Transgenic CCD resistant honeybee - need help

[Mega [Andreas Stuermer]]

Hi everyone! 

That latest project I'm currently working on is to confer resistance to a bee. 

Some of you probably heard of the bee dying due to many different factors, which all together cause CCD.

(See http://beeotex.wordpress.com ) 

The bee does kind of inbreeding and therefore has a very small gene pool. Other insects are much better fighting off all the diseases. 

I found a lot of resistance genes in the literature, such as antibacterial peptides, antifungal peptides, enzymes that destroy insectizides.

Additionally, shRNA will fight the worst viruses

http://www.ncbi.nlm.nih.gov/pubmed/11122471 

Here it is shown that you can "easily" transform bees by mixing bee semen with DNA, and fertilizing a queen bee. Some of the offspring will have the DNA then. 

In this study, the transgenic DNA was inheritable, however it did not integrate into the bees' genomes. 

Another study showed that a transposon works perfectly to integrate DNA into the honeybee genome (although they did microinjection into larvae and yielded genetic mosaic bees). 

I have the entire construct and whatsoever, and found a beekeeper in the US who can do the insemination. 

But DNA 2.0 charges 1800$ for everything (synthesis plus subcloning into this transposon vector). 

Is there anyone with too much money who would like to help out? In case we will be able to somehow sell the bees, we can offer shares :D 

Best,

Andreas

 

[Mega [Andreas Stuermer]]

>I have the entire construct and whatsoever, and found a beekeeper in the US who can do the insemination. 

That means I don't have the construct, only the virtual DNA sequence ready to be printed out

[Josiah Zayner]

How big is the DNA you are attempting to synthesize? $1800 seems pretty hefty.

Check out Genscript: http://www.genscript.com/gene_synthesis.html

[Dakota Hamill]

Is the plan to just repeat what someone else already did in a journal
article and see what happens, or is it to raise funds to start a
company that sells technology (or the bees themselves) that give CCD
resistance? If it's the latter $1800 is a small sum to raise if you
believe it will yield bees resistant to the disorder, especially since
the economic impact of CCD is probably in the billions of dollars. If
I knew I could solve CCD with one plasmid I'd sell my car and
everything I own today. Of course, I doubt it is that simple.

Did the offspring continue to have the vector / integrated DNA after
the 3rd generation when they stopped testing?

> --
> -- You received this message because you are subscribed to the Google Groups
> DIYbio group. To post to this group, send email to diy...@googlegroups.com.
> To unsubscribe from this group, send email to
> diybio+un...@googlegroups.com. For more options, visit this group at
> https://groups.google.com/d/forum/diybio?hl=en
> Learn more at www.diybio.org
> ---
> You received this message because you are subscribed to the Google Groups
> "DIYbio" group.
> To unsubscribe from this group and stop receiving emails from it, send an
> email to diybio+un...@googlegroups.com.
> To post to this group, send email to diy...@googlegroups.com.
> Visit this group at http://groups.google.com/group/diybio.
> To view this discussion on the web visit
> https://groups.google.com/d/msgid/diybio/4b8e95e9-715b-402f-8ccb-b8a51f0e6b90%40googlegroups.com.
>
> For more options, visit https://groups.google.com/d/optout.

[Mega [Andreas Stuermer]]

In the papers they just used GFP.  No viral resistance shRNA, no antifungal peptides, ... etc. 

2100 bp to synthesize for the proof-of-concept. 

And subcloning into a specific transposon

[Mega [Andreas Stuermer]]

My approach won't make CCD extinct. As CCD is a factor of multiple diseases. But I have peptides that fight Nosema (the most hated unicellular parasites that like 90% of hives have) and other antifungal peptides. To kill off viruses is easy, as most bee viruses are RNA viruses. Silencer RNA destroys them. 

Actually, some viruses are related, so one silencer RNA can destroy 2 or three viruses. 

Only this two modifications would decrease mortality rates quite drastically, I assume. Gotta test it. 

http://en.wikipedia.org/wiki/List_of_diseases_of_the_honey_bee

I would be ready to start a company selling those bees. But we got to get EPA approval.

One problem is also that you try to kill the Varroa destructor mites (which feed on bees) with insecticides which also harms the bees. By just inserting the bees a zeocin resistance or Kanamycin resistance, you could kill the mites effectively, and the bee is protected. 

[Andreas Stuermer]

In the native bee genome there is no transposase for this transposon. Thus, it cannot jump out on its own again. 

The vecot would contain LTR ---- Resistance casette ---- LTR ---- transposase

Transposase cuts at the long terminal repeats, and inserts it into the genome. So transposase gene is lost after time. 

--
-- You received this message because you are subscribed to the Google Groups DIYbio group. To post to this group, send email to diy...@googlegroups.com. To unsubscribe from this group, send email to diybio+un...@googlegroups.com. For more options, visit this group at https://groups.google.com/d/forum/diybio?hl=en
Learn more at www.diybio.org
---

You received this message because you are subscribed to a topic in the Google Groups "DIYbio" group.
To unsubscribe from this topic, visit https://groups.google.com/d/topic/diybio/e3QjwVVzSlU/unsubscribe.
To unsubscribe from this group and all its topics, send an email to diybio+un...@googlegroups.com.

To post to this group, send email to diy...@googlegroups.com.
Visit this group at http://groups.google.com/group/diybio.

To view this discussion on the web visit https://groups.google.com/d/msgid/diybio/2a5cdfab-a52d-40b4-8f30-cdc6749ef2a3%40googlegroups.com.

For more options, visit https://groups.google.com/d/optout.

--

---------------

http://diyspartanbiotech.files.wordpress.com/2014/03/genetic-engineering-and-synbio-for-beginners-v1.pdf

[Andreas Stuermer]

In the native bee genome there is no transposase for this transposon. Thus, it cannot jump out on its own again. 

The vector would contain LTR ---- Resistance casette ---- LTR ---- transposase

Transposase cuts at the long terminal repeats, and inserts it into the genome. So transposase gene is lost after time. 

--

---------------

http://diyspartanbiotech.files.wordpress.com/2014/03/genetic-engineering-and-synbio-for-beginners-v1.pdf

[Mega [Andreas Stuermer]]

Perhaps I should patent my mechanisms before Monsanto does. 

Does anyone know how to file biotech patents? 

What I imagine: 

Selling Transgenic bee version 1.0 in 2015 (after approval from EPA)

the bees outcross with other farmers' bees, and after 3 years no one will buy the transgenic bee 1.0 any more. Then version 1.0  will be made open source. 

2018: Transgenic bee 2.0 

If farmers want better bees, they *want* to buy transgenic bee version 2.0. In case they are happy with less, they are free to use and breed version 1.0

Does that sound like a fair buisness model? 

[Dakota Hamill]

I know a guy who writes his own patents, but he's also been working in
the biotech industry for 20 years. He makes the provisional patent
seem not that difficult to write in the sense that it acts as a
"placeholder" which gives you 1 year from the date of filing to do
extra research, amend the patent, have a lawyer write up a serious
one, then resubmit for a final application. Nevertheless I can't
imagine it's cheap in the long haul, or even that easy. If you're
still at a University you could probably make use of their technology
transfer office, maybe there is a nice person there that could answer
some questions. Or do what a lot of startups at the incubator I work
at do, find a law firm / patent lawyer that believes in the company
or patent idea enough to write it up pro-bono (for now), with a signed
agreement that they'll get payed for their time + some in the future.

> --
> -- You received this message because you are subscribed to the Google Groups
> DIYbio group. To post to this group, send email to diy...@googlegroups.com.
> To unsubscribe from this group, send email to
> diybio+un...@googlegroups.com. For more options, visit this group at
> https://groups.google.com/d/forum/diybio?hl=en
> Learn more at www.diybio.org
> ---

> You received this message because you are subscribed to the Google Groups
> "DIYbio" group.
> To unsubscribe from this group and stop receiving emails from it, send an

> email to diybio+un...@googlegroups.com.
> To post to this group, send email to diy...@googlegroups.com.
> Visit this group at http://groups.google.com/group/diybio.
> To view this discussion on the web visit

> https://groups.google.com/d/msgid/diybio/c456bd7e-d97a-4995-8425-fc9fcb27db93%40googlegroups.com.

[Mega [Andreas Stuermer]]

Thanks a lot for the input! 

[Cathal Garvey]

NB: See if you can get a transposon vector that has the mediating
transposases removed to another site on the vector, so that it's a "jump
once then stop forever" system. These probably already exist. Otherwise,
you'll hit (justifiable) roadblocks when asked "how do you prevent this
spreading virally through wild bee populations?".

As far as making this happen, I'd happily chip in to a project like
this, though I'm fairly poor at present.

--
T: @onetruecathal, @IndieBBDNA
P: +353876363185
W: http://indiebiotech.com

[Cathal Garvey]

Whoops, you already covered this. :)

How big are the LTR/transposases? Would it be cheaper to synthesise them
rather than subcloning?

>> https://groups.google.com/d/msgid/diybio/2a5cdfab-a52d-40b4-8f30-cdc6749ef2a3%40googlegroups.com<https://groups.google.com/d/msgid/diybio/2a5cdfab-a52d-40b4-8f30-cdc6749ef2a3%40googlegroups.com?utm_medium=email&utm_source=footer>
>> .

>>
>> For more options, visit https://groups.google.com/d/optout.
>>
>
>
>

--

[Cathal Garvey]

You've disclosed the idea publicly, so it's safe from predatory
patenting. That is, if anyone patents it now, you can have their patent
revoked simply by pointing to the public list archives where you wrote
about it first.

No need for patents! :)

[Mega [Andreas Stuermer]]

The LTR sequences are not clearly described because they want to keep secret. 

Although there is the natural transposable element (and varieties thereof) on ncbi. But the native one has the transposase between the LTR, as you mention. 

Sometimes their core was mentioned to be just dozens of base pairs, but I found papers that say you need the full 1.4 kbp LTRs. 

Modern transposons of this kind do as you say: transposase is outside the borders and thus is not integrated and is lost together with the plasmid/linerar DNA over time. 

[Mega [Andreas Stuermer]]

Sure. 
But the exact mechanisms how I make them e.g. resistant against fungi, that I haven't disclosed (intentionally). So that probably is still patentable. 

Bee transformation with GFP was described before, and you couldn't patent the transformation of honeybee anyway. What you can patent are the specific heterologous sequences.

[Cathal (phone)]

Yea, my point is that if you do make this an open source project and disclose your planned methods, they're then unpatentable by others.

Best also to clearly note the obvious "next steps" to protect those from the embrace/extend/extinguish tactics used by Apple$oft and Google et al and their peers in biotech.

--
Sent from my Android device with K-9 Mail. Please excuse my brevity.

[Dakota Hamill]

Filing a provisional patent keeps your ideas protected from "being in
the public domain" and also theoretically from being patented by
others. That's why many professors and schools will pass everything
through their tech office prior to publishing to see if patents could
be filed. Once you publish in a journal it's in the public domain and
no longer patentable. There of course seem to be a lot of fine lines
to walk with lawyer-speak which is why I find IP so damn confusing.
I read a patent by that company Ecovative designs about using dried
mycelia from a mushroom to make packing material. Then you look up
the authors names and they have like 10 patents all with almost the
exact same name and claim, and I just don't understand why the hell
you'd need that many patents all for the same thing (though they are
probably slightly different in the fine print). It's all in the
fine print!

> --
> -- You received this message because you are subscribed to the Google Groups
> DIYbio group. To post to this group, send email to diy...@googlegroups.com.
> To unsubscribe from this group, send email to
> diybio+un...@googlegroups.com. For more options, visit this group at
> https://groups.google.com/d/forum/diybio?hl=en
> Learn more at www.diybio.org
> ---

> You received this message because you are subscribed to the Google Groups
> "DIYbio" group.
> To unsubscribe from this group and stop receiving emails from it, send an

> email to diybio+un...@googlegroups.com.
> To post to this group, send email to diy...@googlegroups.com.
> Visit this group at http://groups.google.com/group/diybio.
> To view this discussion on the web visit

> https://groups.google.com/d/msgid/diybio/3d46cbf9-12fa-4f6f-abd1-3d4b9df5ae6c%40email.android.com.

[Mega [Andreas Stuermer]]

Just came across this. 

http://www.engadget.com/2014/04/28/brazil-breeds-mosquito-with-suicide-gene-against-dengue-fever/?ncid=rss_truncated

May I cite: "With the World Cup just six weeks away, Brazilian authorities have approved the widespread, commercial release of a strain of mosquito that has been genetically reprogrammed to wipe out its own species."

Male sterility in insects is allowed finally (in Brazilia). As they will have success, other countries will follow. 

[SC]

Have you considered writing a USDA grant?  In that case you won't be able to patent the results, but you seem to indicate you would only do so to prevent Monsanto from doing so.  Publications resulting from the project would also prevent Monsanto from doing so.

[Mega [Andreas Stuermer]]

Nice idea, but i don't know anyone from them & if I just write to anyone chances are high they won't reply.

[Mega [Andreas Stuermer]]

Btw, I don't hate Monsanto and won't do everything to block their projects, but if the rumors about their policy about cross-pollination is true I'm not happy with that.

On the other hand, I recently read an article that there is a lot of untrue myths about them too. They were said not to sue farmers with like 10% cross-pollination, and the famous case intentionally bread the seeds ahead and used round-up

[SC]

Hi Mega,

I didn't mean you should write a letter to a random person at the USDA.  The USDA does fund research for agricultural interests, and they have a specific procedure for asking for money.

Start here:

http://www.csrees.usda.gov/fo/funding.cfm

 

Note: writing a government grant is a whole, um, thing, and if you're interested you should certainly have an experienced grant-writer help you or at least look it over before submission.  It's also pretty competitive, so you'd have to carefully outline what you'd be doing, why, and how they money would be spent.  You should also take a look at the grants that were funded previously to see what they're looking for. 

[Mega [Andreas Stuermer]]

Seems like a lot of paperwork. Easier to pay the 2kbp synthesis myself :P currently writing my bachelor thesis, learning for final exams, doing an internship, and keeping ither projects running.

Yay multitasking.

All the bee sequences are on my computer already, I would just have to have them synthesized and send to my beekeeper for insemination. of course, need to find a cheap source for the transposon.

[SC]

You would mix raw DNA in with bee semen?   How would it be incorporated into the genome?

[Mega [Andreas Stuermer]]

Here is the paper demonstrating the method of sperm-mediated transfection. 

http://www.ncbi.nlm.nih.gov/pubmed/11122471

However, in that specific experiment the DNA was inherited episomally.

There is another paper (I'll send you privately, and anyone else who requests) how chromosomal bee integration works. It already has been done with high efficiency. That should be our least problem, given the right vector (it's commercially available, but a bit expensive)

[SC]

Neat!

Please do let us know how it turns out.
Stacy

[Andreas Stuermer]

I will... Once I finally get the mentioned transposon, I'll have the DNA synthesized and put into bees. However, breeding season starts soon and

a) DNA synthesis must occur before

b) the beekeeper must give the "go"

--

-- You received this message because you are subscribed to the Google Groups DIYbio group. To post to this group, send email to diy...@googlegroups.com. To unsubscribe from this group, send email to diybio+un...@googlegroups.com. For more options, visit this group at https://groups.google.com/d/forum/diybio?hl=en
Learn more at www.diybio.org
---

You received this message because you are subscribed to a topic in the Google Groups "DIYbio" group.
To unsubscribe from this topic, visit https://groups.google.com/d/topic/diybio/e3QjwVVzSlU/unsubscribe.
To unsubscribe from this group and all its topics, send an email to diybio+un...@googlegroups.com.

To post to this group, send email to diy...@googlegroups.com.
Visit this group at http://groups.google.com/group/diybio.

To view this discussion on the web visit https://groups.google.com/d/msgid/diybio/4deeb4cd-4f87-46b5-a4b8-479c25fb27f9%40googlegroups.com.

For more options, visit https://groups.google.com/d/optout.

--

---------------

http://diyspartanbiotech.files.wordpress.com/2014/03/genetic-engineering-and-synbio-for-beginners-v1.pdf

[Mega [Andreas Stuermer]]

I just wished Bill Gates came here and gave me 1000$, then I would immediately have the DNA synthesized. Just kidding* :D

(*If you read, it would really help :P  Where are thou? )

[Inigo Howlett]

Finding a beekeeper shouldn't be that hard. These folks would likely say yes to you, and even if they didn't, they'd know someone who would. 

Also, you could ask the actual bee industry people out in california for money.

http://bees.gmu.edu


Inigo

[Andreas Stuermer]

Thanks a lot for the link. 

I felt like I asked every single email adress from beekeepers there is on the web (in the US)

Breeding programs with universities ususally say they cannot cooperate

--

-- You received this message because you are subscribed to the Google Groups DIYbio group. To post to this group, send email to diy...@googlegroups.com. To unsubscribe from this group, send email to diybio+un...@googlegroups.com. For more options, visit this group at https://groups.google.com/d/forum/diybio?hl=en
Learn more at www.diybio.org
---
You received this message because you are subscribed to a topic in the Google Groups "DIYbio" group.
To unsubscribe from this topic, visit https://groups.google.com/d/topic/diybio/e3QjwVVzSlU/unsubscribe.
To unsubscribe from this group and all its topics, send an email to diybio+un...@googlegroups.com.
To post to this group, send email to diy...@googlegroups.com.
Visit this group at http://groups.google.com/group/diybio.

To view this discussion on the web visit https://groups.google.com/d/msgid/diybio/9aa66e64-5972-433a-90ca-2d638015e537%40googlegroups.com.

For more options, visit https://groups.google.com/d/optout.

--

---------------

http://diyspartanbiotech.files.wordpress.com/2014/03/genetic-engineering-and-synbio-for-beginners-v1.pdf

[Andreas Stuermer]

They don't give their email adress... 

--

---------------

http://diyspartanbiotech.files.wordpress.com/2014/03/genetic-engineering-and-synbio-for-beginners-v1.pdf

[Andreas Stuermer]

Ah ok, the entity is Sweet Virginia... I think I already contacted them

--

---------------

http://diyspartanbiotech.files.wordpress.com/2014/03/genetic-engineering-and-synbio-for-beginners-v1.pdf

[Mike Horwath]

Hi Mega,

This is a very cool project idea, but I think you are going to encounter a lot of roadblocks.  Even here in the US, which is kind of the wild west of GMOs, the FDA and EPA do assessments of potential environmental and human health impact for anything that will be released and/or consumed.  This is expensive and lengthy, for animals more so than plants. The GMO salmon still haven't made it to market after 10+ years.  It's going to be even more difficult to get regulatory approval when you're adding a ton of new genes.  Before that approval, the bees would need to be contained in an indoor facility, so simply finding a regular beekeeper is probably out.

Also, do you have any precedent for adding so many resistance genes to an insect?  Are they contained in a single piece of DNA, and if so will it be able to get into the sperm?  (DNA movement thru membranes gets a lot more difficult as the construct gets bigger...)  How high does the expression need to be for these genes to effective?  This has the potential to put stress on the cell metabolism, and make the bees less healthy.

I won't say walk before you run, I think you're already running.  But maybe run more before you do an ultra-triathlon.

Mike

[Mega [Andreas Stuermer]]

>This is a very cool project idea, but I think you are going to encounter a lot of roadblocks.  Even here in the US, which is kind of the wild west of GMOs, the FDA and EPA do assessments of >potential environmental and human health impact for anything that will be released and/or consumed.  

With the glowing plant there was no regulation, unless it was an edible plant.

And what I heard, US are more liberal with transgenic animals than plants. 

>This is expensive and lengthy, for animals more so than plants. The GMO salmon still haven't made it to market after 10+ years.  It's going to be even more difficult to get regulatory approval when >you're adding a ton of new genes. 

A ton = 4 :D at first it will be only GFP and three resistance genes against viruses and fungi.

If I can show a GFP bee, some investors will probably jump on the train. I hope so at least, I am willing to take the risk.

>Also, do you have any precedent for adding so many resistance genes to an insect? 

As for bees, no. 2 genes at the same time.

For other beetles, Idk. Nobody tries to make insects resistant. You usually want to kill them.

 >Are they contained in a single piece of DNA, and if so will it be able to get into the sperm?

Yes. And perhaps. But the probosed mechanism is that the DNA is attached to the sperms surface and gets inside the cell, as soon as they fuse.

On the other hand my construct is very small. I made it to put the 4 genes into 2100 bp. The original sperm-mediated paper also had at least 1500 bp (I didn't count it but GFP ~800 promoter ~500) and they also took terminator etc. 

> How high does the expression need to be for these genes to effective?  This has the potential to put stress on the cell metabolism, and make the bees less healthy.

Not very much, probably. I chose a medium promoter. 

>I won't say walk before you run, I think you're already running.  But maybe run more before you do an ultra-triathlon.

I love mega projects :D 

[Cathal Garvey]

Agricultural GM Regulation in US doesn't only apply to edibles, it
applies to anything relevant to agriculture. Bees definitely qualify,
even ignoring the fact that they make honey, because they are critical
pollinators.

So yes, you'll hit a huge regulatory barrier that you'll have to
overcome with years of high quality testing.

This is a huge project. If you can pull off the actual science, which is
already very ambitious (but not impossible), that's about a third of the
work. The second third is getting approval to actually bring it to
market, and the third third is getting people to trust it enough to
actually use and accept it.

That's all assuming that it's even possible for the product of your
scientific labours to get regulatory approval, because if your
implementation of CCD-resistant bees isn't contain-able they'll probably
refuse permission. Same for if it's so over-contained that it poses a
risk to other bee populations, see "Sterile Male". Sure, sterile drones
makes for a useful (but incomplete) way to contain your GM bees. It also
risks interfering with the mating behaviour of other mating swarms of
unmodified bees; have you studied virgin queen behaviour? How many
drones will a bee of each breed in use in the US typically mate with on
her virgin flight? If ~1-4, your sterile drones might lead to failed
matings if they DDOS the queen.

So, don't ignore the need for LOTS OF MONEY, because anything big
requires money when facing nigh-insurmountable obstacles like the
regulatory burden of proving your bees won't pose more of a nuisance
than a solution. If people are offering you low-strings grant money to
fix problems, take the money and do the thing.

[Mike Horwath]

Accidentally sent this as a private message rather than a post...
------

Well, you have good answers for most of my questions!  Didn't realize you are only adding a few genes to start, that sounds more reasonable...  I'd still probably start with just 1...anyway hope the science works for you!

As for the legal aspect, you are right that FDA currently cannot regulate unless it's part of the food supply.  If you are making honey from the bees that would certainly qualify.  If they're just for pollination of food crops, it seems less clear.  EPA regulates GMOs that produce insecticide and fungicide proteins.  If you are including genes to fight fungi or mites, you may draw their attention.   USDA regulates GMOs that pose a "plant pest risk." Again it's not clear to me if your pesticide-resistance genes would put the GM bee in that category.  The laws are messy and your project would be pushing their limits! Any biotech law experts on the forum? :)

GMO bees would raise a lot of controversy.  Maybe rightly so since they could likely outcompete and displace normal bees.  If this project picks up and gets attention, keep a lawyer handy.

Mike

[SC]

Hi Mega,

Do you live in a place where you can keep bees yourself? As this may be a lengthy process (making a GMO eukaryote usually is), you'd have good control of what was introduced and when.  I used to keep bees (decades ago), and it's not difficult, but you need appropriate land and plant growth for them.  Failing that you might want to consider an "observation hive", like this:

http://www.pigeonmountaintrading.com/Category/1-22638-observation-hives.aspx

These are kept indoors with a tube leading to the outside.

[Andreas Stuermer]

Sounds good. Where I live you get in prison even for GM engineering of bacteria outside a governmentally certified lab, so I outsource the bee insemination job to the US. 

I'll forward your idea, that may be a good idea to keep them contained ;) 

--

-- You received this message because you are subscribed to the Google Groups DIYbio group. To post to this group, send email to diy...@googlegroups.com. To unsubscribe from this group, send email to diybio+un...@googlegroups.com. For more options, visit this group at https://groups.google.com/d/forum/diybio?hl=en
Learn more at www.diybio.org
---
You received this message because you are subscribed to a topic in the Google Groups "DIYbio" group.
To unsubscribe from this topic, visit https://groups.google.com/d/topic/diybio/e3QjwVVzSlU/unsubscribe.
To unsubscribe from this group and all its topics, send an email to diybio+un...@googlegroups.com.
To post to this group, send email to diy...@googlegroups.com.
Visit this group at http://groups.google.com/group/diybio.

To view this discussion on the web visit https://groups.google.com/d/msgid/diybio/34d5dd95-d673-4eaa-be5e-499b914b8cc0%40googlegroups.com.

For more options, visit https://groups.google.com/d/optout.

--

---------------

http://diyspartanbiotech.files.wordpress.com/2014/03/genetic-engineering-and-synbio-for-beginners-v1.pdf

[Mike Horwath]

Keeping the hive indoors, with a tube to the outside, is not sufficient.  Your GMO bees should be kept in a completely enclosed facility with its own food source, until environmental and food supply safety are proven.  Colonies do "abscond" sometimes--all the bees including the queen leave and start a new hive...

I'm not an expert on the legality of all this. But it's certainly unethical to expose the environment to untested GMOs with a potential competitive advantage against native species.  Like I said previously, this is a cool project idea, but you may need to evaluate whether you have the resources to do this safely and legally.

Mike

[Mega [Andreas Stuermer]]

Seems I can make a deal with the commercial providers of the transposon. "Only" 300$ (50% off) 

Another thing - does anyone know if 34 bp UTR is sufficient? The native promoter->gene has only 34 bp leader. However, maybe it has translation start elements downstream the ATG (and the CDS is what I exchange)?  Does anyone know that for eukaryotes? 

[Cathal Garvey]

If you can induce a nick in the homologous region of the bee chromosome,
then smaller matching regions will have better odds..but the longer
homologs from the other chromosomes will still have better chances if
the length disparity is great (that is, effectively infinite versus
~34bp). You're better off playing it safe, because inefficiency can kill
experiments.

[Andreas Stuermer]

I think you got me wrong ;) 

I'm using a transposon, so no homologous flanking sites... 

My intention was, Between promoter and the ATG of the CDS there's untranslated region. And for the native gene it is just 34 bp. Usually it is said to be 50-200 bp

--

---------------

http://diyspartanbiotech.files.wordpress.com/2014/03/genetic-engineering-and-synbio-for-beginners-v1.pdf

[Cathal (phone)]

UTRs often serve a regulatory function so can be quite long. They also space promoter from CDS, because transcription starts some distance from the promoter. If your promoter starts transcription further downstream than your CDS, it breaks the gene. So, choose according to the promoter behaviour and play it a little safe.

--
Sent from my Android device with K-9 Mail. Please excuse my brevity.

[Andreas Stuermer]

Yeah. but in the native constellation it works like this. Transcription initiation sizte is 34 bp before ATG.

If I exchange the CDS I should be fine?

> --
> -- You received this message because you are subscribed to the Google Groups DIYbio group. To post to this group, send email to diy...@googlegroups.com. To unsubscribe from this group, send email to diybio+un...@googlegroups.com. For more options, visit this group at https://groups.google.com/d/forum/diybio?hl=en
> Learn more at www.diybio.org
> ---
> You received this message because you are subscribed to a topic in the Google Groups "DIYbio" group.
> To unsubscribe from this topic, visit https://groups.google.com/d/topic/diybio/e3QjwVVzSlU/unsubscribe.
> To unsubscribe from this group and all its topics, send an email to diybio+un...@googlegroups.com.
> To post to this group, send email to diy...@googlegroups.com.
> Visit this group at http://groups.google.com/group/diybio.

> To view this discussion on the web visit https://groups.google.com/d/msgid/diybio/d0115952-2b94-4269-a10f-fd2cd8768277%40email.android.com.

[CodonAUG]

Keep in mind that parasites have a faster generation time and could evolve a response to your enhanced-Bee's.  See: Roundup Read Plants (I think weeds evolved 5 methods to counter the roundup issue)

[Mega [Andreas Stuermer]]

Hehe... Just found this: 

http://dev.biologists.org/content/140/2/454.long

How to build an insect electroporator for <200$ 

:D

[Mega [Andreas Stuermer]]

Hm, the cheapest gene synthesis provider failed in making the construct. 

The next cheapest wants to charge 740$. Is there anyone who wants to be part of this and help out with some bucks? 

[Nathan McCorkle]

Nice find on the electroporator! It isn't very high-voltage, and looks
quite easy to build! You could easily swap in an Arduino!

> --
> -- You received this message because you are subscribed to the Google Groups
> DIYbio group. To post to this group, send email to diy...@googlegroups.com.
> To unsubscribe from this group, send email to
> diybio+un...@googlegroups.com. For more options, visit this group at
> https://groups.google.com/d/forum/diybio?hl=en
> Learn more at www.diybio.org
> ---

> You received this message because you are subscribed to the Google Groups
> "DIYbio" group.
> To unsubscribe from this group and stop receiving emails from it, send an

> email to diybio+un...@googlegroups.com.
> To post to this group, send email to diy...@googlegroups.com.
> Visit this group at http://groups.google.com/group/diybio.
> To view this discussion on the web visit

> https://groups.google.com/d/msgid/diybio/5fdf1baa-68c9-43ff-b92c-e89ee7d6a2f5%40googlegroups.com.

>
> For more options, visit https://groups.google.com/d/optout.



--

-Nathan

[Mega [Andreas Stuermer]]

Hi everyone,  

The DNA construct is synthesized and will be subcloned. Now I am desinging a version 2.0 (right, before v1 was tested. But I have the uppermost confidence it is going to work). My beekeeper in the US will do the actual transfection, so I am freed up to do some work on v2.

However, now I will need the "good old" CMV promoter. Does anyone know whether I can use it without it's enhancer? Will it still have the same expression pattern as the full lentgh promoter (probably not, that's why I am asking)? 

CMV enhancer

GTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATG

CMV minimal promoter

GTGATGCGGTTTTGGCAGTACATCAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGGGAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAACAACTCCGCCCCATTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCT

Usually it is nice to just take the full-lentgh promoter, knowing it will work as in the literature. But obviously, paying 200 bp more synthesis instead of 500 bp more (if it is unneccessary) makes a difference :D  

I need to be sure about this, because I'd rather pay more if unsure if it would work. 

[Mega [Andreas Stuermer]]

Hi guys, good news for those who like the project... well, and bad news for those who don't like GM bees -,- 

Some time ago I asked quite a lot of beekeepers if they would be interested, and found one. Now, a guy replied months later, the email got lost between all his mails. However, he happens to be of a University, and is interested in cooperating with the project. 

[Dakota Hamill]

Make it happen! You just got some real world validation

On Nov 14, 2014 4:45 PM, "Mega [Andreas Stuermer]" <masters...@gmail.com> wrote:

Hi guys, good news for those who like the project... well, and bad news for those who don't like GM bees -,- 

Some time ago I asked quite a lot of beekeepers if they would be interested, and found one. Now, a guy replied months later, the email got lost between all his mails. However, he happens to be of a University, and is interested in cooperating with the project. 

--
-- You received this message because you are subscribed to the Google Groups DIYbio group. To post to this group, send email to diy...@googlegroups.com. To unsubscribe from this group, send email to diybio+un...@googlegroups.com. For more options, visit this group at https://groups.google.com/d/forum/diybio?hl=en
Learn more at www.diybio.org
---
You received this message because you are subscribed to the Google Groups "DIYbio" group.
To unsubscribe from this group and stop receiving emails from it, send an email to diybio+un...@googlegroups.com.
To post to this group, send email to diy...@googlegroups.com.
Visit this group at http://groups.google.com/group/diybio.

To view this discussion on the web visit https://groups.google.com/d/msgid/diybio/da91d8aa-a1ee-42c9-b843-cf8c0efe93ae%40googlegroups.com.

[Mega [Andreas Stuermer]]

Indeed, we also were talking a bit about commercialization. It'd be nice to do this open source too, but you gotta live off something... Maybe I can even pay some of my other projects from this some day.

>Hmmmm I'm curious. It would be a great project and noble too. May even be commercial potential since they sell queen bees for >breeding.

>>matt

[Mega [Andreas Stuermer]]

However, experience shows I'll set up some kind of contract to prevent that university from taking the idea and the DNA, writing a paper without me... And selling it alone. 

[Mega [Andreas Stuermer]]

Dakota, thanks a lot for the kind words btw ;) 

[Mega [Andreas Stuermer]]

While I shoot for transposon integration into the genome, I find it fascinating that according to the sperm mediated transformation paper, DNA seemingly without bee replication features can be stably inherited. 

Does anyone work with insect cells/living GM insects? Is that unique to bees? A sign of a bad immune system - foreign DNA doesn't get removed?