To view this discussion on the web visit https://groups.google.com/d/msgid/anvio/5339bfea-272a-4ddb-94db-f9ab9f168d04%40googlegroups.com.--
Anvi'o Paper: https://peerj.com/articles/1319/
Project Page: http://merenlab.org/projects/anvio/
Code Repository: https://github.com/meren/anvio
---
You received this message because you are subscribed to the Google Groups "Anvi'o" group.
To unsubscribe from this group and stop receiving emails from it, send an email to anvio+unsubscribe@googlegroups.com.
To view this discussion on the web visit https://groups.google.com/d/msgid/anvio/CAK5_LaeUmszHsWbzAKFVm6jys_DpoZz-tweaXc2%3DE579OPUP9w%40mail.gmail.com.
--
Anvi'o Paper: https://peerj.com/articles/1319/
Project Page: http://merenlab.org/projects/anvio/
Code Repository: https://github.com/meren/anvio
---
You received this message because you are subscribed to the Google Groups "Anvi'o" group.
To unsubscribe from this group and stop receiving emails from it, send an email to anvio+unsubscribe@googlegroups.com.
To view this discussion on the web visit https://groups.google.com/d/msgid/anvio/d322a9f6-6d36-4d72-aef2-01588a9f40b7%40googlegroups.com.
Hello Antii,It looks like I said I would report back and never did :)The short answer is I did not get it to work. I tried the same troubleshooting you mentioned and it did not work. With the release of 2.3.0 I am re-running the analysis to see if works. So this time I WILL report back.My interest in using IMG pre-called genes is so that I can go back and look at what gene neighborhood a particular PC is found in. Have you found a good way to do this with anvi'o?Jarrod
On Fri, Apr 21, 2017 at 9:25 AM, Antti Karkman <antti....@gmail.com> wrote:
Hi Jarrod and Meren,I ran into the same problem. Any update on this?The log.txt file doesn't give any obvious reason. Shows the MCL output and number of protein clusters, but nothing after that.I'm using the flag --exclude-partial-gene-calls, because otherwise the making of blast DB fails.The partial gene calls don't have any AA sequences, which probably causes the failure in makeblastdb command.And everything works when skipping the alignments, so probably something wrong with the muscle step.Using anvio v. 2.2.3. in anaconda2 virtual environment.My muscle version is 3.8.31.-Antti
--
Anvi'o Paper: https://peerj.com/articles/1319/
Project Page: http://merenlab.org/projects/anvio/
Code Repository: https://github.com/meren/anvio
---
You received this message because you are subscribed to the Google Groups "Anvi'o" group.
To unsubscribe from this group and stop receiving emails from it, send an email to anvio+un...@googlegroups.com.
To unsubscribe from this group and stop receiving emails from it, send an email to anvio+unsubscribe@googlegroups.com.
To view this discussion on the web visit https://groups.google.com/d/msgid/anvio/f9e0ccf8-30e6-4b0f-991a-d56745e52080%40googlegroups.com.
To unsubscribe from this group and stop receiving emails from it, send an email to anvio+unsubscribe@googlegroups.com.
To view this discussion on the web visit https://groups.google.com/d/msgid/anvio/bf105635-735c-42aa-9038-d0399128b2ad%40googlegroups.com.

Wait! I just found another bug. I will fix that, and let you know again. Sorry.It turns out some of the genes coming from IMG external gene calls contains multiple stop codons within genes. Like this one, Jarrod, if you would like to check:In otu18_DIS1, gene callers id 2572236632 translates to this:VDVAQW*SPGL*CRWLGVRVPSSTPThis is the entry in the external genes file:$ grep 2572236632 otu18_DIS1.gene.listI will simply replace STOP codons with X's and warn the user.Best,
To unsubscribe from this group and stop receiving emails from it, send an email to anvio+unsubscribe@googlegroups.com.
To view this discussion on the web visit https://groups.google.com/d/msgid/anvio/53ab3a2f-5f1a-4c59-b970-e99ae9f37db4%40googlegroups.com.
And if I really get to wish, a GFF3 parser to add functional annotation would be nice. If it is possible.
##gff-version 3.2.1 ##sequence-region ctg123 1 1497228 ctg123 . gene 1000 9000 . + . ID=gene00001;Name=EDEN ctg123 . TF_binding_site 1000 1012 . + . ID=tfbs00001;Parent=gene00001 ctg123 . mRNA 1050 9000 . + . ID=mRNA00001;Parent=gene00001;Name=EDEN.1 ctg123 . five_prime_UTR 1050 1200 . + . Parent=mRNA00001 ctg123 . CDS 1201 1500 . + 0 ID=cds00001;Parent=mRNA00001 ctg123 . CDS 3000 3902 . + 0 ID=cds00001;Parent=mRNA00001 ctg123 . CDS 5000 5500 . + 0 ID=cds00001;Parent=mRNA00001 ctg123 . CDS 7000 7600 . + 0 ID=cds00001;Parent=mRNA00001 ctg123 . three_prime_UTR 7601 9000 . + . Parent=mRNA00001 ctg123 . cDNA_match 1050 1500 5.8e-42 + . ID=match00001;Target=cdna0123+12+462 ctg123 . cDNA_match 5000 5500 8.1e-43 + . ID=match00001;Target=cdna0123+463+963 ctg123 . cDNA_match 7000 9000 1.4e-40 + . ID=match00001;Target=cdna0123+964+2964 ##FASTA >ctg123 cttctgggcgtacccgattctcggagaacttgccgcaccattccgccttg tgttcattgctgcctgcatgttcattgtctacctcggctacgtgtggcta tctttcctcggtgccctcgtgcacggagtcgagaaaccaaagaacaaaaa aagaaattaaaatatttattttgctgtggtttttgatgtgtgttttttat aatgatttttgatgtgaccaattgtacttttcctttaaatgaaatgtaat cttaaatgtatttccgacgaattcgaggcctgaaaagtgtgacgccattc gtatttgatttgggtttactatcgaataatgagaattttcaggcttaggc ttaggcttaggcttaggcttaggcttaggcttaggcttaggcttaggctt aggcttaggcttaggcttaggcttaggcttaggcttaggcttaggcttag aatctagctagctatccgaaattcgaggcctgaaaagtgtgacgccattc ... >cnda0123 ttcaagtgctcagtcaatgtgattcacagtatgtcaccaaatattttggc agctttctcaagggatcaaaattatggatcattatggaatacctcggtgg aggctcagcgctcgatttaactaaaagtggaaagctggacgaaagtcata tcgctgtgattcttcgcgaaattttgaaaggtctcgagtatctgcatagt gaaagaaaaatccacagagatattaaaggagccaacgttttgttggaccg tcaaacagcggctgtaaaaatttgtgattatggttaaagg
Dr. Nastassia Patin
Postdoctoral Researcher
School of Biology
Georgia Institute of Technology
To unsubscribe from this group and stop receiving emails from it, send an email to anvio+unsubscribe@googlegroups.com.
To view this discussion on the web visit https://groups.google.com/d/msgid/anvio/CABcLjY0_3iNj0gvaUCc37yakgtP09A1u2-1oXZ8L__AVgZvA0g%40mail.gmail.com.
You received this message because you are subscribed to a topic in the Google Groups "Anvi'o" group.
To unsubscribe from this topic, visit https://groups.google.com/d/topic/anvio/QIn2TKTutJM/unsubscribe.
To unsubscribe from this group and all its topics, send an email to anvio+unsubscribe@googlegroups.com.
To view this discussion on the web visit https://groups.google.com/d/msgid/anvio/CAK5_LacH7HD4GRBeJGNfP9kKtXGCoNyfVVLpP7%2BEKio0JTfD8w%40mail.gmail.com.
To view this discussion on the web visit https://groups.google.com/d/msgid/anvio/CABcLjY3%2BZLK%3DOByATkFzrQsrC2sFN%2BHdBbCN2Wewe2GfmuQ7nw%40mail.gmail.com.
To view this discussion on the web visit https://groups.google.com/d/msgid/anvio/CABcLjY0_3iNj0gvaUCc37yakgtP09A1u2-1oXZ8L__AVgZvA0g%40mail.gmail.com.
--
Anvi'o Paper: https://peerj.com/articles/1319/
Project Page: http://merenlab.org/projects/anvio/
Code Repository: https://github.com/meren/anvio
---
You received this message because you are subscribed to a topic in the Google Groups "Anvi'o" group.
To unsubscribe from this topic, visit https://groups.google.com/d/topic/anvio/QIn2TKTutJM/unsubscribe.
To unsubscribe from this group and all its topics, send an email to anvio+un...@googlegroups.com.
To view this discussion on the web visit https://groups.google.com/d/msgid/anvio/CAK5_LacH7HD4GRBeJGNfP9kKtXGCoNyfVVLpP7%2BEKio0JTfD8w%40mail.gmail.com.
--Dr. Nastassia Patin
Postdoctoral Researcher
School of Biology
Georgia Institute of Technology
--
Anvi'o Paper: https://peerj.com/articles/1319/
Project Page: http://merenlab.org/projects/anvio/
Code Repository: https://github.com/meren/anvio
---
You received this message because you are subscribed to the Google Groups "Anvi'o" group.
To unsubscribe from this group and stop receiving emails from it, send an email to anvio+un...@googlegroups.com.
Hi Nastassia,Have you tried to use the `--ignore-internal-stop-codons` option in the pangenomics pipeline? That might help.
Or then you need to re-run the metagenomes and exclude all gene calls with internal stop codons already in that step.
bestAntti
To view this discussion on the web visit https://groups.google.com/d/msgid/anvio/CABcLjY2s67m8%3DX7vL1S0fq4OB%3DNMwHCiJGbq56MP%3DPmxnqnbOg%40mail.gmail.com.
To view this discussion on the web visit https://groups.google.com/d/msgid/anvio/CAK5_Lae1SQHRhxNYvb7pcb1YinC5jT4OQr%3DmW38gVhiEeTw3Rw%40mail.gmail.com.