<<All reads are mateless>> error on test dataset

[Stelios B]

Hello,

I downloaded the test dataset from here like the README suggests and I am executing the exact command, but I am getting the all reads are mateless error:

$ abyss-pe k=25 name=test in='test-data/reads1.fastq test-data/reads2.fastq'
ABYSS -k25 -q3   --coverage-hist=coverage.hist -s test-bubbles.fa  -o test-1.fa test-data/reads1.fastq test-data/reads2.fastq
ABySS 1.5.2
ABYSS -k25 -q3 --coverage-hist=coverage.hist -s test-bubbles.fa -o test-1.fa test-data/reads1.fastq test-data/reads2.fastq
Reading `test-data/reads1.fastq'...
Reading `test-data/reads2.fastq'...
Loaded 938113 k-mer
Minimum k-mer coverage is 22
Using a coverage threshold of 2...
The median k-mer coverage is 5
The reconstruction is 227624
The k-mer coverage threshold is 2.23607
Setting parameter e (erode) to 2
Setting parameter E (erodeStrand) to 1
Setting parameter c (coverage) to 2.23607
Generating adjacency
Added 1897999 edges.
Eroding tips
Eroded 499695 tips.
Eroded 0 tips.
Pruning tips shorter than 1 bp...
Pruned 11 k-mer in 11 tips.
Pruning tips shorter than 2 bp...
Pruned 16 k-mer in 8 tips.
Pruning tips shorter than 4 bp...
Pruned 73 k-mer in 21 tips.
Pruning tips shorter than 8 bp...
Pruned 140 k-mer in 23 tips.
Pruning tips shorter than 16 bp...
Pruned 278 k-mer in 24 tips.
Pruning tips shorter than 25 bp...
Pruned 93 k-mer in 5 tips.
Pruning tips shorter than 25 bp...
Pruned 92 tips in 6 rounds.
Marked 35786 edges of 17755 ambiguous vertices.
Removing low-coverage contigs (mean k-mer coverage < 2.23607)
Found 437801 k-mer in 25227 contigs before removing low-coverage contigs.
Removed 231837 k-mer in 9467 low-coverage contigs.
Split 18897 ambigiuous branches.
Eroding tips
Eroded 3118 tips.
Eroded 0 tips.
Pruning tips shorter than 1 bp...
Pruned 9 k-mer in 9 tips.
Pruning tips shorter than 2 bp...
Pruned 20 k-mer in 17 tips.
Pruning tips shorter than 4 bp...
Pruned 86 k-mer in 42 tips.
Pruning tips shorter than 8 bp...
Pruned 245 k-mer in 58 tips.
Pruning tips shorter than 16 bp...
Pruned 737 k-mer in 80 tips.
Pruning tips shorter than 25 bp...
Pruned 768 k-mer in 53 tips.
Pruning tips shorter than 25 bp...
Pruned 259 tips in 6 rounds.
Popping bubbles
Removed 81 bubbles.
Removed 81 bubbles
Marked 525 edges of 258 ambiguous vertices.
Left 6 unassembled k-mer in circular contigs.
Assembled 198539 k-mer in 907 contigs.
Removed 737126 k-mer.
The signal-to-noise ratio (SNR) is -5.64374 dB.
AdjList   -k25 -m50 test-1.fa >test-1.adj
abyss-filtergraph    -k25 -g test-2.adj test-1.adj >test-1.path
PopBubbles  -j2 -k25  -p0.9  -g test-3.adj test-1.fa test-2.adj >test-2.path
MergeContigs  -k25 -o test-3.fa test-1.fa test-2.adj test-2.path
The minimum coverage of single-end contigs is 2.28.
The minimum coverage of merged contigs is 2.94118.
Consider increasing the coverage threshold parameter, c, to 2.94118.
awk '!/^>/ {x[">" $1]=1; next} {getline s} $1 in x {print $0 "\n" s}' \
        test-2.path test-1.fa >test-indel.fa
ln -sf test-3.fa test-unitigs.fa
abyss-map  -j2 -l25    test-data/reads1.fastq test-data/reads2.fastq test-3.fa \
        |abyss-fixmate  -l25  -h test-3.hist \
        |sort -snk3 -k4 \
        |DistanceEst  -j2 -k25 -l25 -s200 -n10   -o test-3.dist test-3.hist
Building the suffix array...
Building the Burrows-Wheeler transform...
Building the character occurrence table...
Mateless   0
Unaligned  0
Singleton  0
FR         0
RF         0
FF         0
Different  0
Total      0
abyss-fixmate: error: All reads are mateless. This can happen when first and second read IDs do not match.
error: `test-3.hist': No such file or directory
make: *** [test-3.dist] Error 1
make: *** Deleting file `test-3.dist'

The seq IDs in the read files are correct:

$ head  test-data/reads1.fastq
@chrI_81988_82422_0:0:0_1:0:0_0/1
GTTTATCGATGCCCAGTGTATGAGCCATAACGGGGATGTTATGAACCATGTGGCTACTTTTATAAGCGGT
+
2222222222222222222222222222222222222222222222222222222222222222222222
@chrI_201595_202112_0:0:0_1:0:0_1/1
TCATTATCTGCCTATACAGGAAACGCTTTATTTGGCTCAATAATATGATCATGTTTGTCTGAAGTTGGCA
+
2222222222222222222222222222222222222222222222222222222222222222222222
@chrI_67428_67876_0:0:0_1:1:0_2/1
CTTGCTTGATTTTTTCTTCTACTACTGAGTCTGCCAGTCAAATGGATTTCTGAGGAAAGAGTACTATACC

 and

$ head  test-data/reads2.fastq
@chrI_81988_82422_0:0:0_1:0:0_0/2
TTTCATGCCACCAACTGCGAAAAGACAAGGCATGCATCCATGGCTGGTGAAGTGTTTGTTTAGGCTATGA
+
2222222222222222222222222222222222222222222222222222222222222222222222
@chrI_201595_202112_0:0:0_1:0:0_1/2
ATTCAATGAGATAAGGAGTATAGTAAGATATAATCCCACTAACGATTAGCGAGTGACATGTCTATTTTGC
+
2222222222222222222222222222222222222222222222222222222222222222222222
@chrI_67428_67876_0:0:0_1:1:0_2/2
GCTGACAGAGGCGGCAGTGGCGGTGGAAGTGCCACTAGCGGTAGCATACCTTGCATTAGCGTATCTAATTEnter code here...

And I think I have enough RAM available ( ~2GB)  for the 7,2MB dataset.

Any thoughts?

[Stelios B]

 
By 2GB, I mean 2GB free in the heap, right now. The overall RAM is 4GB

[Anthony Raymond]

Hi,

Looks like the problem is that abyss-map is not printing any alignments (likely means it is exiting early). First of all, please rerun this test assembly adding the verbose option to abyss-pe (abyss-pe v=-v …). 

Also, please report the output of this command:

abyss-map  -j2 -l25 -v   test-data/reads1.fastq test-data/reads2.fastq test-3.fa |tail

Thanks,

Tony

--
You received this message because you are subscribed to the Google Groups "ABySS" group.
To unsubscribe from this group and stop receiving emails from it, send an email to abyss-users...@googlegroups.com.
For more options, visit https://groups.google.com/d/optout.

[Stelios B]

Hi,

The verbose output is

$ abyss-pe v=-v name=test k=25 in='test-data/reads1.fastq test-data/reads2.fastq'ABYSS -k25 -q3 -v --coverage-hist=coverage.hist -s test-bubbles.fa  -o test-1.fa test-data/reads1.fastq test-data/reads2.fastq
ABySS 1.3.6
ABYSS -k25 -q3 -v --coverage-hist=coverage.hist -s test-bubbles.fa -o test-1.fa test-data/reads1.fastq test-data/reads2.fastq
Reading `test-data/reads1.fastq'...
Read 20000 reads. Hash load: 564349 / 1073741824 = 0.000526 using 376 MB
Reading `test-data/reads2.fastq'...
Read 20000 reads. Hash load: 938113 / 1073741824 = 0.000874 using 388 MB
Loaded 938113 k-mer
Hash load: 938113 / 4194304 = 0.224 using 42.8 MB

Minimum k-mer coverage is 22

Coverage: 22    Reconstruction: 307
Coverage: 5.48    Reconstruction: 118716
Coverage: 2.45    Reconstruction: 227624
Coverage: 2.24    Reconstruction: 227624

Using a coverage threshold of 2...
The median k-mer coverage is 5
The reconstruction is 227624

The k-mer coverage threshold is 2.24

Setting parameter e (erode) to 2
Setting parameter E (erodeStrand) to 1

Setting parameter c (coverage) to 2.24

Generating adjacency
Added 1897999 edges.
Eroding tips
Eroded 499695 tips.
Eroded 0 tips.

Hash load: 438418 / 2097152 = 0.209 using 42.1 MB

Pruning tips shorter than 1 bp...

Removed 11 marked k-mer.

Pruned 11 k-mer in 11 tips.
Pruning tips shorter than 2 bp...

Removed 16 marked k-mer.

Pruned 16 k-mer in 8 tips.
Pruning tips shorter than 4 bp...

Removed 73 marked k-mer.

Pruned 73 k-mer in 21 tips.
Pruning tips shorter than 8 bp...

Removed 140 marked k-mer.

Pruned 140 k-mer in 23 tips.
Pruning tips shorter than 16 bp...

Removed 278 marked k-mer.

Pruned 278 k-mer in 24 tips.
Pruning tips shorter than 25 bp...

Removed 93 marked k-mer.

Pruned 93 k-mer in 5 tips.
Pruning tips shorter than 25 bp...
Pruned 92 tips in 6 rounds.

Hash load: 437807 / 2097152 = 0.209 using 42.1 MB

Marked 35786 edges of 17755 ambiguous vertices.

Removing low-coverage contigs (mean k-mer coverage < 2.24)

Found 437801 k-mer in 25227 contigs before removing low-coverage contigs.
Removed 231837 k-mer in 9467 low-coverage contigs.
Split 18897 ambigiuous branches.

Hash load: 205970 / 524288 = 0.393 using 41.6 MB

Eroding tips
Eroded 3118 tips.
Eroded 0 tips.

Hash load: 202852 / 524288 = 0.387 using 41.6 MB

Pruning tips shorter than 1 bp...

Removed 9 marked k-mer.

Pruned 9 k-mer in 9 tips.
Pruning tips shorter than 2 bp...

Removed 20 marked k-mer.

Pruned 20 k-mer in 17 tips.
Pruning tips shorter than 4 bp...

Removed 86 marked k-mer.

Pruned 86 k-mer in 42 tips.
Pruning tips shorter than 8 bp...

Removed 245 marked k-mer.

Pruned 245 k-mer in 58 tips.
Pruning tips shorter than 16 bp...

Removed 737 marked k-mer.

Pruned 737 k-mer in 80 tips.
Pruning tips shorter than 25 bp...

Removed 768 marked k-mer.

Pruned 768 k-mer in 53 tips.
Pruning tips shorter than 25 bp...
Pruned 259 tips in 6 rounds.

Hash load: 200987 / 524288 = 0.383 using 41.6 MB

Popping bubbles
Removed 81 bubbles.
Removed 81 bubbles
Marked 525 edges of 258 ambiguous vertices.
Left 6 unassembled k-mer in circular contigs.
Assembled 198539 k-mer in 907 contigs.
Removed 737126 k-mer.

The signal-to-noise ratio (SNR) is -5.64 dB.
AdjList -v -k25 -m50 test-1.fa >test-1.adj
Reading `test-1.fa'...
Finding overlaps of exactly k-1 bp...
V=1814 E=955 E/V=0.526
Degree: █▂▁
        01234
0: 62% 1: 24% 2-4: 14% 5+: 0% max: 3
abyss-filtergraph -v -k25 -g test-2.adj test-1.adj >test-1.path
Loading graph from file: test-1.adj
Graph stats before:
V=1814 E=955 E/V=0.526
Degree: █▂▁
        01234
0: 62% 1: 24% 2-4: 14% 5+: 0% max: 3
Removing shim contigs from the graph...
Pass 1: Checking 57 contigs.
Pass 2: Checking 3 contigs.
Shim removal stats:
Removed: 26 Too Complex: 213 Tails: 617 Too Long: 50 Self Adjacent: 0 Parallel Edges: 0
Graph stats after:
V=1760 E=898 E/V=0.51
Degree: █▂_
        01234
0: 64% 1: 23% 2-4: 13% 5+: 0.057% max: 5
PopBubbles -v -j2 -k25 -p0.9  -g test-3.adj test-1.fa test-2.adj >test-2.path
Reading `test-2.adj'...
V=1760 E=898 E/V=0.51
Degree: █▂_
        01234
0: 64% 1: 23% 2-4: 13% 5+: 0.057% max: 5
Reading `test-1.fa'...
Bubbles: 30 Popped: 21 Scaffolds: 0 Complex: 6 Too long: 0 Too many: 0 Dissimilar: 3
V=1634 E=730 E/V=0.447
Degree: █▁_
        01234
0: 69% 1: 19% 2-4: 11% 5+: 0.061% max: 5
MergeContigs -v -k25 -o test-3.fa test-1.fa test-2.adj test-2.path
Reading `test-2.adj'...
Read 1760 vertices. Using 578 kB of memory.
Reading `test-1.fa'...
Read 880 sequences. Using 848 kB of memory.
Reading `test-2.path'...
Read 34 paths. Using 848 kB of memory.

The minimum coverage of single-end contigs is 2.28.
The minimum coverage of merged contigs is 2.94118.
Consider increasing the coverage threshold parameter, c, to 2.94118.

n    n:200    n:N50    min    N80    N50    N20    max    sum
817    357    97    201    324    535    981    2260    175032    test-3.fa
awk '!/^>/ {x[">" $1]=1; next} {getline s} $1 in x {print $0 "\n" s}' \

        test-2.path test-1.fa >test-indel.fa
ln -sf test-3.fa test-unitigs.fa

abyss-map -v -j2 -l25   test-data/reads1.fastq test-data/reads2.fastq test-3.fa \
        |abyss-fixmate -v -l25  -h test-3.hist \
        |sort -snk3 -k4 \
        |DistanceEst -v -j2 -k25 -l25 -s200 -n10   -o test-3.dist test-3.hist
Reading from standard input...
Reading `test-3.fa'...
Using 442 kB of memory and 541 B/sequence.
Reading `test-3.fa'...

Building the suffix array...
Building the Burrows-Wheeler transform...
Building the character occurrence table...

Read 228 kB in 817 contigs.
Using 2.43 MB of memory and 10.6 B/bp.
Read 0 alignments

Mateless   0
Unaligned  0
Singleton  0
FR         0
RF         0
FF         0
Different  0
Total      0
abyss-fixmate: error: All reads are mateless. This can happen when first and second read IDs do not match.
error: `

test-3.hist': No such file or directory

make: *** [test-3.dist] Error 1
make: *** Deleting file `test-3.dist'

And:

$ abyss-map  -j2 -l25 -v   test-data/reads1.fastq test-data/reads2.fastq test-3.fa |tail
Reading `test-3.fa'...
Using 446 kB of memory and 546 B/sequence.
Reading `test-3.fa'...

Building the suffix array...
Building the Burrows-Wheeler transform...
Building the character occurrence table...

Read 228 kB in 817 contigs.
Using 2.43 MB of memory and 10.7 B/bp.
@SQ    SN:910    LN:279
@SQ    SN:911    LN:734
@SQ    SN:912    LN:455
@SQ    SN:913    LN:471
@SQ    SN:914    LN:405
@SQ    SN:915    LN:820
@SQ    SN:916    LN:509
@SQ    SN:917    LN:395
@SQ    SN:918    LN:415
@SQ    SN:919    LN:833

Thanks,
Stelios

[Anthony Raymond]

Hi Stelios,

In your first output, the ABySS version was reported as 1.5.2. In this latest one the version is 1.3.6. It may be that you have executables from conflicting versions of ABySS in your PATH. If you run `abyss-pe versions`, all of the ABySS versions should be consistent. 

Assuming everything checks out there, I'll need to be able to reproduce this error (but haven't been able to using any servers I have here). Please send me how you installed ABySS, the result of `abyss-pe versions`, your OS/version, and compiler/version.

Thanks,

Tony

[Stelios B]

I am sorry about this. I had forgotten I had two seperate installations. I unistalled the older one and I kept 1.5.2
Sending again the verbose output of 1.5.2

$ ~/shared/abyss/bin/abyss-pe v=-v name=test k=25 in='test-data/reads1.fastq test-data/reads2.fastq'

ABYSS -k25 -q3 -v  --coverage-hist=coverage.hist -s test-bubbles.fa  -o test-1.fa test-data/reads1.fastq test-data/reads2.fastq

ABySS 1.5.2

ABYSS -k25 -q3 -v --coverage-hist=coverage.hist -s test-bubbles.fa -o test-1.fa test-data/reads1.fastq test-data/reads2.fastq
Reading `test-data/reads1.fastq'...
Read 20000 reads. Hash load: 564349 / 1073741824 = 0.000526 using 376 MB
Reading `test-data/reads2.fastq

'...

Read 20000 reads. Hash load: 938113 / 1073741824 = 0.000874 using 388 MB
Loaded 938113 k-mer

Hash load: 938113 / 4194304 = 0.224 using 42.9 MB

Minimum k-mer coverage is 22
Coverage: 22    Reconstruction: 307
Coverage: 5.48    Reconstruction: 118716
Coverage: 2.45    Reconstruction: 227624
Coverage: 2.24    Reconstruction: 227624
Using a coverage threshold of 2...
The median k-mer coverage is 5
The reconstruction is 227624
The k-mer coverage threshold is 2.24
Setting parameter e (erode) to 2
Setting parameter E (erodeStrand) to 1
Setting parameter c (coverage) to 2.24
Generating adjacency
Added 1897999 edges.
Eroding tips
Eroded 499695 tips.
Eroded 0 tips.

Hash load: 438418 / 2097152 = 0.209 using 42.2 MB

Pruning tips shorter than 1 bp...
Removed 11 marked k-mer.
Pruned 11 k-mer in 11 tips.
Pruning tips shorter than 2 bp...
Removed 16 marked k-mer.
Pruned 16 k-mer in 8 tips.
Pruning tips shorter than 4 bp...
Removed 73 marked k-mer.
Pruned 73 k-mer in 21 tips.
Pruning tips shorter than 8 bp...
Removed 140 marked k-mer.
Pruned 140 k-mer in 23 tips.
Pruning tips shorter than 16 bp...
Removed 278 marked k-mer.
Pruned 278 k-mer in 24 tips.
Pruning tips shorter than 25 bp...
Removed 93 marked k-mer.
Pruned 93 k-mer in 5 tips.
Pruning tips shorter than 25 bp...
Pruned 92 tips in 6 rounds.

Hash load: 437807 / 2097152 = 0.209 using 42.2 MB

Marked 35786 edges of 17755 ambiguous vertices.
Removing low-coverage contigs (mean k-mer coverage < 2.24)
Found 437801 k-mer in 25227 contigs before removing low-coverage contigs.
Removed 231837 k-mer in 9467 low-coverage contigs.
Split 18897 ambigiuous branches.

Hash load: 205970 / 524288 = 0.393 using 41.7 MB

Eroding tips
Eroded 3118 tips.
Eroded 0 tips.

Hash load: 202852 / 524288 = 0.387 using 41.7 MB

Pruning tips shorter than 1 bp...
Removed 9 marked k-mer.
Pruned 9 k-mer in 9 tips.
Pruning tips shorter than 2 bp...
Removed 20 marked k-mer.
Pruned 20 k-mer in 17 tips.
Pruning tips shorter than 4 bp...
Removed 86 marked k-mer.
Pruned 86 k-mer in 42 tips.
Pruning tips shorter than 8 bp...
Removed 245 marked k-mer.
Pruned 245 k-mer in 58 tips.
Pruning tips shorter than 16 bp...
Removed 737 marked k-mer.
Pruned 737 k-mer in 80 tips.
Pruning tips shorter than 25 bp...
Removed 768 marked k-mer.
Pruned 768 k-mer in 53 tips.
Pruning tips shorter than 25 bp...
Pruned 259 tips in 6 rounds.

Hash load: 200987 / 524288 = 0.383 using 41.7 MB

...

'...

n    n:200    n:N50    min    N80    N50    N20    E-size    max    sum    name
817    357    97    201    324    535    981    701    2260    175032    test-3.fa
awk '!/^>/ {x[">" $1]=1; next} {getline s} $1 in x {print $0 "\n" s}' \

        test-2.path test-1.fa >test-indel.fa
ln -sf test-3.fa test-unitigs.fa
abyss-map -v -j2 -l25    test-data/reads1.fastq test-data/reads2.fastq test-3.fa \
        |abyss-fixmate -v -l25  -h test-3.hist \
        |sort -snk3 -k4 \
        |DistanceEst -v -j2 -k25 -l25 -s200 -n10   -o test-3.dist test-3.hist

Reading `Reading from standard input...
test-3.fa'...

Using 442 kB of memory and 541 B/sequence.
Reading `test-3.fa'...
Building the suffix array...
Building the Burrows-Wheeler transform...
Building the character occurrence table...
Read 228 kB in 817 contigs.
Using 2.43 MB of memory and 10.6 B/bp.
Read 0 alignments
Mateless   0
Unaligned  0
Singleton  0
FR         0
RF         0
FF         0
Different  0
Total      0
abyss-fixmate: error: All reads are mateless. This can happen when first and second read IDs do not match.
error: `test-3.hist': No such file or directory
make: *** [test-3.dist] Error 1
make: *** Deleting file `test-3.dist'

$ uname -a
Linux steliosb-OptiPlex-330 3.13.0-39-generic #66-Ubuntu SMP Tue Oct 28 13:30:27 UTC 2014 x86_64 x86_64 x86_64 GNU/Linux

$ g++ -v
Using built-in specs.
COLLECT_GCC=g++
COLLECT_LTO_WRAPPER=/usr/lib/gcc/x86_64-linux-gnu/4.8/lto-wrapper
Target: x86_64-linux-gnu
Configured with: ../src/configure -v --with-pkgversion='Ubuntu 4.8.2-19ubuntu1' --with-bugurl=file:///usr/share/doc/gcc-4.8/README.Bugs --enable-languages=c,c++,java,go,d,fortran,objc,obj-c++ --prefix=/usr --program-suffix=-4.8 --enable-shared --enable-linker-build-id --libexecdir=/usr/lib --without-included-gettext --enable-threads=posix --with-gxx-include-dir=/usr/include/c++/4.8 --libdir=/usr/lib --enable-nls --with-sysroot=/ --enable-clocale=gnu --enable-libstdcxx-debug --enable-libstdcxx-time=yes --enable-gnu-unique-object --disable-libmudflap --enable-plugin --with-system-zlib --disable-browser-plugin --enable-java-awt=gtk --enable-gtk-cairo --with-java-home=/usr/lib/jvm/java-1.5.0-gcj-4.8-amd64/jre --enable-java-home --with-jvm-root-dir=/usr/lib/jvm/java-1.5.0-gcj-4.8-amd64 --with-jvm-jar-dir=/usr/lib/jvm-exports/java-1.5.0-gcj-4.8-amd64 --with-arch-directory=amd64 --with-ecj-jar=/usr/share/java/eclipse-ecj.jar --enable-objc-gc --enable-multiarch --disable-werror --with-arch-32=i686 --with-abi=m64 --with-multilib-list=m32,m64,mx32 --with-tune=generic --enable-checking=release --build=x86_64-linux-gnu --host=x86_64-linux-gnu --target=x86_64-linux-gnu
Thread model: posix
gcc version 4.8.2 (Ubuntu 4.8.2-19ubuntu1)

This version was installed using the " Compiling ABySS from source"  steps given in the README file.

...

[Stelios B]

Same error on another machine. I installed abyss, cloning from github, and tested on the test-dataset. I include the exact steps (sparsehash has already been installed in this machine):

git clone https://github.com/bcgsc/abyss
cd abyss
./configure --prefix=/home/chefarov/abyss
make
make install

Everything seems ok

abyss versions:
chefarov@debian:~/programming/rna_seq/data$ abyss-pe versions
\
abyss-pe (ABySS) 1.5.2
\
Written by Shaun Jackman and Anthony Raymond.
\

\
Copyright 2012 Canada's Michael Smith Genome Science Centre
PATH=/home/chefarov/bin/abyss/bin:/home/chefarov/bin/abyss/bin:/home/chefarov/bin:/usr/local/bin:/usr/bin:/bin:/usr/local/games:/usr/games:/sbin/:/usr/sbin/:/home/chefarov/bin/abyss/bin
ABYSS (ABySS) 1.5.2
Written by Jared Simpson, Shaun Jackman and Anthony Raymond.

Copyright 2014 Canada's Michael Smith Genome Sciences Centre

/bin/bash: ABYSS-P: command not found

AdjList (ABySS) 1.5.2
Written by Shaun Jackman.

Copyright 2014 Canada's Michael Smith Genome Sciences Centre

DistanceEst (ABySS) 1.5.2
Written by Jared Simpson and Shaun Jackman.

Copyright 2014 Canada's Michael Smith Genome Sciences Centre

MergeContigs (ABySS) 1.5.2
Written by Shaun Jackman.

Copyright 2014 Canada's Michael Smith Genome Sciences Centre

MergePaths (ABySS) 1.5.2
Written by Jared Simpson and Shaun Jackman.

Copyright 2014 Canada's Michael Smith Genome Sciences Centre

Overlap (ABySS) 1.5.2
Written by Shaun Jackman.

Copyright 2014 Canada's Michael Smith Genome Sciences Centre

PathConsensus (ABySS) 1.5.2
Written by Shaun Jackman and Rong She.

Copyright 2014 Canada's Michael Smith Genome Sciences Centre

PathOverlap (ABySS) 1.5.2
Written by Shaun Jackman and Tony Raymond.

Copyright 2014 Canada's Michael Smith Genome Sciences Centre

PopBubbles (ABySS) 1.5.2
Written by Shaun Jackman.

Copyright 2014 Canada's Michael Smith Genome Sciences Centre

SimpleGraph (ABySS) 1.5.2
Written by Jared Simpson and Shaun Jackman.

Copyright 2014 Canada's Michael Smith Genome Sciences Centre

abyss-fac (ABySS) 1.5.2
Written by Shaun Jackman.

Copyright 2014 Canada's Michael Smith Genome Sciences Centre

abyss-filtergraph (ABySS) 1.5.2
Written by Tony Raymond.

Copyright 2014 Canada's Michael Smith Genome Sciences Centre

abyss-fixmate (ABySS) 1.5.2
Written by Shaun Jackman.

Copyright 2014 Canada's Michael Smith Genome Sciences Centre

abyss-map (ABySS) 1.5.2
Written by Shaun Jackman.

Copyright 2014 Canada's Michael Smith Genome Sciences Centre

abyss-scaffold (ABySS) 1.5.2
Written by Shaun Jackman.

Copyright 2014 Canada's Michael Smith Genome Sciences Centre

abyss-todot (ABySS) 1.5.2
Written by Shaun Jackman.

Copyright 2014 Canada's Michael Smith Genome Sciences Centre

abyss-map (ABySS) 1.5.2
Written by Shaun Jackman.

Copyright 2014 Canada's Michael Smith Genome Sciences Centre

GNU Awk 4.1.1, API: 1.1 (GNU MPFR 3.1.2-p3, GNU MP 6.0.0)
Copyright (C) 1989, 1991-2014 Free Software Foundation.

This program is free software; you can redistribute it and/or modify
it under the terms of the GNU General Public License as published by
the Free Software Foundation; either version 3 of the License, or
(at your option) any later version.

This program is distributed in the hope that it will be useful,
but WITHOUT ANY WARRANTY; without even the implied warranty of
MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the
GNU General Public License for more details.

You should have received a copy of the GNU General Public License
along with this program. If not, see http://www.gnu.org/licenses/.

sort (GNU coreutils) 8.23
Copyright (C) 2014 Free Software Foundation, Inc.
License GPLv3+: GNU GPL version 3 or later <http://gnu.org/licenses/gpl.html>.
This is free software: you are free to change and redistribute it.
There is NO WARRANTY, to the extent permitted by law.

Written by Mike Haertel and Paul Eggert.

/bin/bash: mpirun: command not found
/home/chefarov/bin/abyss/bin/abyss-pe:272: recipe for target 'versions' failed
make: [versions] Error 127 (ignored)



Downloading the test dataset

wget http://www.bcgsc.ca/platform/bioinfo/software/abyss/releases/1.3.4/test-data.tar.gz
tar xzvf test-data.tar.gz



Running with the debug flag

abyss-pe k=25 name=test in='test-data/reads1.fastq test-data/reads2.fastq' v=-v


gives:

chefarov@debian:~/programming/rna_seq/data$ abyss-pe k=25 name=test in='test-data/reads1.fastq test-data/reads2.fastq' v=-v

Read 1760 vertices. Using 586 kB of memory.
Reading `test-1.fa'...
Read 880 sequences. Using 856 kB of memory.
Reading `test-2.path'...
Read 34 paths. Using 856 kB of memory.

The minimum coverage of single-end contigs is 2.28.
The minimum coverage of merged contigs is 2.94118.
Consider increasing the coverage threshold parameter, c, to 2.94118.
n    n:200    n:N50    min    N80    N50    N20    E-size    max    sum    name
817    357    97    201    324    535    981    701    2260    175032    test-3.fa
awk '!/^>/ {x[">" $1]=1; next} {getline s} $1 in x {print $0 "\n" s}' \
    test-2.path test-1.fa >test-indel.fa
ln -sf test-3.fa test-unitigs.fa
abyss-map -v -j2 -l25    test-data/reads1.fastq test-data/reads2.fastq test-3.fa \
    |abyss-fixmate -v -l25  -h test-3.hist \
    |sort -snk3 -k4 \
    |DistanceEst -v -j2 -k25 -l25 -s200 -n10   -o test-3.dist test-3.hist

Reading `test-3.fa'...
Reading from standard input...
Using 451 kB of memory and 551 B/sequence.

Reading `test-3.fa'...
Building the suffix array...
Building the Burrows-Wheeler transform...
Building the character occurrence table...
Read 228 kB in 817 contigs.

Using 2.44 MB of memory and 10.7 B/bp.

Read 0 alignments
Mateless   0
Unaligned  0
Singleton  0
FR         0
RF         0
FF         0
Different  0
Total      0
abyss-fixmate: error: All reads are mateless. This can happen when first and second read IDs do not match.
error: `test-3.hist': No such file or directory

/home/chefarov/bin/abyss/bin/abyss-pe:425: recipe for target 'test-3.dist' failed

make: *** [test-3.dist] Error 1
make: *** Deleting file 'test-3.dist'

And running abyss-map:

chefarov@debian:~/programming/rna_seq/data$ abyss-map  -j2 -l25 -v   test-data/reads1.fastq test-data/reads2.fastq test-3.fa |tail
Reading `test-3.fa'...
Using 451 kB of memory and 551 B/sequence.
Reading `test-3.fa'...

Building the suffix array...
Building the Burrows-Wheeler transform...
Building the character occurrence table...
Read 228 kB in 817 contigs.

Using 2.44 MB of memory and 10.7 B/bp.

@SQ    SN:910    LN:279
@SQ    SN:911    LN:734
@SQ    SN:912    LN:455
@SQ    SN:913    LN:471
@SQ    SN:914    LN:405
@SQ    SN:915    LN:820
@SQ    SN:916    LN:509
@SQ    SN:917    LN:395
@SQ    SN:918    LN:415
@SQ    SN:919    LN:833

System info following:

chefarov@debian:~/programming/rna_seq/data$ uname -a
Linux debian 3.16-2-amd64 #1 SMP Debian 3.16.3-2 (2014-09-20) x86_64 GNU/Linux
chefarov@debian:~/programming/rna_seq/data$ g++ -v
Using built-in specs.
COLLECT_GCC=g++
COLLECT_LTO_WRAPPER=/usr/lib/gcc/x86_64-linux-gnu/4.9/lto-wrapper
Target: x86_64-linux-gnu
Configured with: ../src/configure -v --with-pkgversion='Debian 4.9.2-3' --with-bugurl=file:///usr/share/doc/gcc-4.9/README.Bugs --enable-languages=c,c++,java,go,d,fortran,objc,obj-c++ --prefix=/usr --program-suffix=-4.9 --enable-shared --enable-linker-build-id --libexecdir=/usr/lib --without-included-gettext --enable-threads=posix --with-gxx-include-dir=/usr/include/c++/4.9 --libdir=/usr/lib --enable-nls --with-sysroot=/ --enable-clocale=gnu --enable-libstdcxx-debug --enable-libstdcxx-time=yes --enable-gnu-unique-object --disable-vtable-verify --enable-plugin --with-system-zlib --disable-browser-plugin --enable-java-awt=gtk --enable-gtk-cairo --with-java-home=/usr/lib/jvm/java-1.5.0-gcj-4.9-amd64/jre --enable-java-home --with-jvm-root-dir=/usr/lib/jvm/java-1.5.0-gcj-4.9-amd64 --with-jvm-jar-dir=/usr/lib/jvm-exports/java-1.5.0-gcj-4.9-amd64 --with-arch-directory=amd64 --with-ecj-jar=/usr/share/java/eclipse-ecj.jar --enable-objc-gc --enable-multiarch --with-arch-32=i586 --with-abi=m64 --with-multilib-list=m32,m64,mx32 --enable-multilib --with-tune=generic --enable-checking=release --build=x86_64-linux-gnu --host=x86_64-linux-gnu --target=x86_64-linux-gnu
Thread model: posix
gcc version 4.9.2 (Debian 4.9.2-3)


Any thoughts?
Thanks,
Stelios

    ...

[Stelios B]

I am sorry I missed the formation. Googlegroups list/editor suck. Sending again.

Same error on another machine. I installed abyss, cloning from github, and tested on the test synthetic dataset. I include the exact steps (btw: sparsehash has already been installed in this machine):

Using 451 kB of memory and 551 B/sequence.
Reading

`test-3.fa'...
Reading from standard input...

Building the suffix array...
Building the Burrows-Wheeler transform...
Building the character occurrence table...
Read 228 kB in 817 contigs.
Using 2.44 MB of memory and 10.7 B/bp.
Read 0 alignments
Mateless   0
Unaligned  0
Singleton  0
FR         0
RF         0
FF         0
Different  0
Total      0
abyss-fixmate: error: All reads are mateless. This can happen when first and second read IDs do not match.
error: `

test-3.hist': No such file or directory

/home/chefarov/bin/abyss/bin/abyss-pe:425: recipe for target '

test-3.dist' failed

make: *** [test-3.dist] Error 1
make: *** Deleting file '

test-3.dist'

And Running abyss-map after that gives:

chefarov@debian:~/programming/rna_seq/data$ abyss-map  -j2 -l25 -v   test-data/reads1.fastq test-data/reads2.fastq test-3.fa |tail
Reading `test-3.fa'...
Using 451 kB of memory and 551 B/sequence.
Reading `test-3.fa'...
Building the suffix array...
Building the Burrows-Wheeler transform...
Building the character occurrence table...
Read 228 kB in 817 contigs.
Using 2.44 MB of memory and 10.7 B/bp.
@SQ    SN:910    LN:279
@SQ    SN:911    LN:734
@SQ    SN:912    LN:455
@SQ    SN:913    LN:471
@SQ    SN:914    LN:405
@SQ    SN:915    LN:820
@SQ    SN:916    LN:509
@SQ    SN:917    LN:395
@SQ    SN:918    LN:415
@SQ    SN:919    LN:833

System info following:

chefarov@debian:~/programming/rna_seq/data$ uname -a
Linux debian 3.16-2-amd64 #1 SMP Debian 3.16.3-2 (2014-09-20) x86_64 GNU/Linux
chefarov@debian:~/programming/rna_seq/

data$
chefarov@debian:~/programming/rna_seq/data$
chefarov@debian:~/programming/rna_seq/data$ g++ -v