Exocytosis in Bacteria

[Jacob Palumbo]

Hey all,

I'm working on a project where it would be extremely useful to have bacteria (E. Coli specifically) exocytose proteins continuously, rather than grow a culture and lyse it the old fashion way. I've found a few papers on this so far (1, 2, 3), but they are all for Gram-positive bacteria, which E. Coli is not. If need be, I could switch over, but it would be nice to not have to. I do have some information the Sec pathway in Gram-negative bacteria, but it is somewhat general.

Anyone have an experience/insight into this?

Thanks,
Jake

[Nathan McCorkle]

Googling 'peptide export "e coli"' found a bunch of good looking hits
on google scholar, on web search this was on the top of the list:
http://www.qiagen.com/us/products/genes%20and%20pathways/pathway%20details.aspx?pwid=286

> --
> -- You received this message because you are subscribed to the Google Groups
> DIYbio group. To post to this group, send email to diy...@googlegroups.com.
> To unsubscribe from this group, send email to
> diybio+un...@googlegroups.com. For more options, visit this group at
> https://groups.google.com/d/forum/diybio?hl=en
> Learn more at www.diybio.org
> ---
> You received this message because you are subscribed to the Google Groups
> "DIYbio" group.
> To unsubscribe from this group and stop receiving emails from it, send an
> email to diybio+un...@googlegroups.com.
> To post to this group, send email to diy...@googlegroups.com.
> Visit this group at http://groups.google.com/group/diybio.
> To view this discussion on the web visit
> https://groups.google.com/d/msgid/diybio/72543824-8297-4f61-8ce2-e165aedc718c%40googlegroups.com.
> For more options, visit https://groups.google.com/d/optout.



--
-Nathan

[Mega [Andreas Stuermer]]

Beta-Lactamase is a protein that is secreted by E coli.

ATGAGTATTCAACATTTCCGTGTCGCCCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCTGTTTTTGCTCACCCAGAAACGCTGGTGAAAGTAAAAGATGCTGAAGATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTTTCGCCCCGAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTATCCCGTGTTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCTCAGAATGACTTGGTTGAGTACTCACCAGTCACAGAAAAGCATCTTACGGATGGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAACCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAACGATCGGAGGACCGAAGGAGCTAACCGCTTTTTTGCACAACATGGGGGATCATGTAACTCGCCTTGATCGTTGGGAACCGGAGCTGAATGAAGCCATACCAAACGACGAGCGTGACACCACGATGCCTGCAGCAATGGCAACAACGTTGCGCAAACTATTAACTGGCGAACTACTTACTCTAGCTTCCCGGCAACAATTAATAGACTGGATGGAGGCGGATAAAGTTGCAGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTTATTGCTGATAAATCTGGAGCCGGTGAGCGTGGGTCTCGCGGTATCATTGCAGCACTGGGGCCAGATGGTAAGCCCTCCCGTATCGTAGTTATCTACACGACGGGGAGTCAGGCAACTATGGATGAACGAAATAGACAGATCGCTGAGATAGGTGCCTCACTGATTAAGCATTGGTAA

The underlined peptide is cut off. Maybe it would work to just fuse your protein to it. Or leave 5-10 additional amino acids of the native N-terminus to make sure it is still recognized

[Mega [Andreas Stuermer]]

"e coli signal peptide "

may also be a good keyword.

[Filip Hasecke]

http://wolfson.huji.ac.il/expression/local/bacteria/Recombinant%20protein%20secretion%20in%20Escherichia%20coli-2005.pdf

There is a big table in this document showing the used signal and the resulting cellular localization of the recombinant protein and a link to a publication. There are also a lot of signals resulting in the secretion of the peptide (localization = "medium").

-Filip

2015-02-06 12:26 GMT+01:00 Mega [Andreas Stuermer] <masters...@gmail.com>:

"e coli signal peptide "

may also be a good keyword.

--

-- You received this message because you are subscribed to the Google Groups DIYbio group. To post to this group, send email to diy...@googlegroups.com. To unsubscribe from this group, send email to diybio+un...@googlegroups.com. For more options, visit this group at https://groups.google.com/d/forum/diybio?hl=en
Learn more at www.diybio.org
---
You received this message because you are subscribed to the Google Groups "DIYbio" group.
To unsubscribe from this group and stop receiving emails from it, send an email to diybio+un...@googlegroups.com.
To post to this group, send email to diy...@googlegroups.com.
Visit this group at http://groups.google.com/group/diybio.

To view this discussion on the web visit https://groups.google.com/d/msgid/diybio/d31f5e1b-6646-41c4-9d88-e2dcf1fb184d%40googlegroups.com.

[Cathal Garvey]

A problem you'll have here is throughput. While it's possible to get
some proteins (some!) to export by hijacking existing signals, the
throughput of these systems tends to be low, or inconsistent.

It's easier to get things to the periplasmic space, because the
transport systems for that are homologous to those used by G+ bacteria.
From there, you can do periplasmic rupture easily enough to release
somewhat low-contamination protein.

But, overall, it's not too rosy. This is something I hit a wall with
when researching IndieBB, because the colicinV operon is *mostly
transport proteins* and I wanted to instead re-use a generalised export
system used by cells for everything else, so I could have "world's
smallest selection cassette"... ugh, not really.

On 06/02/15 12:58, Filip Hasecke wrote:
> http://wolfson.huji.ac.il/expression/local/bacteria/Recombinant%20protein%20secretion%20in%20Escherichia%20coli-2005.pdf
>
> There is a big table in this document showing the used signal and the
> resulting cellular localization of the recombinant protein and a link to
> a publication. There are also a lot of signals resulting in the
> secretion of the peptide (localization = "medium").
>
> -Filip
>
> 2015-02-06 12:26 GMT+01:00 Mega [Andreas Stuermer]

> <masters...@gmail.com <mailto:masters...@gmail.com>>:

>
> "e coli signal peptide "
>
> may also be a good keyword.
>
> --
> -- You received this message because you are subscribed to the
> Google Groups DIYbio group. To post to this group, send email to

> diy...@googlegroups.com <mailto:diy...@googlegroups.com>. To

> unsubscribe from this group, send email to
> diybio+un...@googlegroups.com

> <mailto:diybio%2Bunsu...@googlegroups.com>. For more options,

> visit this group at https://groups.google.com/d/forum/diybio?hl=en

> Learn more at www.diybio.org <http://www.diybio.org>

> ---
> You received this message because you are subscribed to the Google
> Groups "DIYbio" group.
> To unsubscribe from this group and stop receiving emails from it,
> send an email to diybio+un...@googlegroups.com

> <mailto:diybio+un...@googlegroups.com>.

> To post to this group, send email to diy...@googlegroups.com

> <mailto:diy...@googlegroups.com>.

> Visit this group at http://groups.google.com/group/diybio.
> To view this discussion on the web visit
> https://groups.google.com/d/msgid/diybio/d31f5e1b-6646-41c4-9d88-e2dcf1fb184d%40googlegroups.com

> <https://groups.google.com/d/msgid/diybio/d31f5e1b-6646-41c4-9d88-e2dcf1fb184d%40googlegroups.com?utm_medium=email&utm_source=footer>.

>
> For more options, visit https://groups.google.com/d/optout.
>
>

> --
> -- You received this message because you are subscribed to the Google
> Groups DIYbio group. To post to this group, send email to
> diy...@googlegroups.com. To unsubscribe from this group, send email to
> diybio+un...@googlegroups.com. For more options, visit this group
> at https://groups.google.com/d/forum/diybio?hl=en
> Learn more at www.diybio.org
> ---
> You received this message because you are subscribed to the Google
> Groups "DIYbio" group.
> To unsubscribe from this group and stop receiving emails from it, send
> an email to diybio+un...@googlegroups.com

> <mailto:diybio+un...@googlegroups.com>.

> To post to this group, send email to diy...@googlegroups.com

> <mailto:diy...@googlegroups.com>.

> Visit this group at http://groups.google.com/group/diybio.
> To view this discussion on the web visit

> https://groups.google.com/d/msgid/diybio/CA%2BcYcYEFYBB4Fhzxk-5nnvS88SH1sVSCDWHXX2uB0YLzBB1p%2Bw%40mail.gmail.com
> <https://groups.google.com/d/msgid/diybio/CA%2BcYcYEFYBB4Fhzxk-5nnvS88SH1sVSCDWHXX2uB0YLzBB1p%2Bw%40mail.gmail.com?utm_medium=email&utm_source=footer>.

> For more options, visit https://groups.google.com/d/optout.

--
Scientific Director, IndieBio Irish Programme
Got a biology-inspired business idea that $50,000 -
& 3 months in a well equipped lab could accelerate?
Apply for the Summer programme in Ireland:
http://indie.bio/apply-to-ireland
Twitter: @onetruecathal
Phone: +353876363185
miniLock: JjmYYngs7akLZUjkvFkuYdsZ3PyPHSZRBKNm6qTYKZfAM
peerio.com: cathalgarvey

[Josiah Zayner]

The problem with this Jacob is that you are fighting against thermodynamics and metabolism. The amount of energy cost to export proteins is huge, in the folding, transport, generation of transport proteins. Also, one needs to think about ligands, which many proteins contain or need to fold. I think the reason that this avenue has not been explored thoroughly is that you will be trying to optimize many different processes with many bottlenecks. Also, disrupting cells using some detergent (SDS or something) and maybe some freeze-thawing is darn easy. It would probably be extremely difficult to match normal expression methods for the wide variety of proteins that people want to purify. This could be useful for some niche cases but usually that just involves slapping a signal peptide on the proteint.


Josiah

[Jacob Palumbo]

Slapping on a signal peptide is definitely something that could be done. But low throughput is a problem. Random autolysis could also serve the same purpose, as entire colonies would generally survive while individuals wouldn't necessarily.

Do you think overexpression of proteins tagged for secretion would place too much of a metabolic strain on the cell? Even with lower throughput, overexpressing a protein enough may get enough to secrete to be useful. Of course, that still doesn't solve the problem of ligands, as you mentioned.

Jake

[Nathan McCorkle]

On Fri, Feb 6, 2015 at 11:22 AM, Josiah Zayner <josiah...@gmail.com> wrote:
> The problem with this Jacob is that you are fighting against thermodynamics
> and metabolism.

I understand you're saying there's a burden from a 'natural'
bacteria-pulled-from-its-habitat perspective, but it seems ridiculous
when compared to how humans have transformed organisms with
agriculture. If the bacteria aren't doing what you want, the you
haven't engineered it properly. Thermodynamics, metabolism, entropy
are all things to think about, but the earth doesn't have a 'problem'
per-se... we're close to the sun, cold and entropy increases with the
distance from the sun, so we've got the energy.

> The amount of energy cost to export proteins is huge, in the
> folding, transport, generation of transport proteins. Also, one needs to
> think about ligands, which many proteins contain or need to fold. I think
> the reason that this avenue has not been explored thoroughly is that you
> will be trying to optimize many different processes with many bottlenecks.

I agree.

> Also, disrupting cells using some detergent (SDS or something) and maybe
> some freeze-thawing is darn easy.

But it isn't very interesting, is it? I mean, to me that's downright
boring... why waste my time doing extractions then discarding the
waste carcasses and having to deal with taking out the trash when I
could just spend some more time laying on the couch or slouching in my
office chair 'thinking' of how to just get the system to pump out when
glucose/energy is present?

If you're looking for a turn-key solution, then sure lysing cells
get's you there today in a snap... I guess I'm just not sure if that's
what the OP is interested in (the title of the thread /is/ exocytosis,
not protein expression/overexpression/purification).

[Nathan McCorkle]

On Fri, Feb 6, 2015 at 11:22 AM, Josiah Zayner <josiah...@gmail.com> wrote:

> Also, disrupting cells

Also AFAIK (and it's been years since I've gone looking) lysis is the
main detractor from using algae for biofuel, because cracking them
costs more than what is locked inside them.

[Josiah Zayner]

Jacob:
I am not saying it won't work. I am not saying I don't support any work you do, you know I do lots! What I am more saying is what kind of throughput do you want? What do you mean by useful? What problem are you trying to solve? Why are you trying to exocytose?

Overexpressing any protein places a metabolic strain on the cell. Some more than others. It is extremely difficult to understand why some proteins express easily at 100mg/L and other struggle for 1mg/L. I have worked with graduate students who spent months.years attempting to optimize the expression of a single protein.

Here is a olderish (2004) review on secretion systems usage in protein overexpression: https://drive.google.com/file/d/0B_R75gIJvkFUWVdjQU9aNnU3bVU/view?usp=sharing

Nathan:

>I understand you're saying there's a burden from a 'natural'
>bacteria-pulled-from-its-

>habitat perspective, but it seems ridiculous
>when compared to how humans have transformed organisms with
>agriculture. If the bacteria aren't doing what you want, the you
>haven't engineered it properly. Thermodynamics, metabolism, entropy
>are all things to think about, but the earth doesn't have a 'problem'
>per-se... we're close to the sun, cold and entropy increases with the
>distance from the sun, so we've got the energy.

Hmm, I don't know what you mean by the Earth not having a problem?

Proteins are difficult to engineer. If Scientists knew how to engineer proteins and metabolic pathways "properly" we probably wouldn't be having this discussion. Not even getting into how things are regulated on the DNA and RNA level, protein complexity is insane orders of magnitude beyond what we can test. Current best methods can look at 10^10-10^15 sequences. This means that one cannot even sample the entire sequence space for a 15 amino acid protein. Sure we can find local energy minima or local rate maxima in protein function optimization but I might be as brash to say that no protein we know of has ever achieved a global energy minima or rate maxima in function. There is a huge difference between what is possible and what is probable.

On a minorly related stream of thought, one question that interests me in my work is "What kind of sequence space have bacteria actually explored?" Anyone ever read a paper on this?

JZ

--

-- You received this message because you are subscribed to the Google Groups DIYbio group. To post to this group, send email to diy...@googlegroups.com. To unsubscribe from this group, send email to diybio+un...@googlegroups.com. For more options, visit this group at https://groups.google.com/d/forum/diybio?hl=en
Learn more at www.diybio.org
---

You received this message because you are subscribed to a topic in the Google Groups "DIYbio" group.
To unsubscribe from this topic, visit https://groups.google.com/d/topic/diybio/2eGsVtS7AoU/unsubscribe.
To unsubscribe from this group and all its topics, send an email to diybio+un...@googlegroups.com.

To post to this group, send email to diy...@googlegroups.com.

Visit this group at http://groups.google.com/group/diybio.

To view this discussion on the web visit https://groups.google.com/d/msgid/diybio/37c9638b-12ee-4662-9e43-d7ae9f3d26b7%40googlegroups.com.

[Jacob Palumbo]

In the study you linked the authors mention exactly the reason why I want to exocytose: "Another advantage is that correct formation of disulfide bonds can be facilitated because the periplasmic space provides a more oxidative environment than the cytoplasm." I want to secrete the exoskeletal proteins I'm working with for the iGEM project I mentioned earlier. The problem with having them remain inside the cell rather than being secreted is two-fold: one, because the inside of the cell is generally reducing, equilibrium is working against maximum crosslinking of the proteins by disulfide linkage, and two, because protein aggregation inside the cell means crosslinking will be disproportionately dense where cells used to be.
I'm going to attempt the type II pathway, just because it's the most commonly used. I'll report back if I get anything working.

As for protein design, I can personally attest to how difficult it is. We've spent months in the lab I work in just trying to get parameters right for stochastic simulations of protein folding. And if the protein requires any kind of covalent interaction with a ligand for folding, you have to use QM models, which are still extremely computationally heavy. Artificial selection seems like the best way to get a protein to optimize for the time being.

[Josiah Zayner]

As Cathal said, it is probably easier, more reliable and will give a greater amount of protein using a periplasmic sequence on the protein. I have worked with proteins that are disulfide bonded in bacterial cytoplasms or somewhere in the purification process. Though this is anecdotal it might be an easy first attempt to express and see what happens especially if you have an assay (enzymatic of some sort) or measurement (Flourescence, Circular Dichroism, NMR) to tell if the protein is folded correctly. Though if you have not even cloned the protein yet it might just be easier to order it with the periplasmic sequence then clone that in later.

Hope all is well,
     JZ