Error running TransDecoder

163 views

Skip to first unread message

Fairlie Reese

unread,

Mar 13, 2019, 11:26:19 PM3/13/19

to TransDecoder-users

Hi,

I'm having issues running TransDecoder. I'm using a script that I've successfully run before with a different input file.

I looked up the first error on this group and saw that the solution was to run LongOrfs with --no_refine_starts, and I still get this same error output. Any other ideas?

Thanks,

Fairlie

Error, len(target_sequence)=33 and pwm length = 0 at /data/apps/user_contributed_software/freese/TransDecoder/5.5.0/util/PWM/../../PerlLib/PWM.pm line 337

PWM::score_plus_minus_pwm('PWM=HASH(0x1c9e670)', 'GCCACCCGCTAGGAGGGAAGATGAAGGAGATTT', 'PWM=HASH(0x1ca8be0)', 'pwm_range', 'ARRAY(0x1c9e760)') called at /data/apps/user_contributed_software/freese/TransDecoder/5.5.0/util/PWM/feature_scoring.+-.pl line 208

main::score_features('ARRAY(0x1c8a8f8)', 'PWM=HASH(0x1c9e670)', 'PWM=HASH(0x1ca8be0)', 'ARRAY(0x1a6faa0)', 'pos') called at /data/apps/user_contributed_software/freese/TransDecoder/5.5.0/util/PWM/feature_scoring.+-.pl line 112

Error, cmd: /data/apps/user_contributed_software/freese/TransDecoder/5.5.0/util/PWM/feature_scoring.+-.pl --features_plus HepG2_filtered_talon.fasta.transdecoder_dir/start_refinement.enhanced.+.features --features_minus HepG2_filtered_talon.fasta.transdecoder_dir/start_refinement.-.features --atg_position 20 > HepG2_filtered_talon.fasta.transdecoder_dir/start_refinement.enhanced.feature.scores died with ret 65280 No such file or directory at /data/apps/user_contributed_software/freese/TransDecoder/5.5.0/util/../PerlLib/Pipeliner.pm line 185

Pipeliner::run('Pipeliner=HASH(0x1ff5788)') called at /data/apps/user_contributed_software/freese/TransDecoder/5.5.0/util/train_start_PWM.pl line 141

Error, cmd: /data/apps/user_contributed_software/freese/TransDecoder/5.5.0/util/train_start_PWM.pl --transcripts /data/users/freese/mortazavi_lab/data/190313_HepG2/HepG2_filtered_talon.fasta --selected_orfs HepG2_filtered_talon.fasta.transdecoder_dir/longest_orfs.cds.top_500_longest --out_prefix HepG2_filtered_talon.fasta.transdecoder_dir/start_refinement died with ret 512 No such file or directory at /data/apps/user_contributed_software/freese/TransDecoder/5.5.0/PerlLib/Pipeliner.pm line 185

Pipeliner::run('Pipeliner=HASH(0x1a3f2b0)') called at /data/apps/user_contributed_software/freese/TransDecoder/5.5.0/TransDecoder.Predict line 379

Brian Haas

unread,

Mar 14, 2019, 9:20:36 AM3/14/19

to Fairlie Reese, TransDecoder-users

Hi,

I think it's the predict stage that needs the --no_refine_starts option.

--
You received this message because you are subscribed to the Google Groups "TransDecoder-users" group.
To unsubscribe from this group and stop receiving emails from it, send an email to transdecoder-us...@googlegroups.com.
To post to this group, send email to transdeco...@googlegroups.com.
To view this discussion on the web visit https://groups.google.com/d/msgid/transdecoder-users/16a494f2-c6e3-4094-8031-5e1fd30579ec%40googlegroups.com.
For more options, visit https://groups.google.com/d/optout.

--
Brian J. Haas
The Broad Institute
http://broadinstitute.org/~bhaas

Fairlie Reese

unread,

Mar 14, 2019, 5:18:30 PM3/14/19

to TransDecoder-users

Oh, thank you. I was looking at the wrong set of documentation for the input arguments. I was able to get it running!

On Thursday, March 14, 2019 at 6:20:36 AM UTC-7, Brian Haas wrote:

Hi,

I think it's the predict stage that needs the --no_refine_starts option.

On Wed, Mar 13, 2019 at 11:26 PM Fairlie Reese <fairli...@gmail.com> wrote:

Hi,

I'm having issues running TransDecoder. I'm using a script that I've successfully run before with a different input file.

I looked up the first error on this group and saw that the solution was to run LongOrfs with --no_refine_starts, and I still get this same error output. Any other ideas?
Thanks,
Fairlie

Error, len(target_sequence)=33 and pwm length = 0 at /data/apps/user_contributed_software/freese/TransDecoder/5.5.0/util/PWM/../../PerlLib/PWM.pm line 337

PWM::score_plus_minus_pwm('PWM=HASH(0x1c9e670)', 'GCCACCCGCTAGGAGGGAAGATGAAGGAGATTT', 'PWM=HASH(0x1ca8be0)', 'pwm_range', 'ARRAY(0x1c9e760)') called at /data/apps/user_contributed_software/freese/TransDecoder/5.5.0/util/PWM/feature_scoring.+-.pl line 208

main::score_features('ARRAY(0x1c8a8f8)', 'PWM=HASH(0x1c9e670)', 'PWM=HASH(0x1ca8be0)', 'ARRAY(0x1a6faa0)', 'pos') called at /data/apps/user_contributed_software/freese/TransDecoder/5.5.0/util/PWM/feature_scoring.+-.pl line 112

Error, cmd: /data/apps/user_contributed_software/freese/TransDecoder/5.5.0/util/PWM/feature_scoring.+-.pl --features_plus HepG2_filtered_talon.fasta.transdecoder_dir/start_refinement.enhanced.+.features --features_minus HepG2_filtered_talon.fasta.transdecoder_dir/start_refinement.-.features --atg_position 20 > HepG2_filtered_talon.fasta.transdecoder_dir/start_refinement.enhanced.feature.scores died with ret 65280 No such file or directory at /data/apps/user_contributed_software/freese/TransDecoder/5.5.0/util/../PerlLib/Pipeliner.pm line 185

Pipeliner::run('Pipeliner=HASH(0x1ff5788)') called at /data/apps/user_contributed_software/freese/TransDecoder/5.5.0/util/train_start_PWM.pl line 141

Error, cmd: /data/apps/user_contributed_software/freese/TransDecoder/5.5.0/util/train_start_PWM.pl --transcripts /data/users/freese/mortazavi_lab/data/190313_HepG2/HepG2_filtered_talon.fasta --selected_orfs HepG2_filtered_talon.fasta.transdecoder_dir/longest_orfs.cds.top_500_longest --out_prefix HepG2_filtered_talon.fasta.transdecoder_dir/start_refinement died with ret 512 No such file or directory at /data/apps/user_contributed_software/freese/TransDecoder/5.5.0/PerlLib/Pipeliner.pm line 185

Pipeliner::run('Pipeliner=HASH(0x1a3f2b0)') called at /data/apps/user_contributed_software/freese/TransDecoder/5.5.0/TransDecoder.Predict line 379

--
You received this message because you are subscribed to the Google Groups "TransDecoder-users" group.

To unsubscribe from this group and stop receiving emails from it, send an email to transdecoder-users+unsub...@googlegroups.com.

To post to this group, send email to transdeco...@googlegroups.com.
To view this discussion on the web visit https://groups.google.com/d/msgid/transdecoder-users/16a494f2-c6e3-4094-8031-5e1fd30579ec%40googlegroups.com.
For more options, visit https://groups.google.com/d/optout.

Brian Haas

unread,

Mar 14, 2019, 5:26:09 PM3/14/19

to Fairlie Reese, TransDecoder-users

Great! Glad it's running now

-via googleFi

On Thu, Mar 14, 2019, 5:18 PM Fairlie Reese <fairli...@gmail.com> wrote:

Oh, thank you. I was looking at the wrong set of documentation for the input arguments. I was able to get it running!

On Thursday, March 14, 2019 at 6:20:36 AM UTC-7, Brian Haas wrote:

Hi,

I think it's the predict stage that needs the --no_refine_starts option.

On Wed, Mar 13, 2019 at 11:26 PM Fairlie Reese <fairli...@gmail.com> wrote:

Hi,

I'm having issues running TransDecoder. I'm using a script that I've successfully run before with a different input file.

I looked up the first error on this group and saw that the solution was to run LongOrfs with --no_refine_starts, and I still get this same error output. Any other ideas?
Thanks,
Fairlie

Error, len(target_sequence)=33 and pwm length = 0 at /data/apps/user_contributed_software/freese/TransDecoder/5.5.0/util/PWM/../../PerlLib/PWM.pm line 337

PWM::score_plus_minus_pwm('PWM=HASH(0x1c9e670)', 'GCCACCCGCTAGGAGGGAAGATGAAGGAGATTT', 'PWM=HASH(0x1ca8be0)', 'pwm_range', 'ARRAY(0x1c9e760)') called at /data/apps/user_contributed_software/freese/TransDecoder/5.5.0/util/PWM/feature_scoring.+-.pl line 208

main::score_features('ARRAY(0x1c8a8f8)', 'PWM=HASH(0x1c9e670)', 'PWM=HASH(0x1ca8be0)', 'ARRAY(0x1a6faa0)', 'pos') called at /data/apps/user_contributed_software/freese/TransDecoder/5.5.0/util/PWM/feature_scoring.+-.pl line 112

Error, cmd: /data/apps/user_contributed_software/freese/TransDecoder/5.5.0/util/PWM/feature_scoring.+-.pl --features_plus HepG2_filtered_talon.fasta.transdecoder_dir/start_refinement.enhanced.+.features --features_minus HepG2_filtered_talon.fasta.transdecoder_dir/start_refinement.-.features --atg_position 20 > HepG2_filtered_talon.fasta.transdecoder_dir/start_refinement.enhanced.feature.scores died with ret 65280 No such file or directory at /data/apps/user_contributed_software/freese/TransDecoder/5.5.0/util/../PerlLib/Pipeliner.pm line 185

Pipeliner::run('Pipeliner=HASH(0x1ff5788)') called at /data/apps/user_contributed_software/freese/TransDecoder/5.5.0/util/train_start_PWM.pl line 141

Error, cmd: /data/apps/user_contributed_software/freese/TransDecoder/5.5.0/util/train_start_PWM.pl --transcripts /data/users/freese/mortazavi_lab/data/190313_HepG2/HepG2_filtered_talon.fasta --selected_orfs HepG2_filtered_talon.fasta.transdecoder_dir/longest_orfs.cds.top_500_longest --out_prefix HepG2_filtered_talon.fasta.transdecoder_dir/start_refinement died with ret 512 No such file or directory at /data/apps/user_contributed_software/freese/TransDecoder/5.5.0/PerlLib/Pipeliner.pm line 185

Pipeliner::run('Pipeliner=HASH(0x1a3f2b0)') called at /data/apps/user_contributed_software/freese/TransDecoder/5.5.0/TransDecoder.Predict line 379

--
You received this message because you are subscribed to the Google Groups "TransDecoder-users" group.

To unsubscribe from this group and stop receiving emails from it, send an email to transdecoder-us...@googlegroups.com.

To post to this group, send email to transdeco...@googlegroups.com.
To view this discussion on the web visit https://groups.google.com/d/msgid/transdecoder-users/16a494f2-c6e3-4094-8031-5e1fd30579ec%40googlegroups.com.
For more options, visit https://groups.google.com/d/optout.

--
--
Brian J. Haas
The Broad Institute
http://broadinstitute.org/~bhaas

--

You received this message because you are subscribed to the Google Groups "TransDecoder-users" group.

To unsubscribe from this group and stop receiving emails from it, send an email to transdecoder-us...@googlegroups.com.

To post to this group, send email to transdeco...@googlegroups.com.

To view this discussion on the web visit https://groups.google.com/d/msgid/transdecoder-users/5899ff0c-4283-433a-9527-06cab8bb90cd%40googlegroups.com.

Reply all

Reply to author

Forward

0 new messages