Input file issue

[Judy Malas]

Hello, 

I am trying to run Trinity with the following command 

$TRINITY_HOME/Trinity --seqType fq --left reads.ALL.left.fq --right reads.ALL.right.fq --SS_lib_type RF --CPU 6 --max_memory 20G

And I am getting the error below. I know my input files are not corrupt, because I can run fastqc on them before and after running Trimmomatic. I am using the Paired output files from Trimmomatic for the Trinity input.

Error encountered just after sequence entry[8756939]: A00419:611:HNYJ5DSX3:1:2258:16758:16423, quals and seq lines dont match in length:

... corrupt file?Thread 2 terminated abnormally: Error, cmd: seqtk-trinity seq -A -R 2  /mnt/store1/home/jmalas2/titan-data/RNA-seq/RNAseq220525_Rush/shewanella_RNA_seq/RawReads/trimmedReads/reads.ALL.right.fq >> right.fa died with ret 768 at /software/linux-el7-x86_64-legacy/EasyBuild/software/Trinity/2.10.0-foss-2019b-Python-3.7.4/trinityrnaseq-v2.10.0/util/insilico_read_normalization.pl line 793.
CMD finished (1236 seconds)
Error, conversion thread failed at /software/linux-el7-x86_64-legacy/EasyBuild/software/Trinity/2.10.0-foss-2019b-Python-3.7.4/trinityrnaseq-v2.10.0/util/insilico_read_normalization.pl line 336.
Error, cmd: /software/linux-el7-x86_64-legacy/EasyBuild/software/Trinity/2.10.0-foss-2019b-Python-3.7.4/trinityrnaseq-v2.10.0/util/insilico_read_normalization.pl --seqType fq --JM 20G  --max_cov 200 --min_cov 1 --CPU 6 --output /mnt/store1/home/jmalas2/titan-data/RNA-seq/RNAseq220525_Rush/shewanella_RNA_seq/RawReads/trimmedReads/trinity_out_dir/insilico_read_normalization --max_CV 10000  --SS_lib_type RF  --left /mnt/store1/home/jmalas2/titan-data/RNA-seq/RNAseq220525_Rush/shewanella_RNA_seq/RawReads/trimmedReads/reads.ALL.left.fq --right /mnt/store1/home/jmalas2/titan-data/RNA-seq/RNAseq220525_Rush/shewanella_RNA_seq/RawReads/trimmedReads/reads.ALL.right.fq --pairs_together --PARALLEL_STATS   died with ret 7424 at /software/linux-el7-x86_64-legacy/EasyBuild/software/Trinity/2.10.0-foss-2019b-Python-3.7.4/trinityrnaseq-v2.10.0/Trinity line 2805.
 ----

I wonder if this error is due to the fact that my input files do not include a /1 or /2 suffix to indicate the left or right end of the sequenced fragment. For example, this is the first line of one of my forward reads; is there a way to add the suffix needed? If that is indeed an issue. 

@A00419:611:HNYJ5DSX3:1:1101:4508:1000 1:N:0:CGATTATCAT+ATCAACTCGT
CNGCGGACGGGTGAGTAATGCCTAGGGATCTGCCCAGTCGAGGGGGATAACAGTTGGAAACGACTGCTAATACCGCATACGCCCTACGGGGGAAAGAGGGGGACTTTCGGGCCT
CTCGCGATTGGATGAACCTAGGTGGGATTAGCTAGTT

Thanks-

Judy

[Brian Haas]

Hi Judy,

It sounds like the fastq file(s) might have some corruption.  Try running fastqc on them and see if that goes ok.

best,

~b

--
You received this message because you are subscribed to the Google Groups "trinityrnaseq-users" group.
To unsubscribe from this group and stop receiving emails from it, send an email to trinityrnaseq-u...@googlegroups.com.
To view this discussion on the web visit https://groups.google.com/d/msgid/trinityrnaseq-users/09467f7d-4636-49d3-8e3d-16690bc1a263n%40googlegroups.com.

--

--
Brian J. Haas
The Broad Institute
http://broadinstitute.org/~bhaas

 

[Judy Malas]

Quick update in case anyone has this issue again. It worked if I use raw reads as input and just use the —trimmomatic flag to trim the reads. Not sure why this is the case, because the same input files and settings were used for the commands run separately. This might be resolved on the updated release, but I didn’t get the chance to try that yet.

$TRINITY_HOME/Trinity --seqType fq --left GMCF-1049-DMD-1_S1_L001_R1_001.fastq.gz --right GMCF-1049-DMD-1_S1_L001_R2_001.fastq.gz --SS_lib_type FR --CPU 16 --max_memory 20G --trimmomatic --quality_trimming_params "ILLUMINACLIP:/$EBROOTTRIMMOMATIC/adapters/TruSeq3-PE.fa:2:40:15:1:True LEADING:3 TRAILING:3 MINLEN:36 HEADCROP:10"

Thanks- 

Judy

On Sep 22, 2022, at 8:32 AM, Brian Haas <bh...@broadinstitute.org> wrote:

Interesting.  I'm not sure why it's complaining about the seq and qual lines not matching up in length.  We have made some changes since the release you're using.  

Can you try the current release and see how that goes?

https://github.com/trinityrnaseq/trinityrnaseq/releases/tag/Trinity-v2.14.0

best,

~brian

On Thu, Sep 22, 2022 at 7:46 AM Judy Malas <jma...@uic.edu> wrote:

Hi Brian, 

Thanks for getting back to me. I did run fastqc and they worked out okay. 

What else could be the issue?

-Judy