CRISPR/Cas9 gRNA

[anshika srivastava]

Hi,

I have designed the gRNAs from the site http://crispr.mit.edu and have got the gRNAs with 76 score. I have to inject these gRNAs into the mice embryos. I have also checked the region of my interest by running the PCR on the blastocysts. I have two specific questions:

1. Whether the score 70-80 adequate for considering gRNA for genome editing?

2. I am supposed to inject both the gRNAs and Cas9 in the mRNA format in the mouse embryos. How I can synthesize the gRNA in the mRNA format from the plasmid? I am using the pRGEN-U6 vector for synthesizing the sgRNAs.

Since I am new to this technology so the help will be highly appreciated.

Thanks

Anshika

[Le Cong]

Hi Anshika,

For 1. the score doesn't necessarily correlate with the efficiency of the guide for genome engineering so I would suggest you try a few guide that have good score and see which one is most efficient, and 70-80 is not bad. I will let other experts to reply for your questions 2.

Best,

Le 

-

Le CONG, Ph.D. 丛乐

Broad Institute of MIT and Harvard
HHMI International Fellow

Tel: (+1) 617-823-6132
E-Mail: congl...@gmail.com / co...@broadinstitute.org

--
You received this message because you are subscribed to the Google Groups "Genome Engineering using CRISPR/Cas Systems" group.
To unsubscribe from this group and stop receiving emails from it, send an email to crispr+un...@googlegroups.com.
For more options, visit https://groups.google.com/groups/opt_out.

[anshika srivastava]

Hi Li,

Thanks for the reply. It was really helpful to me.

Thanks again 

Anshika

[Patrick David Hsu]

Hi anshika,

Could you clarify your question:

1. In vitro transcription of sgRNA (short RNA)

2. In vitro transcription of Cas9 mRNA (long RNA)

which one do you want to do?

thanks,

Patrick

[anshika srivastava]

Hi Patrick,

Thanks for the response. I am trying to inject the Cas9 and sgRNA in the mRNA format in the mice embryos. For Cas9 I have already ordered the mRNA format from PNA bio but for sgRNA I need to synthesize the sgRNA using the linearized pRGEN-U6 vector and ligating the 20bp oligos and then looking for the clones. After I have the oligos inserted in the pRGEN-U6 vector how I can synthesize the sgRNAs in the mRNA format.

Please suggest

On Tuesday, January 7, 2014 1:19:19 PM UTC-5, anshika srivastava wrote:

[Renchao Chen]

U6 promoter is used to transcript gRNA in cells. For micro-injection, the gRNA is usually transcript in vitro. You can add T7 promoter before the gRNA sequence by PCR and get gRNA transcription product by using T7 in vitro transcription Kit (such as shortscript T7 kit ).

Good luck!

在 2014年1月15日星期三UTC+8上午7时24分22秒，anshika srivastava写道：

[anshika srivastava]

Hi Renchao,

Thanks for the reply. Can you please elaborate on adding T7 promoter before the gRNA sequence by PCR. I have selected the 20 bp target site with PAM motif. 

Thanks

Anshika

On Tuesday, January 7, 2014 1:19:19 PM UTC-5, anshika srivastava wrote:

[Renchao Chen]

Hi, you can just add T7 promoter TTAATACGACTCACTATAGG before your 20bp target sequence. For example, the target sequence is AACTTTTCCTTGAGCGTCCT, I use primer TTAATACGACTCACTATAGGAACTTTTCCTTGAGCGTCCT and reverse primer (for px330, I use AAAAGCACCGACTCGGTGCC) to amplify the gRNA sequence, the PCR product was gel purified and used as in vitro transcription template.

Renchao Chen

在 2014年1月16日星期四UTC+8下午8时39分53秒，anshika srivastava写道：

[anshika srivastava]

Hi Renchao, 

Thanks for the information. I still have one confusion. I am having pRGEN-U6 vector for synthesizing the sgRNAs and I have the Cas9 in the mRNA format. But with U6 promoter we cannot do in vitro transcription of sgRNA. I need to order the plasmid with T7 promoter and used for synthesizing the sgRNA and not the Cas9 then I can do in vitro transcription of my sgRNA and do the pronuclear injection in the mouse embryos using both the Cas9 and sgRNA in the mRNA format.

It would be really great if anyone could suggest me. 

Thanks 

Anshika

On Tuesday, January 7, 2014 1:19:19 PM UTC-5, anshika srivastava wrote:

[Renchao Chen]

Hi Anshika，

You dont need a vector with T7 promoter. After inserting the gRNA sequence in your U6 vector, you can amplify the in vitro transcription template from the U6-construct. The T7 promoter is added in the forward primer as indicated above. 

Wish you good luck!

Renchao

在 2014年1月17日星期五UTC+8上午2时38分17秒，anshika srivastava写道：

[Ryan Costello]

Hi Renchao,

Forgive my ignorance about the RNA transcription steps, you may have already answered my question but I don't fully understand.

I have the X330 plasmid (from Zhang lab) with my target sequences cloned into it and like Anshika I am going to be doing injections into embryos and have a few questions.

1) Can I just inject the DNA or does it need to be transcribed into RNA before injections?

2) If it does need to be the RNA, do I understand completely that this cannot be done in-vitro using the U6 promoter which is already contained in the X330 plasmid?

3) If this has to be done with the T7 promoter exactly how do I design my primers for this transcription. I understand adding the T7 promoter before my target sequence on the Forward primer but I don't fully understand the reverse primer?

I apologise if this seems very basic but as injections are very expensive I don't want to make any mistakes.

Thanks in advance,

Ryan

[Patrick David Hsu]

hey Ryan,

1. You will want to transcribe into RNA

2. You cannot use the U6 promoter

3. Here is the T7 promoter oligo (5'-3'):

TAATACGACTCACTATAGGG

Here is an example T7-gRNA oligo (5'-3'): aaaaaagcaccgactcggtgccactttttcaagttgataacggactagccttattttaacttgctatttctagctctaaaacttatccgtgaccggggacctccctatagtgagtcgtatta
tracrRNA; spacer; T7 promoter

For the T7 transcription, we use T7 High Yield RNA Synthesis Kit from NEB

 

hope this helps

Patrick

[Ryan Costello]

Hi Patrick,

Thank you very much for your response. The first 2 parts I now understand but I have some more specifics about adding the T7 promoter sequence to my DNA and then about transcribing it to RNA.

In the X330 vector the sequence is as follows:

5’
U6 promoter  (241 bp)

GCCCGCATGGCAGTTGCACAaaaaaagcaccgactcggtgccactttttcaagttgataacggactagccttattttaacttgctatttctagctctaaaac 

3’

TARGET SEQUENCE (OR SPACER)
tracrRNA

So my target sequence is before my tracrRNA. Does this mean I need to amplify my DNA with Forward primer;

TAATACGACTCACTATAGGGGCCCGCATGGCAGTTGCACA

With the green being the T7 sequence and the underlined being my spacer sequence?

Also, what would the reverse primer be in this situation?

Do I then purify this before using the kit you mentioned above?

Again, I apologise for the very specific questions,

Thanks,

Ryan

[Fatwa Adikusuma]

Hi Ryan, here the example of the primers to make IVT template. This is based on Jaenisch Cell paper.

Oligos to insert to PX330 (green is the gRNA)

5’ CACCCAGGCTGTACATCGCCGGGG 3’

           3’GTCCGACATGTAGCGGCCCCCAAA 5’

 

T7-gRNA F: 5’ TTAATACGACTCACTATAGCAGGCTGTACATCGCCGGGG 3’

(yellow is T7 promoter)

Reverse primer: 5’ AAAAGCACCGACTCGGTGCC 3’

After the IVT you need to clean up the gRNA, you can use RNeasy mini kit.

Cheers,

Fatwa

[Cor]

To be complete (and perhaps a bit of nit-picking here): if you would use below sgRNA in pX330 as a plasmid in transfection experiments, one should add a "G" before it for proper expression from the U6 promotor:

5’ CACCGCAGGCTGTACATCGCCGGGG 3’

          3’CGTCCGACATGTAGCGGCCCCCAAA 5’

Best,

Cor

[Ryan Costello]

Thank you Cor and Fatwa,

My gRNA in X330 already has the 'G' added at the start so this shouldn't be a problem.

I have looked at the Jaenisch Cell Paper and the supplemental information now and I am confused by the primers for the IVT template for the Cas9 mRNA.

Is this for generating Cas9 mRNA from pX330 or from somewhere else? I say this because part of the forward is not identical to the X330 (Zhang lab) sequence I have from addgene. On the forward primer there are 4 base pairs between the T7 sequence and the X330 sequence that I am not sure about?

Thanks,

Ryan

[CS]

Hi Patrick and Ryan and others,

I may be really retarded, but I am really confused to as why it is required to transcribe all these different components before pronuclear injections for mouse targeting?  I thought injection of simply the pX330/335 bicistronic expression plasmids was sufficient....?!?!

Thanks and sorry again for the dumb questions....:(

caroline

[Peter Hohenstein]

I have seen a paper for TALENs plasmid injection instead of RNA which was as efficient as RNA, haven’t seen it yet for CRISPR. Logic tells me it shouldn’t be different…

 

Peter

--

[Cor]

These papers describe the injection plasmid into zygotes:

http://www.ncbi.nlm.nih.gov/pubmed/24372541

and

http://www.nature.com/srep/2013/131127/srep03355/full/srep03355.html


They are from the same group, I believe there is also a paper of a  Chinese group describing the same approach.

I believe their claim  is that plasmid works as good as RNA, we tried it once (compairing plasmid versus RNA0 and obseved that the NHEJ frequency was much lower with plasmid than with RNA, but again only one try does not count ..

Best,

Cor

[Hemant Bengani]

Hi Chen

Using folowing sequence  AAAAGCACCGACTCGGTGCC as reverse primer to amplify gRNA for invitro transcription will exclude one of the scaffold sequence (GTTTTAGAGCTAGAAATAGC)just upstream to the reverse primer but include the one 3' to the guide RNA.
Will it make a difference?if not then could you please able to tell me what is the use of this sequence.

Best
hemant

[leeleeleeleelee]

Hello, 

I know this post is old but I just stumbled onto it and have a few questions:

I am also trying to do an in vitro transcription of my guide RNA and need to add a t7 promoter. I used your guidelines for designing my primers. I tried combining my extension and annealing step with a two-step PCR and cannot see any product on a gel. I also did a normal pcr with 35 cycles and 15ng of DNA/rxn (recommended by herculase II polymerase protocol). I can see a band but it is not very prominent. It is about the same as a control band I have in there at a concentration of 20 ng/µl. I need a much higher concentration for the in vitro transcription reaction (kit recommends about 500ng/µl). Any ideas on your end? What was your PCR set up when using the primers you listed? Did you have to change anything due to using a 40bp

Thanks,

Nathan

[Sindhu Naik]

Hi Fatwa,

Apologies for asking this question on an old thread, but you mention cleaning up guide RNA with RNeasy mini kit but the protocol for RNeasy mini kit says the binding capacity is for >200nt and guide RNA are of approx 100nt, isn't this a problem?

I have got good yield after IVT and I'm worried that I will lose all of them if I use wrong kit or protocol. Please could you help with your experience?

Thanks

Sindhu

[Silvana Konermann]

Hi Sindhu,

I usually use the microRNeasy kit to ensure that I am retaining the small sgRNAs. Other people in our lab use the Megaclear kit successfully.

Hope this helps!

Best,

Silvana

[Fatwa Adikusuma]

We always use RNeasy mini kit to purify gRNA, hardly failed...

Cheers,

Fatwa

[Marwa]

Hi everyone

Sorry to bring back the discussion again regarding the sgRNA design but I have one small questions. I am planning to use the Same sgRNA for gene targeting in vitro (transfection with electroporation) and in vivo (embryo injection) and as I understood one should Add a T7 promoter seq for in vitro transcription while for in vitro transcription the sgRNA should be expressed from a U6 promoter. Now I was wondering whether I could Clone my sgRNA behind a U6 promoter but Also include a T7 seq at the same time.  This way I can order a gBlock seq that include the T7seq and SgRNA for in vivo and just clone it in a U6 vector for in Vitro. Would that be possible ?? 

Thanks a lot 

Marwa  

[JP]

I would not do that. It would make the 5' end of your sgRNA have additional sequence that might disrupt its binding to the desired gDNA site.

[jga...@exeligen.com]

Hello Fellow Gene Engineers,

Exeligen Scientific now offers custom endotoxin-free gRNA synthesis that is Injection/tranfection ready for your CRISPR/Cas9 gene editing needs delivered to you within 2 weeks! RNA gel  QC validation and high yield/concentration guaranteed! 

Please visit www.exeligen.com

Please Inquiry at: sa...@exeligen.com

Have a great weekend,

Johan Garza

Technical Sales & Marketing Manager

Exeligen Scientific, Inc. 

[Joe Miano]

Injecting plasmid DNA could very well work but then you have the issues of high mosaicism (with possible non-targeting of germ cells) and the uncertainty surrounding random integration of the plasmid and chronic Cas9 expression.

For all of our mouse work up to now, we inject RNA and ssoligo in cytoplasm or pronucleus and cytoplasm 

We are looking to test the recent RNP approach with Cas9 protein and synthesized crRNA and tracrRNA (saves a lot of time) +/- HDR template.