--
-- You received this message because you are subscribed to the Google Groups DIYbio group. To post to this group, send email to diy...@googlegroups.com. To unsubscribe from this group, send email to diybio+un...@googlegroups.com. For more options, visit this group at https://groups.google.com/d/forum/diybio?hl=en
Learn more at www.diybio.org
---
You received this message because you are subscribed to the Google Groups "DIYbio" group.
To unsubscribe from this group and stop receiving emails from it, send an email to diybio+un...@googlegroups.com.
To post to this group, send email to diy...@googlegroups.com.
Visit this group at http://groups.google.com/group/diybio.
To view this discussion on the web visit https://groups.google.com/d/msgid/diybio/ecf0ac37-c5bf-41f3-bd88-afec8b91a0a8%40googlegroups.com.
For more options, visit https://groups.google.com/d/optout.
TGTGTTTAGGGTTTTTTTCCTTTAG[C/T]GTGCCGTAGTAACATGCCCTTGGCT
Thanks a lot!!!!!
but this mutation is pathogenic? It's bloned hair mutation!
--
-- You received this message because you are subscribed to the Google Groups DIYbio group. To post to this group, send email to diy...@googlegroups.com. To unsubscribe from this group, send email to diybio+un...@googlegroups.com. For more options, visit this group at https://groups.google.com/d/forum/diybio?hl=en
Learn more at www.diybio.org
---
You received this message because you are subscribed to a topic in the Google Groups "DIYbio" group.
To unsubscribe from this topic, visit https://groups.google.com/d/topic/diybio/pp32_xEwk8I/unsubscribe.
To unsubscribe from this group and all its topics, send an email to diybio+un...@googlegroups.com.
To post to this group, send email to diy...@googlegroups.com.
Visit this group at http://groups.google.com/group/diybio.
To view this discussion on the web visit https://groups.google.com/d/msgid/diybio/a37cc37a-2a4a-4370-af0a-d175cfd624d3%40googlegroups.com.