shRNA construct template

[Mega [Andreas Stuermer]]

Hi everyone. 

Just wondering if anyone could share an .ape file or .dna file of a well annotated silencer construct. 

In papers they always give the sequence of the actual silencing part, but never the entire sequence like 

ATATTTTATATATATAgagtctgcgctagtATATATATATATAAAATATAAAAAA

hairpin-forming sequence

silencing RNA part (complementary to target gene)

vector backbone

The silencing constructs I designed so far all rely on a tutorial, but I'd rather have one sequence that was shown to work and just replace the silencing part 

 e.g. 

ATATTTTATATATATAnnnnnnnnnnATATATATATATAAAATATAAAAAA

[Mega [Andreas Stuermer]]

Good news. I accidentally got my hands on this sequence.

Retroviral Tet-shRNA expression vector TRMPVIR, complete sequence

GenBank: HQ456317.1

And its open acces paper. http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3394154/#SD1

I should be able to comprehend shRNA design with that info and get a universal template for designing shRNAs

[Mega [Andreas Stuermer]]

And here's its target!
TAGATAAGCATTATAATTCCTA

[Mega [Andreas Stuermer]]

And the reverse complement of the targeting seq is

Renilla reniformis luciferase mRNA, complete cds

check. 

GenBank: M63501.1

atgacttcgaaagtttatgatccagaacaaaggaaacggatgataactggtccgcagtggtgggccagatgtaaacaaatgaatgttcttgattcatttattaattattatgattcagaaaaacatgcagaaaatgctgttatttttttacatggtaacgcggcctcttcttatttatggcgacatgttgtgccacatattgagccagtagcgcggtgtattataccagatcttattggtatgggcaaatcaggcaaatctggtaatggttcttataggttacttgatcattacaaatatcttactgcatggtttgaacttcttaatttaccaaagaagatcatttttgtcggccatgattggggtgcttgtttggcatttcattatagctatgagcatcaagataagatcaaagcaatagttcacgctgaaagtgtagtagatgtgattgaatcatgggatgaatggcctgatattgaagaagatattgcgttgatcaaatctgaagaaggagaaaaaatggttttggagaataacttcttcgtggaaaccatgttgccatcaaaaatcatgagaaagttagaaccagaagaatttgcagcatatcttgaaccattcaaagagaaaggtgaagttcgtcgtccaacattatcatggcctcgtgaaatcccgttagtaaaaggtggtaaacctgacgttgtacaaattgttaggaattataatgcttatctacgtgcaagtgatgatttaccaaaaatgtttattgaatcggatccaggattcttttccaatgctattgttgaaggcgccaagaagtttcctaatactgaatttgtcaaagtaaaaggtcttcatttttcgcaagaagatgcacctgatgaaatgggaaaatatatcaaatcgttcgttgagcgagttctcaaaaatgaacaataa

5' ATGnnnnaattgt taggaa  ttataa    tgctta   tcta       cgtgcaa nnnnnTAG 3'
   --------------------- ATCCTT  AATATT  ACGAAT AGAT-----------------

ATCCTTAATATTACGAATAGAT
 is the reverse of
TAGATAAGCATTATAATTCCTA (our mRNA-binding site in the shRNA)

[Mega [Andreas Stuermer]]

I stand corrected... Happened to come across that paper

"An Optimized microRNA Backbone for Effective Single-Copy RNAi" (open access, too big to attach here http://www.cell.com/cell-reports/fulltext/S2211-1247%2813%2900687-6 )

That's the way how to do it. You need a sense and anti-sense. I didn't see that when BLASTing last time. Snapgene showed me that the sequence is present twice, and I thought that must be an error. 

The paper has good graphics describing everything

[Mega [Andreas Stuermer]]

When downloading, make sure to take the extended pdf with supplementary figures.

The sequence is not present twice as stated above, but rather once sense, and once anti-sense. The shRNA desing is based on a natural shRNA and includes sequence motives for Drosha/RISC/..., so really all you have to do is replace the sense strand by your GOI-sense and the anti-sense by your GOI-anti-sense.The cell's enymes do the magic then.