Would it be possible to make the built indexes for alignment of the GeCKO libraries available online? It seems like that would be easy a nice convenience for users rather than having new users rebuild their own indexes every time (which I just did).-Jon
--
You received this message because you are subscribed to the Google Groups "Genome Engineering using CRISPR/Cas Systems" group.
To unsubscribe from this group and stop receiving emails from it, send an email to crispr+un...@googlegroups.com.
For more options, visit https://groups.google.com/d/optout.
--
--
Hi NevilleI am using lentiCRISPRv2.thanks again for your prompt replyOn Tue, Feb 24, 2015 at 5:24 AM, Neville Sanjana <nsan...@mit.edu> wrote:Hello: I think ligation should work although I haven’t done it myself for GeCKO readout, as I always do the 2 rounds of PCR. As for checking the annealing regions of your primer sequences, could you let me know if you’re using libraries with lentiCRISPRv2 or with lentiGuide-Puro? Once I know the backbone vector, I would be happy to check the annealing sequences for your amplicon.
- Neville
On Feb 24, 2015, at 11:16 AM, Lab Bahlis <bahli...@gmail.com> wrote:
Hi Neville
I am using lentiCRISPRv2.
thanks again for your prompt reply
| >HGLibA_00001,A1B1G GTCGCTGAGCTCCGATTCGA >HGLibA_00002,A1B1G 
 |