Problems with Lenti Crispr cloning and question re: correct oligo BsmBI sequence

[Chris Lazarski]

We have been unable to get colonies using the Lenti Crispr after following the protocol.  This is using oligos phosphorylated with PNK in fresh T4 buffer, and we see no colonies using either SAP or non-SAP treated digested Lenti Crispr plasmid.  We also saw no negative colonies using the non SAP treated Lenti Crispr.  These are into both Stbl and Dh5a cells.  On Addgene's website, the sequence right after the U6 promoter (1726-1958) is

AAAGGACGAAACACCGGAGACGGTTGTAAATGAGCACACA, where the GAGACG is the reverse complement of the BsmBI sequence (1967-1972).  That produces a 5' overhang of CACC (according to NEB cutter).  The second cut site is 3840 to 3845 and that one is CGTCTC, which produces a 5' overhang of GTTT.

The Addgene Lenti Crispr protocol directs to have an overhang of CACC on the 5' end of the oligo, and CAAA on the 3' end.

Is this correct?  Shouldn't the overhang on the 5' end be GTGG?

[Chris Lazarski]

My oligos are:

CAC CGA CAG CCT TCA TCG TAG ACG A

AAA CTC GTC TAC GAT GAA GGC TGT C 

[Neville Sanjana]

Hi Chris,

I checked your oligos and they look correct to me. Please re-try the cloning. (It is normal to not see many colonies when ligating non-SAP treated vector since the sticky ends are not compatible.)

- Neville

--
You received this message because you are subscribed to the Google Groups "Genome Engineering using CRISPR/Cas Systems" group.
To unsubscribe from this group and stop receiving emails from it, send an email to crispr+un...@googlegroups.com.
For more options, visit https://groups.google.com/groups/opt_out.

[Chris Lazarski]

Hi Neville-

We are trying the cloning again using pre-phosphorylated oligos and will attempt a larger range of vector/insert ratios to see how that works out for us.  Thanks for the reply

Chris

[Rene Martin Linka]

Hi Chris,

I also didn't get colonies with this ratio (50 ng vector, 10 pmol ds oligo). The digested vector has about 11,5 kb, which means that 50 ng are approximately 0.04 pmol. So with 10 pmol oligo you have a molar ratio of 1:250 - quite high.

I downscaled the ligation to a ratio of 1:5 (vector : ds oligo) and got a usual numbers of colonies. Just today, so awaiting the screening...

Btw, usually you don't need to phosphorylate oligos for the cloning. The vector (P) is sufficient for cloning, E coli does the rest.

Cheers

Martin

[Rene Martin Linka]

Correction: the 11.5 kb vector has a molecular weight of about 7.150.000 g/mol. So 50 ng is only about 7 fmol, which means the ratio with 10 pmol oligo is about 1:1500.

[Annan Yang]

Hi Chris,

I had the same problem as you did. Have you solved it? I tried oligo dilution of both 1:200 (as protocol) and 1:2000, no colonies. Also no colonies for the cut vector alone. Do not know what else to do. THank you,

best,

Annan

[Chris Lazarski]

We have still had problems with the lenti crispr recombining and have moved onto the px458 and px459 plasmids, where we have had success with inserts and transfections.  I don't have any information at the moment why our lenti crispr clonings have repeatedly failed.

[Neville Sanjana]

Hey Chris and Annan,

We routinely clone oligos into lentiCRISPR (v1 and v2) without any issues. Have you sequenced your vector stock (or done a restriction digest) to make sure that the vector is as expected? Since it is a lentiviral vector with LTRs, it is possible that the vector backbone had some recombination problem when you amplified it.

Good luck!

- Neville

For more options, visit https://groups.google.com/d/optout.

[JH]

Which E. coli strain is everyone using?  Stbl3?

[Neville Sanjana]

We use Stbl3 for lentiviral vector cloning.

- Neville

On Sat, May 31, 2014 at 6:09 AM, JH <jhf...@gmail.com> wrote:

Which E. coli strain is everyone using?  Stbl3?

--

You received this message because you are subscribed to the Google Groups "Genome Engineering using CRISPR/Cas Systems" group.
To unsubscribe from this group and stop receiving emails from it, send an email to crispr+un...@googlegroups.com.

For more options, visit https://groups.google.com/d/optout.

[Annan Yang]

Hi Chris and Neville,

Thank you for your input, I realized I made a mistake when making oligos. This could be why I did not get colonies. I will try again and hope it might solve this problem. Will let you know.

Annan

[Neville Sanjana]

Glad to hear that..... any mistakes in the oligo design that result in imperfect overhangs will drastically decrease the cloning efficiency.

Good luck,

- Neville

[Annan Yang]

Neville and Chris,

I have got all the vectors I want, it was the oligos problem. Just follow the protocol, 1 out of 30 colonies have double oligo insert, but the rest are all positive. 

Just another question: when you infect cells with CRISPR vectors, what method do you use for screening positive clones, PCR, RT-PCR or western?

Thank you all for your input. 

best,

Annan

[Neville Sanjana]

Hi Annan,

There are two types of screening for positive clones:

To screen for the oligo insert (after cloning into lentiCRISPR), I use sequencing with a U6 forward primer.

To screen for genome modification after infection and selection, I recommend using deep sequencing or surveyor on PCR of the edited genomic locus.

Hope that helps,

- Neville

[Donghai Wang]

HI, Annan,
Can you please tell me what mistake in the design of the oligos that you have made? we are having the same problem and have no clue what we did wrong.
Thanks,
Donghai


在 2014年5月31日星期六UTC-4下午3时45分34秒，Annan Yang写道：

[Jennifer Cruickshank]

I have been trying to clone annealed sgOligos into BsmBI digested lentiCRISPRv2 following the Zhang lab protocol listed on Addgene. I am not getting any colonies. I've tried varying the molar ratio of vector to insert, but still no luck. Does anyone have any suggestions?

Jen

[lif...@gmail.com]

Dear all,

 

I get the same problem with the LentiCRISPRv2  according to the Zhang lab's Protocol and have done the troubleshooting for a long time. I changed the competent cells and annealing the oligos multiple times. I don't know what I

could do next. Does anyone have successful experience? My email is lif...@gmail.com. I appreciate for your any advices. Thank you.

 

Best wishes,

Jasen

 

 
在 2014年10月24日星期五 UTC-4下午2:55:17，JC写道：

[Jayant Asthana]

Hi Neville,

I am planning to use the LentiCRISPR V2 vector for gene editing. I want to tag my gene of interest with mGFP or mCherry at the endogenous locus. How useful is the vector for this application. We do not want the vector to be integrated in the genome, because we also plan to tag another gene in the same cell line and if gRNA and WT CAS9 floats around in the cells, they will cut the genomic sequence again.

Kind Regards

Jayant

[Neville Sanjana]

Hi Jayant,

To achieve HDR for GFP integration without having Cas9 or the sgRNA integrate, you can transiently transfect LCv2 plasmid along with your donor template. You will need to screen single cell-derived colonies for those that successfully underwent HDR.

Good luck,

- Neville

[Multi Nucleated]

Maybe multiple alleles got edited differently so there are multiple PCR products (even though they might look indistinguishable on gel) in the same sequencing reaction.  Could try to TOPO clone and sequence multiple plasmids to obtain clean reads.  More work..although I'm generally satisfied with lack of product with western blot.

On Thursday, September 15, 2016 at 8:21:55 PM UTC-4, Nabin Poudel wrote:

Hello

I used LentiCRISPRv2 to delete my gene of interest in 293 cells. I picked isolated single cell colonies from the transfected cells. The region of mutation has Nci I digestion site in it. I amplified the region of mutations using primers that land on either side of site of mutation (about 1 kb fragment). Digestion of this fragment with NciI shows that the site has been destructed, my Cas9 worked!! 

Now I am trying to sequence this PCR product using Sanger sequencing, so that I know what exactly is deleted. Everytime I sequence them, I get a unanimous sequence upto the point of mutation and after that there is noise for the rest of the sequence. It happens when I sequence from both the ends, upstream and downstream of site of mutation. I suspected heterogenous cell populations and I started subcloning the cells and picked single cell colonies on isolated 96 well plates. 

When I sequence DNA from cells of those subcloned isolated colonies, I still see the same result: Good sequencing consensus to the point of mutation and then noise, with both upstream primer and downstream primer. Interestingly, the sequence readout of the noise in between different clones matches to each other to a great extent. 

How is that possible? Has anybody encountered this problem? 

Also, what would be the better approach to identify the deletion? We do not have access to NGS facility. 

[Phil Abbosh]

I have had good luck with TIDE: https://tide-calculator.nki.nl/

described here: nar.oxfordjournals.org/content/42/22/e168

in my hands, with total knockout as determined on WB, this gave me (for instance) a one bp insert and one bp deletion.  different mutations but both result in frameshift, which would give you double peaks on Sanger sequencing. TIDE can figure that out.  you need to have a chromatogram from your unedited cells too. 

i got the idea from somewhere on this forum but i cant remember where. 

TA cloning is also a good method.  would only need to sequence 6-8 clones to be sure of what you have and the kit for that is pretty good.

phil

On Friday, September 16, 2016 at 3:42:07 PM UTC-4, Nabin Poudel wrote:

Yes! Thats what I am planning to do next. I was wondering if there was any other trick beside that.

Thanks

--

You received this message because you are subscribed to the Google Groups "Genome Engineering using CRISPR/Cas Systems" group.
To unsubscribe from this group and stop receiving emails from it, send an email to crispr+un...@googlegroups.com.

To post to this group, send email to cri...@googlegroups.com.
For more options, visit https://groups.google.com/d/optout.

--

Nabin Poudel, BVSc & AH
Graduate Teaching Assistant
Center for Veterinary Health Sciences,
Oklahoma State University,
Stillwater, OK, 74074
Tel: 405 612 9645

[Mike]

This is very unusual, you should get a nice sequence trace from a single topo-cloned colony, as even if there was lots of variation in the original PCR, each miniprep should have resulted from a single PCR product. The only thing I can think of to explain this would be if there was a repetitive region (especially long homopolymers), but this would need to occur right at your CRISPR cut site. If there is nothing that looks like difficult to sequence in that region that I've got no idea. If you could upload a trace file (or even just a screenshot of the aberrant region) then maybe someone might come up with another explanation?

Mike

On Tuesday, 4 October 2016 04:49:08 UTC+1, Nabin Poudel wrote:

So my TIDE results are back, 

my TOPO blunt ligation results are back.

with TIDE analysis on the sequences of my PCR product, I saw three predicted mutation, a +1, a -18 and a -20 predominant above others. 

I TOPO captured the same PCR product, and I sequenced miniprep from 5 colonies, my Sanger sequencing yielded similar results as my initial sequencing, even in TOPO captured PCR product. I have nice chromatogram peaks in the begining but they go all aberrant after the point of mutation. Just out of curiosity, I ran those chromatograms in TIDE, and now I see about 92% efficiency with 18 bp deletion, 

My questions, 

1. Is this normal ? 

2. How do you predict which base pairs are deleted? aligning the sequences in MacVector with Wildtype sequence doesnot help anything because of aberrant sequence. 

3. Is there any other sequencing method besides Sanger sequencing? I don't know how NGS works? Will NGS be able to solve this issue? 

Nabin 

[zhijie...@gmail.com]

Could you tell me what the problem  you found in your oligos was?

[Ayshe]

Hi all,

I tried cloning oligos into the lentiCRISPR plasmid following the protocol, I could not get any colonies at all. I did all possible troubleshooting and nothing worked. Oligos are fine. What could be the problem?? Is it OK just to digest the vector with no phosphatase treatment and use that directly without gel purification in ligation reaction together with oligos?

Ayshe

[Gunjan Kumar]

Hi all,

I'm just going to pile on here. I'm having the exact same issue. I'm not getting any clones. I know the BsmBI digest worked, and the liner fragment is stable. I can't tell if the oligo annealing is working and I suspect that's what the problem is. 

Thanks,

Gunjan