Error: quality string length is not equal to sequence length

[Komal Rathi]

Hello,

I am using STAR v2.5.2b. 

This is the genome-generate step:

/mnt/isilon/cbmi/variome/bin/star/STAR-2.5.2b/bin/Linux_x86_64/STAR \
--runThreadN 4 \
--runMode genomeGenerate \
--genomeDir star_hg38_no_alt \
--genomeFastaFiles hg38.fa \
--sjdbGTFfile gencode.v23.annotation.gtf \
--sjdbOverhang 99

This is my commandline (I have tried both **STAR** and **STARlong**):

/mnt/isilon/cbmi/variome/bin/star/STAR-2.5.2b/bin/Linux_x86_64/STARlong --version
STAR_2.5.2b


/mnt/isilon/cbmi/variome/bin/star/STAR-2.5.2b/bin/Linux_x86_64/STARlong \
--runThreadN 4 \
--genomeDir star_hg38_no_alt \
--readFilesIn CHP134_R1.fastq.gz CHP134_R2.fastq.gz \
--readFilesCommand zcat \
--outFileNamePrefix CHP134_ \
--outSAMtype BAM SortedByCoordinate \
--outSAMunmapped Within \
--quantMode TranscriptomeSAM \
--outSAMattributes NH HI AS NM MD \
--outFilterType BySJout \
--outFilterMultimapNmax 20 \
--outFilterMismatchNmax 999 \
--outFilterMismatchNoverReadLmax 0.04 \
--alignIntronMin 20 \
--alignIntronMax 1000000 \
--alignMatesGapMax 1000000 \
--alignSJoverhangMin 8 \
--alignSJDBoverhangMin 1 \
--sjdbScore 1 \
--limitBAMsortRAM 50000000000

But I am getting this error in for one sample:

EXITING because of FATAL ERROR in reads input: quality string length is not equal to sequence length
@NB501069:27:HY32VBGXX:1:12111:11340:4339
GCGGGCGGGGAAGAGGGCACAGACGGGCGGGCGAGGGCCGGGGACCGCGAGGGCAAGGGCACCCGGGAGCCCGCAGAGGCGGCGGCTCGGGGAGAAACCTC


SOLUTION: fix your fastq file

This is the corresponding read in the two fastq files, the read corresponds to R1 but the quality string length is equal to sequence length:

$ zcat CHP134_R1.fastq.gz | head -n 17136372 | tail -4
@NB501069:27:HY32VBGXX:1:12111:11340:4339 1:N:0:GCCAAT
GCGGGCGGGGAAGAGGGCACAGACGGGCGGGCGAGGGCCGGGGACCGCGAGGGCAAGGGCACCCGGGAGCCCGCAGAGGCGGCGGCTCGGGGAGAAACCTC
+
AAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAEEEEEEEEEEEEEEEAEEEEEEEEEEEEEEEEEEEE<EEA


$ zcat CHP134_R2.fastq.gz | head -n 17136372 | tail -4
@NB501069:27:HY32VBGXX:1:12111:11340:4339 2:N:0:GCCAAT
GTTTTCCTGGTGGCCCGGCCGTGCCTGAGGTTTCTCCCCGAGCCGCCGCCTCTGCGGGCTCCCGGGTGCCCTTGCCCTCGCGGTCCCCGGCCCTCGCCCGC
+
AAAAAEEEEEEEEEEEEEEEEEE<EEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAEE<AEE<

I saw some solutions where you suggest to make STARlong (However this shouldnt be the case because my reads are not long). When I try to do that, I get no rule to make STARlong:

$ pwd
/mnt/isilon/cbmi/variome/bin/star/STAR-2.5.2b


$ ls
bin  CHANGES.md  doc  extras  LICENSE  README.md  RELEASEnotes.md  source


$ make STARlong
make: *** No rule to make target 'STARlong'.  Stop.

I am getting this error in a lot of samples but there are other samples that aligned just fine. I have attached the STAR log for this sample.

[Alexander Dobin]

Hi Komal,

if you re-start the mapping, does it break on the same read every time?

Please try to map just this one read extracted into Read1 Read2 files.

Cheers

Alex

[Komal Rathi]

STAR or STARlong wasn't compiled properly I think. I used conda to run STAR and don't see errors anymore.