Multiple gRNA into a single CRISPR array

[Parwez Alam]

Dr. Zhang,

Very nice paper on Multiplex Genome Engineering using CRISPR/Cas System, a revolutionary research.

I have a question regarding multiplexing of genome engineering using CRISPR/cas system. In your paper you have mentioned that multiple gRNA can be encoded into single CRISPR array. 

1) I wanted to know upto how many gRNA you have tested in a single CRISPR array? And whether number gRNA encoded into a single CRISPR array affects its efficiency?

 Is it possible to drive expression of multiple gRNA (more than three) by a single promoter in the construct?

2) Also have you detected bi-allelic mutations for a target in your experiments? What are their efficiency?

3) Is there a way to introduce a selectable marker for the mutated clones in this technique?

I will highly appreciate if you could clarify these questions.

Thanks and regards,

Parwez

[yang...@gmail.com]

Dr. Zhang<

I have the same question. I am planning to make conditional targeting. How can I make a single CRISPR array encoding two targeting spacers as you did on your science paper2/15/13) Fig 4 with the commercial px260/px330. I didn't find it(and the DR sequence) from your paper.

Hope to hear from you again.

Thanks.

Juxiang.

[Le Cong]

Dear Juxiang, Parwez, and others interested in the multiplex design and application,

I wrote a response to similar questions before (Attach below again in case some of you didn't see it) and we also updated our main website with the information. Please check out the application note section in the reagent page: http://www.genome-engineering.org/crispr/?page_id=23

I strongly recommend everyone to check back at our website regularly for updates and additional information as we are working constantly to improve it. 

Hope this helps!

Best,

Le

_____

(previous response)

Regarding the design, we have supplied detailed sequence information as well as design in the supplementary information of the paper, please refer to Supple Figure S5. 

Meantime, I wrote a note below that summarizes and provides information for design of CRISPR constructs, esp. for the CRISPR array design and DR sequence, here in detail:

(1) Chimeric vs. Array design

In our most recent updated design, the full-length longer chimeric RNA design in general has been the most efficient system for introducing genome cleavage, the system and construct maps, reagent links to Addgene are all provided at our website: http://www.genome-engineering.org/crispr/?page_id=23

(2) Direct Repeat Sequence

Despite the new chimeric design, The CRISPR array design allows for simultaneous cleavage at multiple genomic loci with a single array.

The DR sequence we used for S. pyogenes is:  GTTTTAGAGCTATGCTGTTTTGAATGGTCCCAAAAC

(3) Multiplexing CRISPR Array Design

Therefore,  when trying to clone a two-spacer CRISPR array into our backbone vector like PX260, you should first define your two 30-bp protospacer targets, then order a pair of oligos looks like:

5' - AAACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN-DR-NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGT - 3'

and

3' - NNNNNNNNNNNNNNNNNNNNNNNNNNNNNN-DR-NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAAAAT - 5'

So the annealed product looks like:

5' - AAACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN-DR-NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGT - 3'

    3' - NNNNNNNNNNNNNNNNNNNNNNNNNNNNNN-DR-NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAAAAT - 5'               

Which can be readily cloned into the target backbone vector PX260 or PX334.

Please let me know if me know if you have any further questions or comments. Hope this helps with your experiments.

-

Le CONG 丛乐

Harvard University/Harvard Medical School
HHMI International Fellow

Tel: (+1) 617-823-6132
E-Mail: congl...@gmail.com / co...@fas.harvard.edu

--
You received this message because you are subscribed to the Google Groups "Genome Engineering using CRISPR/Cas Systems" group.
To unsubscribe from this group and stop receiving emails from it, send an email to crispr+un...@googlegroups.com.
For more options, visit https://groups.google.com/groups/opt_out.
 
 

[yang...@gmail.com]

Dear Dr. Cong:

Thanks for your reply. I checked the website several days ago, and didn't get the answer. Today after I post my question, I found your reply to the same question to Marbre on 3/25/13. Sorry I should check it earlier before the post.

Again thank you so much for your nice help to me and lots of people in need.

Best regards,

Juxiang.

[Rory Johnson]

Hi Dr Cong

Thanks for your excellent work on the Cas9 system.

I'm looking into doing multiplex targeting also, and I have a few doubts that I hope you could clarify for me:

1) I'm confused why on this page (http://www.genome-engineering.org/crispr/?page_id=23), the upper figure shows a targeting protospacer region of 30nt, whereas in every other construct I've seen it is 20nt long. Is there some reason that for multiplex targeting you use 30nt protospacers? Is this size fixed? Is there some advantage to using 30nt?

2) Looking at the section in the FAQ page http://www.genome-engineering.org/crispr/?page_id=159 regarding "How should I design the oligos for simultaneous cleavage" : In the case where you are expressing >1 different chimaeric gRNAs from a single construct, It appears that you are creating two fused gRNAs, consisting of protospacer1-DR-protospacer2-DR. Is this correct Could you point me to a plasmid sequence example containing multiplex gRNAs so I can see how it works?

3) Similar to the above, if we want to incorporate the new longer 85nt tracRNA mentioned here http://www.genome-engineering.org/crispr/ for creating multiplex targeting, then we just modify the DR in the tandem sequence?

4) Is the longer 85nt tracRNA compatible with other Cas9 constructs, specifically the Cas9-KRAB developed by Weissmann's group? Its not clear to me whether the various published Cas9 proteins are all compatible with the various gRNAs that are around.

Appreciate your help!
Rory Johnson

[Le Cong]

Hi Rory,

Sorry about delay. For your questions:

1. The reason for the 30nt region on the upper is because the top figure shows the construct from our 'Split RNA' design, where the pre-processing form of crRNA is expressed and a tracrRNA (the helper RNA that facilitate the processing of the crRNA) is also expressed from a separate promoter. In the pre-processing form, the crRNA contains 30nt of the target spacer, but then when expressed in cell and with Cas9 and tracrRNA, it will be processed (i.e., cleaved) into a shorter form that contains 20bp of the target spacer, or in another words, the first 10bp will be cut off. That's why in the lower figure with PX330 and PX335, where the construct is from our 'Chimeric RNA' design (meaning the mature processed form of crRNA is fused chimerically to a mature tracrRNA), the spacer used is only 20bp. Please refer to our paper's description for more detail (http://www.ncbi.nlm.nih.gov/pubmed/23287718)

One important note is that this design is not as efficient in genome editing as the second design (in PX330/PX335), so we recommend people all use the PX330/PX335 system. Please refer to another paper from us for comparison (http://www.nature.com/nbt/journal/vaop/ncurrent/full/nbt.2647.html)

2. For multiplexing CRISPR to target multiple genome loci, the most efficient and easiest way is probably to co-tranfect several plasmid together, with each plasmid having a targeting spacer cloned into the backbone (PX330 or PX335, depending if you want to use wildtype cas9 or double nickase). 

For example, if you want to target two genomic loci with wildtype Cas9, clone two spacers for each locus into PX330, then co-transfect or delivery the two plasmids together into your cells. If you want to use double nickase, you need to have four spacers co-expressed and using PX335 to express the Cas9n (nickase). 

3. Again, I would recommend trying to co-deliver multiple plasmids, this could be more efficient than trying to clone multiple targets into a single one vector. If you want to try the multiplexing single-vector, because there are a lot of info for explaining the design in detail, please email me directly at co...@broadinstitute.org and I could provide you with more information, the single-vector has the benefit that all spacers are in the same vector, but it is usually less efficient so I don't recommend using it. Also, to use the long-85nt design, the DR is still the same, but you will need to clone the longer 85-nt tracrRNA.

4. For most CRISPR system to achieve max efficiency, we usually need to use matching tracrRNA and DR, with the proper Cas9 from the same CRISPR locus. So if the construct is using wildtype DR and the same Cas9 from S. pyogenes as we used, then the tracrRNA should be compatible.

Hope this helps!

Best,

Le

 

-

Le CONG, Ph.D. 丛乐

Broad Institute of MIT and Harvard
HHMI International Fellow

Tel: (+1) 617-823-6132
E-Mail: congl...@gmail.com / co...@broadinstitute.org

[TC888]

you can try Cys4-based system, as described in a recent Mol Cell paper.

[JP]

Do you have the reference, please?

[TC888]

Multiplexed and Programmable Regulation of Gene Networks with an Integrated RNA  and CRISPR/Cas Toolkit in Human Cells

Lior Nissim,1,2 Samuel D. Perli,1,2 Alexandra Fridkin,1 Pablo Perez-Pinera,1 and Timothy K. Lu1,*
1Synthetic Biology Group, Research Laboratory of Electronics, Department of Biological Engineering and Electrical Engineering & Computer
Science, Massachusetts Institute of Technology, Cambridge, MA 02142, USA

[JP]

Thank you!