--
You received this message because you are subscribed to the Google Groups "Genome Engineering using CRISPR/Cas Systems" group.
To unsubscribe from this group and stop receiving emails from it, send an email to crispr+un...@googlegroups.com.
For more options, visit https://groups.google.com/d/optout.
Thanks for your information.
This helps a lot!
Let me ask you how to determine "very strong bands".
Is it determined by the final PCR product (PCR#2)? or do you even consider it just after the first PCR (PCR#1)?
To gel purify the amplicon of PCR#2 for NGS, I may load 100ul PCR#2 reaction into a well (or split into 2 wells?).
So do you mean that it is overamplification if you see very strong bands from this well?
Or do you load a portion of PCR samples?
I'm sorry to ask you a basic question but I think that the band intensity may vary depend on how much sample I load in a well.
It is also very helpful if you remember the quantity of PCR amplicon from each reaction (or pool you did in Science).
--
How much concentration of library do you use for HiSeq2500 sequence?also how much PhIX spike do you use?
Last time when I sequenced Gecko library plasmid using MiSeq, I used 2nM of amplicon library and it seemed to work.
But I used 50% PhIX and wasted lots of read. So I want to know the appropriate condition.
About the preparation of amplicon library by 2 step PCR (#1 and #2), I believe that one experimental sample needs 13 PCR reactions (10ug gDNA each) in order to maintain library complexity at x300 as you did in Science paper. But do you also perform 2nd PCR (#2) of these 13 reactions, individually (in individual 13 tubes)? or after 1st PCR, do you combine 13 reactions, take 5 ul of PCR products and perform 2nd PCR in 1 tube?
If you perform the 2-step PCR amplification of 13 tubes individually, total post PCR amplicon volume may be 1.3ml.
In this case, do you just mix them, take a portion of them and pool them into other experimental samples and do gel purification?
I'm bothering you many times... but you suggestion and answer are invaluable to me.
Thank you so much for your help, Neville.We validated the representation of plasmid and got nearly 64500 sgRNA.The representation in your Science paper was very good. I think the biological might not be the main reason, although we used the different cell type (mine is HepG2)So I think the main reason might be the PCR#1 or PCR#2.Would you mind offer me the actual number of PCR2# reactions when you conducted the GeCKO v1 validation of transducted cells?Sharp
在 2015年3月25日星期三 UTC+8下午1:18:02,Neville Sanjana写道:
| v2Adaptor_F | AATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCG | 
| v2Adaptor_R | TCTACTATTCTTTCCCCTGCACTGTtgtgggcgatgtgcgctctg | 
| v2Adaptor_R | TCTACTATTCTTTCCCCTGCACTGTtgtgggcgatgtgcgctctg | 
Hi.
How much PCR product is in a single 100ul PCR2 reaction? I'm writing SOP for our group and may need to concentrate and reduce the volume of PCR2 before running on a gel due to the number of PCR reactions I will have.
Thanks
Hi Neville,