Thank you for your answer.
My file looks like this, so basically fasta format with 6 total sequences :
>12040
ATGATCCCGCGCGAAATCGCGATTCTCGATGCGTACATGCCCACGGTCGTGCTGATGTTC
GTCGTCGGCGCGCTCGCGACCTGGGCCGTCGACCGCCTGCTCGCCTATACGGGCCTCTAC
CGTGTCGTCTGGCACCCGTCGCTGTTCCGGGCCTGCCTGCTCGTCTGCATATGCGGCGGA
CTCAGTCTCGCCGTTTACCGTTGAATGTCGAAGACAACGTATTAC
...
>12041
ATGATCCCGCGCGAAATCGCGATTCTCGATGCGTACATGCCCACGGTCGTGCTGATGTTC
GTCGTCGGCGCGCTCGCGACCTGGGCCGTCGACCGCCTGCTCGCCTATACGGGCCTCTAC
CGTGTCGTCTGGCACCCGTCGCTGTTCCGGGCCTGCCTGCTCGTCTGCATATGCGGCGGA
...
Here is all what raxml prints after I type the command :
Alignment has 386 distinct alignment patterns
Proportion of gaps and completely undetermined characters in this alignment: 0.77%
RAxML rapid hill-climbing mode
Using 1 distinct models/data partitions with joint branch length optimization
Executing 1 inferences on the original alignment using 1 distinct randomized MP trees
All free model parameters will be estimated by RAxML
GAMMA model of rate heteorgeneity, ML estimate of alpha-parameter
GAMMA Model parameters will be estimated up to an accuracy of 0.1000000000 Log Likelihood units
Partition: 0
Alignment Patterns: 386
Name: No Name Provided
DataType: DNA
Substitution Matrix: GTR
RAxML was called as follows:
raxmlHPC-PTHREADS-AVX -m GTRGAMMA -p 12345 -s core_gene_alignment.aln -n CF_ATCC_basic
Partition: 0 with name: No Name Provided
Base frequencies: 0.159 0.338 0.344 0.158
Instruction non permise (core dumped)