--
You received this message because you are subscribed to the Google Groups "3D Genomics" group.
To unsubscribe from this group and stop receiving emails from it, send an email to 3d-genomics+unsubscribe@googlegroups.com.
To view this discussion on the web visit https://groups.google.com/d/msgid/3d-genomics/96656e92-9996-4c6f-aff7-0f689942bbb6%40googlegroups.com.
For more options, visit https://groups.google.com/d/optout.
Skipping >1 dna:chromosome chromosome:GRCz10:1:1:58871917:1 REF
Skipping GATCTTAAACATTTATTCCCCCTGCAAACATTTTCAATCATTACATTGTCATTTCCCCTC
Skipping CAAATTAAATTTAGCCAGAGGCGCACAACATACGACCTCTAAAAAAGGTGCTGTAACATG
Skipping TACCTATATGCAGCACCACTATATGAGAGCGGCATAGCAGTGTTTAGTCACTTGGTTGCT
...
Unable to find proper file via VIA_ID
motifs <genomeID> <bed_file_dir> <looplist> [custom_global_motif_list]I putted bowtie index here for <genomeID> but I saw the warning messages without this option just announced that it needs chromosomal size fileCould not find chromosome sizes file for: zebrafish
Hello,Please have a look at the documentation here:BestNeva
On Thu, Sep 7, 2017 at 10:38 PM, Aoi Summer <stca...@gmail.com> wrote:
Hi,I'm trying to analysis zebrafish HiC data by Juicer, and was stuck running motif finder. I used FIMO to creat a CTCF bed file from zebrafish genome. But have no idea how to prepare files needed in unique and inferred folder. Is there any suggestion? I just want to annotate CTCF locations for the hic files.BestAoi
--
You received this message because you are subscribed to the Google Groups "3D Genomics" group.
To unsubscribe from this group and stop receiving emails from it, send an email to 3d-genomics...@googlegroups.com.
To view this discussion on the web visit https://groups.google.com/d/msgid/3d-genomics/96656e92-9996-4c6f-aff7-0f689942bbb6%40googlegroups.com.
For more options, visit https://groups.google.com/d/optout.
To unsubscribe from this group and stop receiving emails from it, send an email to 3d-genomics+unsubscribe@googlegroups.com.
To view this discussion on the web visit https://groups.google.com/d/msgid/3d-genomics/d353c826-e78d-49bf-972f-d0cc1b90fc73%40googlegroups.com.
For more options, visit https://groups.google.com/d/optout.