quality string length is not equal to sequence length, fix your fastq file

[rsklav]

Hi all, 

As has been discussed before on this forum, I tried running STAR on my fastq files and ran into this error message. And it turned out I had the same issue as other people, namely my last read only had 90 quality characters, but that was only in one of the two fastq files; the other one was just fine. Instead of deleting that last read and then look for the corresponding read in the other fastq file to delete, I added 10 fake quality characters to the incomplete last read. I then ran into another issue: read1 and read2 are not consistent and STAR reaches the end of one file before the other. Can you help?

Thanks!

[Alexander Dobin]

Hi @rsklav,

you need to make sure that the number of reads (lines) in two files is exactly the same. You can count the lines with

$ wc -l r1.fq r2.fq

and then cut the minimum of these numbers:
$head -n minN r1.fq > r1.fixed.fq
$head -n minN r2.fq > r2.fixed.fq

For FASTQ files minN should be divisible by 4 since you have 4 lines per read.

Cheers

Alex

[Nasima]

Hi Alex,

I have the same problem. My data is human-herat failure PE sequences with four separate .fastq files for the first read and four .fastq files for th second read for each patient:

P1.1.R1.fastq.gz  

P1.2.R1.fastq.gz  

P1.3.R1.fastq.gz  

P1.4.R1.fastq.gz  

 

P1.1.R2.fastq.gz  

P1.2.R2.fastq.gz  

P1.3.R2.fastq.gz  

P1.4.R2.fastq.gz  

 

I’ve run the following script for all patients’ fastq files and it’s just working fine except for one patient:

 

STAR\

--runThreadN 32\

--genomeDir /HF2-STAR/genome\

--sjdbGTFfile /Homo_sapiens.GRCh38.79.gtf\

--readFilesIn P1.1.R1.fastq.gz, P1.2.R1.fastq.gz, P1.3.R1.fastq.gz, P1.4.R1.fastq.gz  P1.1.R2.fastq.gz, P1.2.R2.fastq.gz, P1.3.R2.fastq.gz, P1.4.R2.fastq.gz\

--readFilesCommand zcat\

--outFilterMultimapNmax 20\

--outSAMtype BAM SortedByCoordinate\

--quantMode TranscriptomeSAM GeneCounts\

--outFilterMatchNminOverLread 0\

--outFilterScoreMinOverLread 0\

--outFileNamePrefix "p1"\

 

For one patient I got the following error:

EXITING because of FATAL ERROR in reads input: quality string length is not equal to sequence length

@NB501373:8:HTTKYBGXX:4:22403:20084:1317

GCGATCTTTTTCAATACAATTTACACCCTCATCCCCATTTCCAGTCTGATTATACAAGTGCTAAGTGGCAGAA

@NB501373:8:HTTKYBGXX:4:13504:19963:7094 47732852 N 3

SOLUTION: fix your fastq file  

 

I tried to remove these lines from fastq files but then I got another error message:

 

EXITING because of FATAL ERROR: Read1 and Read2 are not consistent, reached the end of the one before the other one

SOLUTION: Check you your input files: they may be corrupted

 

I checked the number of reads in two files with $ wc -l r1.fq r2.fq and was the same (both were 56759618—not divisible by 4 though).

 

Right now I am stuck with this patient. Any help is much appreciated. 

Thank you,

Nasima

[Alexander Dobin]

Hi Nasima,

it seems like that read is missing the quality scores. The total number of lines in FASTQ has to be divisible by 4.

Please post the output of

$ grep -B4 -A8 "^@NB501373:8:HTTKYBGXX:4:22403:20084:1317" r1.fq 

$ grep -B4 -A8 "^@NB501373:8:HTTKYBGXX:4:22403:20084:1317" r2.fq

Cheers

Alex

[Samuel Mo]

Hi Alex,

Can I follow up on this thread even though it's been some time?

I'm also running into a similar error, and I've gotten other samples to work but a few like the original question. 

Can you explain why the fastq has to be divisible by 4 and what you're referring to regarding quality score? 

[Alexander Dobin]

Hi Samuel,

each read is represented with 4 lines in the FASTQ files

@readID
sequence
+
quality scores

e.g.:

@D00102:CBR8BANXX171122:CBR8BANXX:1:1101:10003:18149 1:N:0:TAAGGCGACTCTCTAT
GCTCGTAGGAGCGTATCATCAGCTGGGTGCCGTTCTTCCTGTCTCTTATAC
+
/B<</BFFFFFFFFBBFFFFFFFFFFFFFFFFBFFFFFFFFFBBFFBFFFF

The length of the quality string should be equal to the sequence length.

Cheers

Alex