Re: Installation problem

[Ben Vandervalk]

Hi Riccardo,

Try using the --with-sqlite=<dir> at the 'configure' step (type ./configure --help to see all of the options), where <dir> is the parent directory of the 'include' and 'lib' directories containing sqlite.

Also, when you run the binaries, you should also add the 'lib' directory for sqlite to your LD_LIBRARY_PATH, e.g. 'export LD_LIBRARY_PATH=/home/riccardo/lib'.

It is unfortunate that sqlite3 is a required dependency of ABySS -- it really shouldn't be.  We will fix that in the next release.

- Ben

On Tue, Jun 9, 2015 at 11:58 AM, Riccardo Aiese Cigliano <raiesec...@sequentiabiotech.com> wrote:

Hi,

I am having a problem installing ABySS on CentOS. When I execute the 'make' command I got  the following error:

Making all in DataBase

make[2]: Entering directory `/Shared/002-Software/programs/abyss-1.9.0/DataBase'

g++ -Wall -Wextra -g -O2   -o abyss-db-csv abyss_db_csv-DB.o abyss_db_csv-db-csv.o -lsqlite3 -ldl -lm 

/bin/ld: cannot find -lsqlite3

collect2: error: ld returned 1 exit status

make[2]: *** [abyss-db-csv] Error 1

make[2]: Leaving directory `/Shared/002-Software/programs/abyss-1.9.0/DataBase'

make[1]: *** [all-recursive] Error 1

make[1]: Leaving directory `/Shared/002-Software/programs/abyss-1.9.0'

make: *** [all] Error 2

I have sqlite3 installed and in my path. Any help will be very appreciated.

Thank you

Riccardo

--
You received this message because you are subscribed to the Google Groups "ABySS" group.
To unsubscribe from this group and stop receiving emails from it, send an email to abyss-users...@googlegroups.com.
For more options, visit https://groups.google.com/d/optout.

[Riccardo Aiese Cigliano]

Hi Ben,

thank you for your answer. I executed this command:

./configure --with-sqlite=/home/software/lib/

Now when I get this error:

 

configure: WARNING: boost/functional/hash.hpp: present but cannot be compiled

configure: WARNING: boost/functional/hash.hpp:     check for missing prerequisite headers?

configure: WARNING: boost/functional/hash.hpp: see the Autoconf documentation

configure: WARNING: boost/functional/hash.hpp:     section "Present But Cannot Be Compiled"

configure: WARNING: boost/functional/hash.hpp: proceeding with the compiler's result

configure: WARNING:     ## ----------------------------------- ##

configure: WARNING:     ## Report this to abyss...@bcgsc.ca ##

configure: WARNING:     ## ----------------------------------- ##

 Then when I execute make I get this new error:

 

Uncompress.cpp: In function 'bool uncompress_init()':

Uncompress.cpp:220:9: error: 'HAVE_LIBDL' was not declared in this scope

  return HAVE_LIBDL;

         ^

Uncompress.cpp:221:1: warning: control reaches end of non-void function [-Wreturn-type]

 }

 ^

make[2]: *** [libcommon_a-Uncompress.o] Error 1

make[2]: Leaving directory `/media/sequentia/NAS/software/001-Software/abyss-1.9.0/Common'

make[1]: *** [all-recursive] Error 1

make[1]: Leaving directory `/media/sequentia/NAS/software/001-Software/abyss-1.9.0'

make: *** [all] Error 2 

Could you please help me?

Thank you very much

Riccardo

[Ben Vandervalk]

Hi Riccardo,

Sorry, I'm not sure what the problem is.  Is that the full log output?  If not, could you post the full log output with verbose turned on (add "v=-v" to the abyss-pe command line)? Or you can send the log to me in a private e-mail if you prefer.

To me, that looks like the error message you would get if the first ABYSS command failed and didn't produce an AbyssK21-1.fa file.   But from your message it sounds like it *did* produce AbyssK21-1.fa file, so I'm confused.  Does AbyssK21-1.fa look normal, if you look at the file size and the last few lines (with 'tail')?  You can also check some sequence stats by running 'abyss-fac' on it (e.g. number of sequences, N50).

If abyss-pe got to the point of running the 'AdjList' command it would show that command in the log, so it must be that something that went wrong with the first step (the 'ABYSS' command).  By the way, if you resubmit/rerun the abyss-pe command, it will attempt to pick up where it left off, since it is a Makefile.  It might be worth trying that to see what happens.  Perhaps your problem is due to some distributed file system weirdness.

Also, if you want to see the commands that abyss-pe would be run, without actually running them, you can add '--dry-run' to the abyss-pe command.

- Ben

On Wednesday, June 10, 2015 at 9:46:48 AM UTC-7, Riccardo Aiese Cigliano wrote:

Hi Ben,

finally I managed to install Abyss and then TransAbyss. Unfortunately now I have another problem, I am running some assembly tests and when I execute the command I get this message and then an error:

make: Entering directory `/Synology/002-Projects/084-Cherry/Trimmed_Reads/Transabyss/K21_prova'

ABYSS -k21 -q3 -e2 -E0 -c2   --SS --coverage-hist=coverage.hist -s AbyssK21-bubbles.fa  -o AbyssK21-1.fa  /Synology/002-Projects/084-Cherry/Trimmed_Reads/Transabyss/prova_R1.fastq /Synology/002-Projects/084-Cherry/Trimmed_Reads/Transabyss/prova_R2.fastq

ABySS 1.9.0

ABYSS -k21 -q3 -e2 -E0 -c2 --SS --coverage-hist=coverage.hist -s AbyssK21-bubbles.fa -o AbyssK21-1.fa /Synology/002-Projects/084-Cherry/Trimmed_Reads/Transabyss/prova_R1.fastq /Synology/002-Projects/084-Cherry/Trimmed_Reads/Transabyss/prova_R2.fastq

Reading `/Synology/002-Projects/084-Cherry/Trimmed_Reads/Transabyss/prova_R1.fastq'...

`/Synology/002-Projects/084-Cherry/Trimmed_Reads/Transabyss/prova_R1.fastq': reversed 1000000 reads

`/Synology/002-Projects/084-Cherry/Trimmed_Reads/Transabyss/prova_R1.fastq': discarded 2 reads containing non-ACGT characters

Reading `/Synology/002-Projects/084-Cherry/Trimmed_Reads/Transabyss/prova_R2.fastq'...

`/Synology/002-Projects/084-Cherry/Trimmed_Reads/Transabyss/prova_R2.fastq': discarded 68 reads containing non-ACGT characters

Loaded 47800009 k-mer

Minimum k-mer coverage is 44

Using a coverage threshold of 2...

The median k-mer coverage is 3

The reconstruction is 30231282

The k-mer coverage threshold is 1.73205

Generating adjacency

Added 95526490 edges.

Eroding tips

Eroded 13008220 tips.

Eroded 0 tips.

Pruning tips shorter than 1 bp...

Pruned 1811 k-mer in 1811 tips.

Pruning tips shorter than 2 bp...

Pruned 3280 k-mer in 2118 tips.

Pruning tips shorter than 4 bp...

Pruned 11595 k-mer in 4283 tips.

Pruning tips shorter than 8 bp...

Pruned 41623 k-mer in 8550 tips.

Pruning tips shorter than 16 bp...

Pruned 138839 k-mer in 15622 tips.

Pruning tips shorter than 21 bp...

Pruned 107598 k-mer in 8591 tips.

Pruning tips shorter than 21 bp...

Pruned 5 k-mer in 2 tips.

Pruning tips shorter than 21 bp...

Pruned 40977 tips in 7 rounds.

Marked 714517 edges of 348850 ambiguous vertices.

Removing low-coverage contigs (mean k-mer coverage < 2)

Found 34478236 k-mer in 596193 contigs before removing low-coverage contigs.

Removed 4643987 k-mer in 143655 low-coverage contigs.

Split 258356 ambigiuous branches.

Eroding tips

Eroded 20080 tips.

Eroded 0 tips.

Pruning tips shorter than 1 bp...

Pruned 1470 k-mer in 1470 tips.

Pruning tips shorter than 2 bp...

Pruned 2065 k-mer in 1648 tips.

Pruning tips shorter than 4 bp...

Pruned 5889 k-mer in 2827 tips.

Pruning tips shorter than 8 bp...

Pruned 16319 k-mer in 4224 tips.

Pruning tips shorter than 16 bp...

Pruned 47417 k-mer in 6326 tips.

Pruning tips shorter than 21 bp...

Pruned 42081 k-mer in 3326 tips.

Pruning tips shorter than 21 bp...

Pruned 116 k-mer in 17 tips.

Pruning tips shorter than 21 bp...

Pruned 19838 tips in 7 rounds.

Popping bubbles

Removed 11695 bubbles.

Removed 11695 bubbles

Marked 207407 edges of 99661 ambiguous vertices.

Left 12898 unassembled k-mer in circular contigs.

Assembled 29412231 k-mer in 252740 contigs.

Removed 18092395 k-mer.

The signal-to-noise ratio (SNR) is 2.15372 dB.

make: *** No rule to make target `AbyssK21-1.adj'.  Stop.

make: Leaving directory `/Synology/002-Projects/084-Cherry/Trimmed_Reads/Transabyss/K21_prova'

Elapsed time: 0 h 5 m 42 s

ERROR: CMD ended with status code 2

I understand that the file .adj should be generated by the command AdjList. I tried to to use it separately and it works. 

AdjList -k 21 AbyssK21-1.fa > AbyssK21-1.adj

This try has been done with a small dataset with 1M of pe reads. I started with a full dataset with 35M pe reads and I had the same error.

Could you please help me to solve this problem?

Thank you

Riccardo

--
Dr. Riccardo Aiese Cigliano
Scientific Director and Co-funder

Sequentia Biotech SL
Parc Cientific de Barcelona
Torre R 02A6/A7
c/ Baldiri Reixac 4-8
08028 Barcelona
Cel. +34 633042534
raiesecigliano@sequentiabiotech.com
www.sequentiabiotech.com

This message is intended exclusively for its addressee and may contain information considered CONFIDENTIAL and protected by professional privilege. If you are not the intended recipient you are hereby notified that any dissemination, copy or disclosure of this communication is strictly prohibited by law. If this message has been mistakenly received, please immediately notify us via e-mail and delete it.

[Riccardo Aiese Cigliano]

Dear Ben,

first I would like to thank you for spending your time trying to help me, I really appreciate it! 

This is what I did:

I used 'abyss-fac' on the AbyssK21-1.fa file that was generated and I got these stats:

n       n:200   L50   min     N80     N50     N20     max     sum

252740  50500   16292   200     262     389     625     2358    18.76e6 K21_prova/AbyssK21-1.fa

Then I checked the fasta file with an head:

>0 143 322

CTCTGTTGTTGGCCATATATTGAGTACTCTGTTATAGCCTTAGAGGAACTGCACTGCCTTCTCTCACTCTGTTAGCCAACAATTTAGACCATCTGTTTGTTCAAACAAGGCTAAACTTACAAAATGTGCTATAGCATGTGCTA

>1 274 1050

GTGGAGATCATTGGGAAGAATGCAGTGGTAATAGGGAGAAGCAAGATTGCTGGGTTATCCACTTCTTTGCTCTTGCAGTCCTGGACAGAGGCACCACGCGACGGTTAGCACTCTCCATTCGTTCACCAACAACCCAGAACAAATTACTCGTCGAGCTGATATTGTTGTATCAGATGTTGGCATTCCAAATAGAGTCGGATGCAATTGGCTGATGCCAGGGGCAGTTGTAGTCGACATGGGGACAAATTCAGTTAAGGATCCCAATAGTCCCCGA

And then with a tail:

>252738 44 48

ATGATGGGCGCCTAATAATTTGTGACGAAGCAGAATCGTACAAA

>252739 75 199

TCCAACCGCTACTACGACTTAAAGACCTTGCTCAGCGGGGCAATGACCAACCAGTACACGTGTCTTGATGGGTTT

I am not an expert but I don't see anything strange. Finally I repeated only the  abyss-pe command as follows (with the verbose mode):

abyss-pe k=21 name=K21_prova lib=pe in='prova_R1.fastq prova_R2.fastq' e=2 E=0 c=2 SS=--SS j=16 v=-v

I attached the full log file. Again I have an error but the message is different, now it says "make: *** [pe-3.dist] Error 1". I don't know if it related to the error that was printed with the transabyss command. Anyway, again the fasta and the bubble.fa file have been created.

I also tried to create the .adj file separately and then re-run the transabyss command and I got this message:

make: Entering directory `/Synology/002-Projects/084-Cherry/Trimmed_Reads/Transabyss/K21_prova'

make: `AbyssK21-1.fa' is up to date.

make: Nothing to be done for `AbyssK21-1.adj'.

make: Leaving directory `/Synology/002-Projects/084-Cherry/Trimmed_Reads/Transabyss/K21_prova'

CHECKPOINT: De Bruijn graph assembly completed.

=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-

Assembly stopped at stage 'dbg'

Total wallclock run time: 0 h 0 m 0 s

Traceback (most recent call last):

  File "/Shared/002-Software/programs/transabyss-1.5.3/transabyss", line 748, in <module>

    __main__()

  File "/Shared/002-Software/programs/transabyss-1.5.3/transabyss", line 553, in __main__

    if perform_pe_assembly and not has_edges(adj3):

  File "/Shared/002-Software/programs/transabyss-1.5.3/utilities/adj_utils.py", line 1017, in has_edges

    with open(adj_file, 'r') as fh:

IOError: [Errno 2] No such file or directory: '/Synology/002-Projects/084-Cherry/Trimmed_Reads/Transabyss/K21_prova/AbyssK21-3.adj'

Then I tried to perform the ''unitigs'' step but I had another error, but I don't want to overflow you with too many things, if you think that it might be useful I can also send you the error I got from the "unitigs" step

Thank you and have a nice day
Riccardo

Il giorno mercoledì 10 giugno 2015 19:23:46 UTC+2, Ben Vandervalk ha scritto:

Hi Riccardo,

raiesec...@sequentiabiotech.com

www.sequentiabiotech.com

This message is intended exclusively for its addressee and may contain information considered CONFIDENTIAL and protected by professional privilege. If you are not the intended recipient you are hereby notified that any dissemination, copy or disclosure of this communication is strictly prohibited by law. If this message has been mistakenly received, please immediately notify us via e-mail and delete it.

[Ben Vandervalk]

Hi Riccardo,

Yep, I agree, the FASTA file looks fine.

I noticed the following line in your log file:

         /bin/bash: line 1: abyss-fixmate: command not found

This is the reason that your assembly failed on the second attempt.

There must have been some problem during compilation/installation or with the setup of your PATH variable for your assembly job.  I assume you are installing ABySS from source?  If so, the normal procedure is:

$ ./configure --prefix=<abyss_install_dir>

$ make

$ make install

Where <abyss_install_dir> is a directory that exists and that you have write access to  (e.g. /home/riccardo/abyss-1.9.0).

Then a directory called <abyss_install_dir>/bin will be created which should have *all* of the ABySS binaries.

When you run your assembly job, you need to add this directory to your PATH, i.e.:

          export PATH=<abyss_install_dir>/bin:$PATH

- Ben

[Ben Vandervalk]

Hi Riccardo,

For some reason, the test-1.adj error you are reporting doesn't match the log file.

In the log, it looks like there is something funny with your input reads.  You are loading two 100MB files and yet the assembly is reporting that it is only loading 6361 distinct k-mers:

"Loaded 6361 k-mer"

In the contig stage (where DistanceEst is run), ABySS forms links the assembled sequences by aligning the paired-end reads.  It looks like DistanceEst is failing because there aren't any read pairs that align across different sequences:

"Different      0"

I also noticed that the assembly up to that stage only has two contigs:

"Read 1.67 kB in 2 contigs."

Does that make sense for you dataset?  It sounds to me like their is something fishy with your input files, like you have the same sequence repeated over and over.

- Ben

On Fri, Jun 12, 2015 at 3:41 AM, Riccardo Aiese Cigliano <raiesec...@sequentiabiotech.com> wrote:

Hi Ben,

I made a new installation of Abyss and Transabyss and I started over using the test dataset that is in the installation folder of Transabyss. So first I ran the the assembly.sh script that produced again the error:

make: *** No rule to make target `test-1.adj'.  Stop.

make: Leaving directory `/Shared/002-Software/programs/transabyss-1.5.3/sample_dataset/test/assembly'

ERROR: CMD ended with status code 2

I executed the abyss-pe command: abyss-pe k=32 in='reads/rnaseq_1.fq.gz reads/rnaseq_2.fq.gz' name=test v=-v and I got this log:

ABYSS -k32 -q3 -v   --coverage-hist=coverage.hist -s test-bubbles.fa  -o test-1.fa reads/rnaseq_1.fq.gz reads/rnaseq_2.fq.gz 

ABySS 1.9.0

ABYSS -k32 -q3 -v --coverage-hist=coverage.hist -s test-bubbles.fa -o test-1.fa reads/rnaseq_1.fq.gz reads/rnaseq_2.fq.gz

Reading `reads/rnaseq_1.fq.gz'...

Read 10000 reads. Hash load: 5006 / 1073741824 = 4.66e-06 using 359 MB

Reading `reads/rnaseq_2.fq.gz'...

Read 10000 reads. Hash load: 6361 / 1073741824 = 5.92e-06 using 359 MB

Loaded 6361 k-mer

Hash load: 6361 / 16384 = 0.388 using 852 kB

Minimum k-mer coverage is 5

Coverage: 5 Reconstruction: 3563

Coverage: 14.8 Reconstruction: 3499

Coverage: 14.8 Reconstruction: 3499

Using a coverage threshold of 15...

The median k-mer coverage is 219

The reconstruction is 3499

The k-mer coverage threshold is 14.8

Setting parameter e (erode) to 15

Setting parameter E (erodeStrand) to 1

Setting parameter c (coverage) to 14.8

Generating adjacency

Added 12766 edges.

Eroding tips

Eroded 4295 tips.

Eroded 0 tips.

Hash load: 2066 / 8192 = 0.252 using 918 kB

Pruning tips shorter than 1 bp...

Pruning tips shorter than 2 bp...

Pruning tips shorter than 4 bp...

Pruning tips shorter than 8 bp...

Pruning tips shorter than 16 bp...

Removed 11 marked k-mer.

Pruned 11 k-mer in 2 tips.

Pruning tips shorter than 32 bp...

Pruned 2 tips in 5 rounds.

Hash load: 2055 / 8192 = 0.251 using 918 kB

Marked 60 edges of 30 ambiguous vertices.

Removing low-coverage contigs (mean k-mer coverage < 14.8)

Found 2055 k-mer in 47 contigs before removing low-coverage contigs.

Removed 416 k-mer in 13 low-coverage contigs.

Split 26 ambigiuous branches.

Hash load: 1639 / 8192 = 0.2 using 918 kB

Eroding tips

Eroded 0 tips.

Eroded 0 tips.

Hash load: 1639 / 8192 = 0.2 using 918 kB

Pruning tips shorter than 1 bp...

Pruning tips shorter than 2 bp...

Pruning tips shorter than 4 bp...

Pruning tips shorter than 8 bp...

Pruning tips shorter than 16 bp...

Pruning tips shorter than 32 bp...

Pruned 0 tips in 5 rounds.

Hash load: 1639 / 8192 = 0.2 using 918 kB

Popping bubbles

Removed 2 bubbles.

Removed 2 bubbles

Marked 0 edges of 0 ambiguous vertices.

Assembled 1575 k-mer in 2 contigs.

Removed 4722 k-mer.

The signal-to-noise ratio (SNR) is -4.6 dB.

AdjList -v   -k32 -m50 --dot test-1.fa >test-1.dot

Reading `test-1.fa'...

Finding overlaps of exactly k-1 bp...

V=4 E=0 E/V=0

Degree:  ▇

        01234

0: 1e+02% 1: 0% 2-4: 0% 5+: 0% max: 0

abyss-filtergraph -v --dot   -k32 -g test-2.dot1 test-1.dot test-1.fa >test-1.path

Loading graph from file: test-1.dot

Graph stats before:

V=4 E=0 E/V=0

Degree:  ▇

        01234

0: 1e+02% 1: 0% 2-4: 0% 5+: 0% max: 0

Removing shim contigs from the graph...

Shim removal stats:

Removed: 0 Too Complex: 0 Tails: 2 Too Long: 0 Self Adjacent: 0 Parallel Edges: 0

Reading `test-1.fa'...

Edge removal stats:

Removed: 0

Graph stats after:

V=4 E=0 E/V=0

Degree:  ▇

        01234

0: 1e+02% 1: 0% 2-4: 0% 5+: 0% max: 0

MergeContigs -v  -k32 -g test-2.dot -o test-2.fa test-1.fa test-2.dot1 test-1.path

Reading `test-2.dot1'...

Read 4 vertices. Using 446 kB of memory.

Reading `test-1.fa'...

Read 2 sequences. Using 446 kB of memory.

Reading `test-1.path'...

Read 0 paths. Using 446 kB of memory.

Writing `test-2.dot'...

V=4 E=0 E/V=0

Degree:  ▇

        01234

0: 1e+02% 1: 0% 2-4: 0% 5+: 0% max: 0

PopBubbles -v --dot -j2 -k32  -p0.9  -g test-3.dot test-2.fa test-2.dot >test-2.path

Reading `test-2.dot'...

V=4 E=0 E/V=0

Degree:  ▇

        01234

0: 1e+02% 1: 0% 2-4: 0% 5+: 0% max: 0

Reading `test-2.fa'...

Bubbles: 0 Popped: 0 Scaffolds: 0 Complex: 0 Too long: 0 Too many: 0 Dissimilar: 0

V=4 E=0 E/V=0

Degree:  ▇

        01234

0: 1e+02% 1: 0% 2-4: 0% 5+: 0% max: 0

MergeContigs -v  -k32 -o test-3.fa test-2.fa test-2.dot test-2.path

Reading `test-2.dot'...

Read 4 vertices. Using 446 kB of memory.

Reading `test-2.fa'...

Read 2 sequences. Using 446 kB of memory.

Reading `test-2.path'...

Read 0 paths. Using 446 kB of memory.

awk '!/^>/ {x[">" $1]=1; next} {getline s} $1 in x {print $0 "\n" s}' \

test-2.path test-1.fa >test-indel.fa

ln -sf test-3.fa test-unitigs.fa

abyss-map -v  -j2 -l32    reads/rnaseq_1.fq.gz reads/rnaseq_2.fq.gz test-3.fa \

|abyss-fixmate -v  -l32  -h test-3.hist \

|sort -snk3 -k4 \

|DistanceEst -v  -j2 -k32 -l32 -s200 -n10   -o test-3.dist test-3.hist

Reading `test-3.fa'...

Using 442 kB of memory and 2.21e+05 B/sequence.

Reading `test-3.fa'...

Building the suffix array...

Building the Burrows-Wheeler transform...

Building the character occurrence table...

Read 1.67 kB in 2 contigs.

Using 442 kB of memory and 265 B/bp.

Reading from standard input...

Mapped 11384 of 20000 reads (56.9%)

Mapped 11374 of 20000 reads uniquely (56.9%)

Read 20000 alignments

Mateless       0

Unaligned   1965  19.6%

Singleton   4686  46.9%

FR          3349  33.5%

RF             0

FF             0

Different      0

Total      10000

FR Stats mean: 495.6 median: 495 sd: 48.7 n: 3325 min: 353 max: 642 ignored: 24

          _▁_▁▁▁▂▂▂▃▄▃▄▄▆▇▅▆▇█▆█████▇████▇▇▆▅▅▆▅▄▃▄▂▃▂▂▂▁▁_ ▁ __

Mate orientation FR: 3349 (100%) RF: 0 (0%)

The library test-3.hist is oriented forward-reverse (FR).

Stats mean: 495.6 median: 495 sd: 48.7 n: 3325 min: 353 max: 642

          _▁_▁▁▁▂▂▂▃▄▃▄▄▆▇▅▆▇█▆█████▇████▇▇▆▅▅▆▅▄▃▄▂▃▂▂▂▁▁_ ▁ __

Minimum and maximum distance are set to -31 and 642 bp.

DistanceEst: DistanceEst.cpp:619: int main(int, char**): Assertion `in' failed.

/bin/bash: line 3: 100465 Done                    abyss-map -v -j2 -l32 reads/rnaseq_1.fq.gz reads/rnaseq_2.fq.gz test-3.fa

     100466                       | abyss-fixmate -v -l32 -h test-3.hist

     100467                       | sort -snk3 -k4

     100468 Aborted                 | DistanceEst -v -j2 -k32 -l32 -s200 -n10 -o test-3.dist test-3.hist

make: *** [test-3.dist] Error 134

make: *** Deleting file `test-3.dist'

The abyss-fix problem has disappeared, so I suppose that now the installation was ok and the error seems to be related to the DistanceEst command.

Thank you again

Riccardo

--
Dr. Riccardo Aiese Cigliano
Scientific Director and Co-funder

Sequentia Biotech SL
Parc Cientific de Barcelona
Torre R 02A6/A7
c/ Baldiri Reixac 4-8
08028 Barcelona
Cel. +34 633042534
raiesec...@sequentiabiotech.com
www.sequentiabiotech.com

This message is intended exclusively for its addressee and may contain information considered CONFIDENTIAL and protected by professional privilege. If you are not the intended recipient you are hereby notified that any dissemination, copy or disclosure of this communication is strictly prohibited by law. If this message has been mistakenly received, please immediately notify us via e-mail and delete it.

[Riccardo Aiese Cigliano]

Hi Ben,

I am sorry but I am confused. I executed the assemble.sh script that is in the sample_dataset directory of TransAbyss. Why the log is not matching?

Thank you and best regards

Riccardo

--
Dr. Riccardo Aiese Cigliano
Scientific Director and Co-funder

Sequentia Biotech SL
Parc Cientific de Barcelona
Torre R 02A6/A7
c/ Baldiri Reixac 4-8
08028 Barcelona
Cel. +34 633042534
raiesec...@sequentiabiotech.com
www.sequentiabiotech.com

This message is intended exclusively for its addressee and may contain information considered CONFIDENTIAL and protected by professional privilege. If you are not the intended recipient you are hereby notified that any dissemination, copy or disclosure of this communication is strictly prohibited by law. If this message has been mistakenly received, please immediately notify us via e-mail and delete it.

[Andres Espindola]

Hi Ricardo and Ben,

[abyss 1.9.0]

I'm having the same problem with sqlite3. I did the ./config with-sqlite=/usr/bin but got the same errors you got.  

Could you post what was your solution please?

Thank you

Andres

[Amol Ghodke]

hi Riccardo, 

I am having same problem with Abyss installation with error "‘HAVE_LIBDL’ was not declared in this scope". 

I ran following configure command 

./configure --prefix=/home/amol/volume/software/abyss-1.9.0 --without-sparsehash --with-sqlite=/usr/lib64/python2.7/sqlite3

then 

make 

now I am getting this error - 

ho './'`Uncompress.cpp

Uncompress.cpp: In function ‘bool uncompress_init()’:

Uncompress.cpp:220:9: error: ‘HAVE_LIBDL’ was not declared in this scope

  return HAVE_LIBDL;

         ^

Uncompress.cpp:221:1: warning: control reaches end of non-void function [-Wreturn-type]

 }

 ^

make[2]: *** [libcommon_a-Uncompress.o] Error 1

make[2]: Leaving directory `/volume/data/software/abyss-1.9.0/Common'

make[1]: *** [all-recursive] Error 1

make[1]: Leaving directory `/volume/data/software/abyss-1.9.0'

make: *** [all] Error 2

can you please help me with this 

[Ben Vandervalk]

Hi Ricardo/Amol/Andres,

I have removed the sqlite3 dependency in the latest revision of ABySS on github.  Please see: https://github.com/bcgsc/abyss/issues/86

- Ben