern, and so that hypothesis doesn't explain
anything. OTOH that's exactly the kind of pattern Evolution causes.
It's really not that hard to understand.

[jillery]

BZZT! Of course the pattern needs explanation. Evolution provides
it. OTOH your idea of a creative Deity >poofing< species into
existence on a whim doesn't explain anything.

>LOL!
>You have been trained to pick and choose what "patterns" you will consider compelling evidence.
>Your opinion is worthless.
>
>> >>>> It
>> >>>> doesn't matter for that purpose if we have parents or uncles or cousins.
>> >>>> So yes, the horse tree is great evidence for evolution way past the
>> >>>> species level, and that's why Mo included it.
>> >>>
>> >>> You and Mo really must rely on the public's lack of imagination to believe that this horse 'tree' points only
>> >>> to your cherished theory.
>> >>> LOL!
>> >>
>> >> Just so you know, "LOL" makes you look like you will do anything to
>> >> avoid thinking.
>> >
>> > "LOL" shows that I used to be disgusted, now I'm just amused.
>>
>> The term "jackass" comes to mind. It's still a substitute for thinking
>> or making a real argument.
>
>Don't like being laughed at? Try learning what scientific investigation is all about.

Every time you post the above kind of hubris, you show that you have
no idea what you're talking about.

[John Harshman]

Not familiar with The Princess Bride, then?

> Sure
>> it's conceivable. But does it make sense? Why that order instead of 3,
>> 4, 1, 5?
>
> Oh, yes, such COMPELLING EVIDENCE!
> You need to step back and take a look at the situation with a little common sense.
>
> You decline to admit that the irreducibly complex, precision-fitted, integrated nature of living structures
> and functions forms a "pattern" that needs explanation, while you uncritically accept that the number of
> toes of land-dwelling creatures is SO COMPELLING A PATTERN that it proves that they turned into each
> other - no other explanation "makes sense"!
> LOL!

Another compelling argument. You understand that it isn't just the toes,
right? It's a host of other features of the horses, and in fact of the
entire fossil record. Why does the fossil record have such a good fit to
the phylogenetic tree derived from other data? I know your answer:
"LOL". Well, that showed me.

> You have been trained to pick and choose what "patterns" you will consider compelling evidence.
> Your opinion is worthless.

So it isn't just Mo who's either a liar or a moron; it's all scientists,
without exception. Right?

>>>>>> It
>>>>>> doesn't matter for that purpose if we have parents or uncles or cousins.
>>>>>> So yes, the horse tree is great evidence for evolution way past the
>>>>>> species level, and that's why Mo included it.
>>>>>
>>>>> You and Mo really must rely on the public's lack of imagination to believe that this horse 'tree' points only
>>>>> to your cherished theory.
>>>>> LOL!
>>>>
>>>> Just so you know, "LOL" makes you look like you will do anything to
>>>> avoid thinking.
>>>
>>> "LOL" shows that I used to be disgusted, now I'm just amused.
>>
>> The term "jackass" comes to mind. It's still a substitute for thinking
>> or making a real argument.
>
> Don't like being laughed at? Try learning what scientific investigation is all about.
>

Hey, who's the scientist here? Of course all scientists are liars and/or
morons, so I suppose being a scientist isn't such a good thing.

Still, I actually make arguments, while all you do is say "LOL".

[John Harshman]

That you ask what we're talking about at this late date tells me you
haven't been paying attention.

> You think finding fossils of different animals with different forms somehow shows that they turned into each other.
> That's magical thinking - you just not understanding science again.
>

So why are all Eocene horses small and many-toed, with low-crowned
teeth, but all modern horses are large and one-toed with high-crowned
teeth? Do you have an explanation other than "that's what god felt like
at the time"?

For that matter, do you even think there was such a thing as the Eocene,
or do you think all the fossils derive from a worldwide flood?

[Bob Casanova]

On Sat, 7 May 2016 20:03:22 -0700 (PDT), the following
appeared in talk.origins, posted by
christi...@brown.edu:

If you think Eddie will accept anyone as an expert who
doesn't agree with him I have a bridge you might be
interested in purchasing.
--

Bob C.

"The most exciting phrase to hear in science,
the one that heralds new discoveries, is not
'Eureka!' but 'That's funny...'"

- Isaac Asimov

[Steady Eddie]

Your point is equally applicable to yourself.
You have demonstrated yourself capable of some self-criticism, I encourage you to apply it here too and
consider whether you may be the 'primitive tool maker' in this exchange.

> > It was exactly on "closer inspection" that we found the dazzling integrated complexity of life on the
> > molecular level, something that was unknown when the theory of evolution was first accepted by the
> > "untutored eye" of mainstream scientists.
>
> And sort of provided massive independent confirmation for the ToE
> precisely because of this - gave it the mechanism for change (we now
> know about the inherent instability of some of these structures) and
> also all the anomalies that a random walk gets you, but not a planned
> design process (e.g. the onion paradox)

You show your confirmation bias and simple-minded acceptance of everything Darwinian, again.
Who's thinking like a 'primitive tool maker', here?

Darwinists, for three quarters of a century, have managed to ignore the combinatorial problem first
posed by Crick upon discovery of the chemical structure of DNA, then re-iterated by the best engineers
and mathematicians of the day at Wistar.

At some point, you have to FACE THE MATH to be considered a serious science. Ignoring the simple math
that is needed to support your bias elicited "HOOTING" from the serious scientists at Wistar. In fact, while
Darwinists are content to point to IMAGINARY HORSE LINEAGES, real scientists have demonstrated that it
is statistically impossible for even ONE NEW FUNCTIONAL PROTEIN FOLD to be randomly generated
at the time and place it is needed.

And that's just the combinatorial problem of DNA and protein sequences.

Then there's the irreducible complexity of virtually every system, machine, and process in a typical cell.
Darwinists have come up with zero empirical evidence for how ANY of these things could feasibly come
about by chance. Only Op-Eds slipped into actual scientific papers, with titles that pretend that the
problems 'are well in hand'.

Then there's the discovery of the self-healing, self-correcting mechanisms that repair, or 'work around'
many potentially destructive errors in replication, keeping the systems and structures in the cell stable.

And that's just the tip of the iceberg.
The discovery of epigenetic influences that somehow work hand-in-hand with the genome to fine-tune
Species for survival by adaptation simply cannot be explained scientifically by Darwinism. Op-Eds
and rhetoric are blithely thrown at this phenomenon, with full certainty that any Darwinian explanation
will be accepted by the public as correct.

Put simply, the facts have passed you by, leaving you, in a 2016 'course' on evolution, telling stories of
imaginary horse "ancestors", 'asphalt-phobic' squirrels, and hubristic declarations that whales 'must have'
evolved from land animals based on a comically simple conception of what it would take.

Your only supporting arguments are just-so stories based on confirmation bias - it helps to "believe in"
Atheism a priori, in order to accept them as anything but an intellectual insult to the student.

The Zeitgeist of the last century or so is pressuring people to adopt Atheism, for reasons having nothing
to do with science. Darwinist 'science' is simply a stooge of Atheism, as evidenced by the ridiculous
mental convolutions made by otherwise competent academics to promote it, and avoid facing the math.

[Vincent Maycock]

On Sun, 8 May 2016 12:02:11 -0700 (PDT), Steady Eddie
<1914o...@gmail.com> wrote:

snip

>Darwinists, for three quarters of a century, have managed to ignore the combinatorial problem first
>posed by Crick upon discovery of the chemical structure of DNA, then re-iterated by the best engineers
>and mathematicians of the day at Wistar.
>
>At some point, you have to FACE THE MATH to be considered a serious science. Ignoring the simple math

If it's simple, why don't you post it here? I mean the math itself,
not "what other people claim math indicates."

>that is needed to support your bias elicited "HOOTING" from the serious scientists at Wistar.

A lot has changed since the 1960s, Eddie. And wasn't it the
"mathematicians and engineers," not the serious scientists, who were
doing the "hooting"?

> In fact, while
>Darwinists are content to point to IMAGINARY HORSE LINEAGES,

No, the lineages are real; there's just more branching involved than
we used to think.

> real scientists have demonstrated that it
>is statistically impossible for even ONE NEW FUNCTIONAL PROTEIN FOLD to be randomly generated
>at the time and place it is needed.

New proteins are involved in at least some forms of newly evolved
antibacterial resistance.

>And that's just the combinatorial problem of DNA and protein sequences.

I think natural selection needs to be involved, here, rather than just
"randomly generated" sequences.

>Then there's the irreducible complexity of virtually every system, machine, and process in a typical cell.

And evolution can easily create irreducible complexity. Also, I doubt
irreducible complexity is as widespread as you seem to think.

>Darwinists have come up with zero empirical evidence for how ANY of these things could feasibly come
>about by chance.

And natural selection; adding that to the mix changes a lot.

>Only Op-Eds slipped into actual scientific papers, with titles that pretend that the
>problems 'are well in hand'.
>
>Then there's the discovery of the self-healing, self-correcting mechanisms that repair, or 'work around'
>many potentially destructive errors in replication, keeping the systems and structures in the cell stable.

Which may not have been necessary in a less sophisticated version of
the system.

>And that's just the tip of the iceberg.
>The discovery of epigenetic influences that somehow work hand-in-hand with the genome to fine-tune
>Species for survival by adaptation simply cannot be explained scientifically by Darwinism.

No, epigenetic influences can be explained by evolution.

> Op-Eds
>and rhetoric are blithely thrown at this phenomenon, with full certainty that any Darwinian explanation
>will be accepted by the public as correct.
>
>Put simply, the facts have passed you by, leaving you, in a 2016 'course' on evolution, telling stories of
>imaginary horse "ancestors", 'asphalt-phobic' squirrels, and hubristic declarations that whales 'must have'
>evolved from land animals

The fossil record shows whales evolving from land animals in detail.

[Steady Eddie]

Vincent:
Thank you for your above reply to my post.

RE the "simple math" you ask about: it has been posted many times.
A handy example is Stephen Meyer's recent article entitled:
"Dawkins's Dilemma: Misrepresent the Mechanism, or Face the Math" where he writes:

"Why a formidable challenge? Because RANDOM MUTATIONS ALONE must produce (or "search for")
exceedingly rare functional sequences among a vast combinatorial sea of possible sequences before
natural selection can play any significant role.
Moreover, as I discussed in Toronto, and show in more detail in Darwin's Doubt,6 every replication event in
the entire multi-billion year history of life on Earth would not generate or "search" but a miniscule fraction
(ONE TEN TRILLION, TRILLION TRILLIONTH, TO BE EXACT) of the total number of possible nucleotide
base or amino-acid sequences corresponding to a SINGLE FUNCTIONAL GENE OR PROTEIN FOLD. THE
NUMBER OF TRIALS AVAILABLE to the evolutionary process (corresponding to the total number of
organisms -- 10^40 -- that have ever existed on earth), thus, turns out to be INCREDIBLY SMALL in
relation to the number of possible sequences that need to be searched. The threshold of selectable
function EXCEEDS WHAT IS REASONABLE TO EXPECT A RANDOM SEARCH TO BE ABLE TO ACCOMPLISH
given the number of trials available to the search EVEN ASSUMING EVOLUTIONARY DEEP TIME."
http://www.evolutionnews.org/2016/03/about_a_bike_lo102722.html

And, if you expect me to reply to your posts, please do not delete any of my previous post.
That is a cowardly way to "erase" points that you do not wish to respond to.
I accord this respect to others, and demand it for myself.

[Steady Eddie]

It doesn't. You're bluffing about that.
You just don't want to disclose the degree of chaos encountered when Darwinists closely study said
phylogenetic trees using "other data".
One thing we can be sure of: the latest version of the "tree", or "bush", as many scientists now characterize it, is always the "true" version.
Until it's replaced by the "really true" version.
LOL!

I know your answer:
> "LOL". Well, that showed me.

> > You have been trained to pick and choose what "patterns" you will consider compelling evidence.
> > Your opinion is worthless.
>
> So it isn't just Mo who's either a liar or a moron; it's all scientists,
> without exception. Right?

Scientists typically are NOT liars or morons like you.
But Darwinists are.

> >>>>>> It
> >>>>>> doesn't matter for that purpose if we have parents or uncles or cousins.
> >>>>>> So yes, the horse tree is great evidence for evolution way past the
> >>>>>> species level, and that's why Mo included it.
> >>>>>
> >>>>> You and Mo really must rely on the public's lack of imagination to believe that this horse 'tree' points only
> >>>>> to your cherished theory.
> >>>>> LOL!
> >>>>
> >>>> Just so you know, "LOL" makes you look like you will do anything to
> >>>> avoid thinking.
> >>>
> >>> "LOL" shows that I used to be disgusted, now I'm just amused.
> >>
> >> The term "jackass" comes to mind. It's still a substitute for thinking
> >> or making a real argument.
> >
> > Don't like being laughed at? Try learning what scientific investigation is all about.
> >
> Hey, who's the scientist here? Of course all scientists are liars and/or
> morons, so I suppose being a scientist isn't such a good thing.

Wrong again.
Scientists are typically dispassionate investigators.
It's Darwinists who are liars and/or morons.

> Still, I actually make arguments, while all you do is say "LOL".

Bullshit.
I argue against your pompous scientific pretensions, AND laugh at them.
The two aren't mutually exclusive.
LOL! You didn't know that?

[Steady Eddie]

I know exactly what you're talking about.
You and your kind are trying to use your PhDs to bully people into thinking and believing there is some
"pattern" that compellingly demonstrates that one life form turned into another, while having the hubris
to unaccountably ignore the "patterns" that point unmistakably to a creator of life.

That's why you deserve all the derision that can be heaped on you, and much more.

> > You think finding fossils of different animals with different forms somehow shows that they turned into each other.
> > That's magical thinking - you just not understanding science again.
> >
> So why are all Eocene horses small and many-toed, with low-crowned
> teeth, but all modern horses are large and one-toed with high-crowned
> teeth? Do you have an explanation other than "that's what god felt like
> at the time"?

What Eocene "horses"?
You don't get to decide for us what are "horses" and what aren't.
It doesn't come with the PhD, you know.

> For that matter, do you even think there was such a thing as the Eocene,
> or do you think all the fossils derive from a worldwide flood?

I wouldn't be surprised if you were dead wrong about both, but I don't know, so I don't make an issue of it.
Why are you trying to bait me on the issue now?

[Vincent Maycock]

And here is that post again, since it somehow disappeared from your
reply.

<RE-POST>
snip

>Darwinists, for three quarters of a century, have managed to ignore the combinatorial problem first
>posed by Crick upon discovery of the chemical structure of DNA, then re-iterated by the best engineers
>and mathematicians of the day at Wistar.
>
>At some point, you have to FACE THE MATH to be considered a serious science. Ignoring the simple math

If it's simple, why don't you post it here? I mean the math itself,
not "what other people claim math indicates."

>that is needed to support your bias elicited "HOOTING" from the serious scientists at Wistar.

A lot has changed since the 1960s, Eddie. And wasn't it the
"mathematicians and engineers," not the serious scientists, who were
doing the "hooting"?

> In fact, while
>Darwinists are content to point to IMAGINARY HORSE LINEAGES,

No, the lineages are real; there's just more branching involved than
we used to think.

> real scientists have demonstrated that it
>is statistically impossible for even ONE NEW FUNCTIONAL PROTEIN FOLD to be randomly generated
>at the time and place it is needed.

New proteins are involved in at least some forms of newly evolved
antibacterial resistance.

>And that's just the combinatorial problem of DNA and protein sequences.

I think natural selection needs to be involved, here, rather than just

"randomly generated" sequences.

>Then there's the irreducible complexity of virtually every system, machine, and process in a typical cell.

And evolution can easily create irreducible complexity. Also, I doubt
irreducible complexity is as widespread as you seem to think.

>Darwinists have come up with zero empirical evidence for how ANY of these things could feasibly come
>about by chance.

And natural selection; adding that to the mix changes a lot.

>Only Op-Eds slipped into actual scientific papers, with titles that pretend that the
>problems 'are well in hand'.
>
>Then there's the discovery of the self-healing, self-correcting mechanisms that repair, or 'work around'
>many potentially destructive errors in replication, keeping the systems and structures in the cell stable.

Which may not have been necessary in a less sophisticated version of
the system.

>And that's just the tip of the iceberg.
>The discovery of epigenetic influences that somehow work hand-in-hand with the genome to fine-tune
>Species for survival by adaptation simply cannot be explained scientifically by Darwinism.

No, epigenetic influences can be explained by evolution.

> Op-Eds
>and rhetoric are blithely thrown at this phenomenon, with full certainty that any Darwinian explanation
>will be accepted by the public as correct.
>
>Put simply, the facts have passed you by, leaving you, in a 2016 'course' on evolution, telling stories of
>imaginary horse "ancestors", 'asphalt-phobic' squirrels, and hubristic declarations that whales 'must have'
>evolved from land animals

The fossil record shows whales evolving from land animals in detail.

</RE-POST>

>RE the "simple math" you ask about: it has been posted many times.
>
>A handy example is Stephen Meyer's recent article entitled:
>"Dawkins's Dilemma: Misrepresent the Mechanism, or Face the Math" where he writes:
>
>"Why a formidable challenge? Because RANDOM MUTATIONS ALONE must produce (or "search for")
>exceedingly rare functional sequences among a vast combinatorial sea of possible sequences before
>natural selection can play any significant role.
>Moreover, as I discussed in Toronto, and show in more detail in Darwin's Doubt,6 every replication event in
>the entire multi-billion year history of life on Earth would not generate or "search" but a miniscule fraction
>(ONE TEN TRILLION, TRILLION TRILLIONTH, TO BE EXACT) of the total number of possible nucleotide
>base or amino-acid sequences corresponding to a SINGLE FUNCTIONAL GENE OR PROTEIN FOLD. THE
>NUMBER OF TRIALS AVAILABLE to the evolutionary process (corresponding to the total number of
>organisms -- 10^40 -- that have ever existed on earth), thus, turns out to be INCREDIBLY SMALL in
>relation to the number of possible sequences that need to be searched.

Now that you're being more specific, I remember this claim; an
evolutionist said he was talking with a creationist making a claim
like this, and I helped the evolutionist out by giving him my opinion.
The answer to your question is that evolution doesn't have to search
the entire search space because it constructs the search space around
it as it goes along.

There are so many sequences that are just pure nonsense, in biological
terms (i.e., in terms of what would make a viable protein), that
mutations never have to sample that part of the search space in order
to make proteins.

For example, we're never going to see the protein-coding DNA sequence

AAAAAAAAAAAAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTTTTTTTTTTT

or

ATATATATATATATATATATATATATA

or

AAAAGGGGCCCCTTTTAAAAGGGGGCCCCTTTTAAAAGGGG

or

AAAAAAAAAAAAAAAAAAAAAAAAATTTTTTTTTTTTATTTTTTTTTTTTTTTT

or even

AGCTAGCTAGCTAGCTAGCTAGCT

because these potential sequences were eliminated from the beginning,
(when genome sequences were small), since they bear no resemblance to
anything with a biological function.

So the search space is much smaller than calculated by design
proponents, because evolution never has search through these nonsense
strings when constructing a new protein.

[jillery]

Right here would have been a good place for you to identify those
patterns you think point unmistakably to a creator of life. Failing
that, you're still blowing smoke out of your ass.

>That's why you deserve all the derision that can be heaped on you, and much more.
>
>> > You think finding fossils of different animals with different forms somehow shows that they turned into each other.
>> > That's magical thinking - you just not understanding science again.
>> >
>> So why are all Eocene horses small and many-toed, with low-crowned
>> teeth, but all modern horses are large and one-toed with high-crowned
>> teeth? Do you have an explanation other than "that's what god felt like
>> at the time"?
>
>What Eocene "horses"?
>You don't get to decide for us what are "horses" and what aren't.
>It doesn't come with the PhD, you know.
>
>> For that matter, do you even think there was such a thing as the Eocene,
>> or do you think all the fossils derive from a worldwide flood?
>
>I wouldn't be surprised if you were dead wrong about both, but I don't know,

So you explicitly admit that you don't know what you think. Is
anybody surprised?

>so I don't make an issue of it.
>Why are you trying to bait me on the issue now?

Whatever Harshman's motives, the veracity of the Eocene is relevant.
Why won't you answer the question?

[jillery]

Actually, leaving in all of your noise is a terrible way to focus on
any particular point, but a great way to document your obfuscating
noise, which is exactly what I just did.

And if you want Maycock to reply to your posts, it would help if you
actually replied to his post instead of one of your own.

You would be funny if you weren't so pathetic.

[jillery]

On Sun, 8 May 2016 22:04:40 -0700 (PDT), Steady Eddie
<1914o...@gmail.com> wrote:


<snip for focus>

>> > You have been trained to pick and choose what "patterns" you will consider compelling evidence.
>> > Your opinion is worthless.
>>
>> So it isn't just Mo who's either a liar or a moron; it's all scientists,
>> without exception. Right?
>
>Scientists typically are NOT liars or morons like you.
>But Darwinists are.

Right here would have been a good place for you to say what you think
is the difference between Scientists and Darwinists. Hopefully, it's
something other than the former agree with you and the latter don't.
Just sayin'.

[John Harshman]

First off, you have no idea how "many scientists now characterize it",
never having read any of the scientific literature, ever in your life.
Second, you have no idea what degree of chaos is encountered, for the
same reason. Third, the horse tree has changed only in minor details
during the last century or so.

Let me make the point again: horse phylogeny is determined by methods
that do not take stratigraphic position into account, and yet we still
find that the earlier a character appears on the tree, the earlier it
appears in the fossil record. How do you explain that?

> LOL!
>
> I know your answer:
>> "LOL". Well, that showed me.

You have to agree that "LOL" serves no purpose other than to annoy.

>>> You have been trained to pick and choose what "patterns" you will consider compelling evidence.
>>> Your opinion is worthless.
>>
>> So it isn't just Mo who's either a liar or a moron; it's all scientists,
>> without exception. Right?
>
> Scientists typically are NOT liars or morons like you.
> But Darwinists are.

So is it all evolutionary biologists, without exeption, who are liars
and/or morons? But wait, don't you also have to include geologists in
that? And what about those silly astronomers who keep insisting on a
universe that's billions of years old despite all the evidence to the
contrary?

>>>>>>>> It
>>>>>>>> doesn't matter for that purpose if we have parents or uncles or cousins.
>>>>>>>> So yes, the horse tree is great evidence for evolution way past the
>>>>>>>> species level, and that's why Mo included it.
>>>>>>>
>>>>>>> You and Mo really must rely on the public's lack of imagination to believe that this horse 'tree' points only
>>>>>>> to your cherished theory.
>>>>>>> LOL!
>>>>>>
>>>>>> Just so you know, "LOL" makes you look like you will do anything to
>>>>>> avoid thinking.
>>>>>
>>>>> "LOL" shows that I used to be disgusted, now I'm just amused.
>>>>
>>>> The term "jackass" comes to mind. It's still a substitute for thinking
>>>> or making a real argument.
>>>
>>> Don't like being laughed at? Try learning what scientific investigation is all about.
>>>
>> Hey, who's the scientist here? Of course all scientists are liars and/or
>> morons, so I suppose being a scientist isn't such a good thing.
>
> Wrong again.
> Scientists are typically dispassionate investigators.
> It's Darwinists who are liars and/or morons.

I think that scientists would be another subject you know nothing about.
First off, "Darwinists" is a term that only creationists use these days.
I think you may mean evolutionary biologists. But of course almost all
scientists agree with the major claims of evolutionary biologists. Are
they merely deceived?

>> Still, I actually make arguments, while all you do is say "LOL".
>
> Bullshit.
> I argue against your pompous scientific pretensions, AND laugh at them.
> The two aren't mutually exclusive.
> LOL! You didn't know that?

I haven't seen any arguments. Couldn't you at least laugh in a slightly
more creative way?

[John Harshman]

That's you being proud of your ignorance again.

>>> You think finding fossils of different animals with different forms somehow shows that they turned into each other.
>>> That's magical thinking - you just not understanding science again.
>>>
>> So why are all Eocene horses small and many-toed, with low-crowned
>> teeth, but all modern horses are large and one-toed with high-crowned
>> teeth? Do you have an explanation other than "that's what god felt like
>> at the time"?
>
> What Eocene "horses"?
> You don't get to decide for us what are "horses" and what aren't.
> It doesn't come with the PhD, you know.

It doesn't matter what you call them. Do you have an explanation?

>> For that matter, do you even think there was such a thing as the Eocene,
>> or do you think all the fossils derive from a worldwide flood?
>
> I wouldn't be surprised if you were dead wrong about both, but I don't know, so I don't make an issue of it.
> Why are you trying to bait me on the issue now?

Just trying to plumb the depths of your ignorance. Since you get most of
your information from JW sources, I thought you might agree with them.

[christi...@brown.edu]

>
> What Eocene "horses"?

Eocene mammals who look have features of the teeth, skull and skeleton only seen in modern horses.

> You don't get to decide for us what are "horses" and what aren't.

People who are experts in mammalian evolution do get to decide.

> It doesn't come with the PhD, you know

No, it doesn't need a PhD. Paleontologists like Bryan Patterson never obtained a PhD, yet had a lifetime of looking at and understanding fossil mammals. BTW, it *does* take that, PhD or no.

[Steady Eddie]

Did Bryan Patterson contribute to the "lamentable" horse evolution "problem"?

‘I admit that an awful lot of that has gotten into the textbooks as though it were true. For instance, the
most famous example still on exhibit downstairs (in the American Museum) is the exhibit on horse
evolution prepared perhaps 50 years ago. That has been presented as literal truth in textbook after
textbook. Now I think that that is lamentable, particularly because the people who propose these kinds of
stories themselves may be aware of the speculative nature of some of the stuff. But by the time it filters
down to the textbooks, we’ve got science as truth and we’ve got a problem.’
– Dr. Niles Eldredge, curator at the American Museum of Natural History, in a recorded interview with
Luther Sunderland, published in Darwin’s Enigma: Fossils and Other Problems, Master Books, El Cajon,
California, USA.

[John Harshman]

Let me point out a couple of things. First, Niles Eldredge is an
invertebrate paleontologist and one who never mastered modern methods in
phylogenetics. Christine, on the other hand, is a working vertebrate
paleontologist specializing in mammals. Who is more qualified to speak
on the subject?

Second, Luther Sunderland is well known for quote-mining. Who knows what
Eldredge actually said or meant there?

[Steady Eddie]

Of course - many different kinds of land mammals were created.
Do you have a problem with that?

> >> For that matter, do you even think there was such a thing as the Eocene,
> >> or do you think all the fossils derive from a worldwide flood?
> >
> > I wouldn't be surprised if you were dead wrong about both, but I don't know, so I don't make an issue of it.
> > Why are you trying to bait me on the issue now?
>
> Just trying to plumb the depths of your ignorance. Since you get most of
> your information from JW sources, I thought you might agree with them.

Jehovah's Witnesses do not speculate on "flood geology" either.
Where did you get that idea?

[John Harshman]

That isn't an explanation. It's a denial that there's anything to
explain. It's just "shit happens". Don't you think "shit happens" is an
inadequate response?

>>>> For that matter, do you even think there was such a thing as the Eocene,
>>>> or do you think all the fossils derive from a worldwide flood?
>>>
>>> I wouldn't be surprised if you were dead wrong about both, but I don't know, so I don't make an issue of it.
>>> Why are you trying to bait me on the issue now?
>>
>> Just trying to plumb the depths of your ignorance. Since you get most of
>> your information from JW sources, I thought you might agree with them.
>
> Jehovah's Witnesses do not speculate on "flood geology" either.
> Where did you get that idea?
>

You mean they don't believe in a worldwide flood?

[Greg Guarino]

On 5/11/2016 10:32 AM, John Harshman wrote:
> Second, Luther Sunderland is well known for quote-mining. Who knows what
> Eldredge actually said or meant there?

https://en.wikipedia.org/wiki/Talk%3AEvolution_of_the_horse

"Eldredge explains (see the cited pages for details) that what he was
trying to explain to Sunderland, which Sunderland misrepresented, was
not that the museum display at that time (it has since been updated) was
wrong, nor that the intermediates shown in the display were not actually
intermediates (they were), but merely that it gave a simplified "steady
straight line" impression of evolution, when in fact evolutionary
progress is "bushier" and more sporadic, with variable rates of change.

This is far, far different from what Sunderland tried to misrepresent
Eldredge as saying. --Ichneumon (talk) 22:10, 11 April 2008 (UTC)"

[Bob Casanova]

On Wed, 11 May 2016 11:42:23 -0400, the following appeared
in talk.origins, posted by Greg Guarino
<gdgu...@gmail.com>:

So Sutherland quote-mined and Eddie posted the mined quote
as evidence of something or other? No surprise...

[Greg Guarino]

On 5/9/2016 1:04 AM, Steady Eddie wrote:
> Wrong again.
> Scientists are typically dispassionate investigators.
> It's Darwinists who are liars and/or morons.

Let's be clear. Virtually every biologist is what you would likely call
a "Darwinist". All liars and morons? A hundred thousand or two in the world?

(It's no use trotting out the "Dissent From Darwinism" list. Very few of
those people are biologists, and it's not clear what even that group
believes)

[jillery]

Eldredge above is not supporting your claim, that these individual
species were >poofed< into existence. Eldredge instead was making a
distinction between the stereotype gradualism supported by Patterson,
and Eldredge's preferred punctuated equilibrium.

The above is very similar to your recent quote mine of Larry Moran.
You're just the most recent in a long line of IDiots who think Punq
Eek supports Intelligent Design.