Media triumph: petrol burns for Yorkshire woman

[DVH]

The timing couldn't be better. A horrific, yet heaven-sent story of a woman
suffering 40% burns while transferring petrol will have Labour and the
newspapers squirming with delight.

http://news.sky.com/home/uk-news/article/16199277

[sutartsorric]

You mean, just like you are?

[Phister]

Was she smoking at the time ?

--
DNA signature encryption key........
ATTGGTGCATTACTTCAGGCTCT

[Richard McKenzie]

I didnt realise that you are only allowed to store by law 2 x 5 litre
plastic containers of petrol (2x 10 litres if it is a metal container)
and they must be in a shed or store out sife the home.

[Jahbulon]

"DVH" <d...@vhvhvhvh.com> wrote in news:F3fdr.47319$ch4....@fx17.am4:

> A horrific, yet heaven-sent story of a woman suffering
> 40% burns while transferring petrol will have Labour
> and the newspapers squirming with delight.
>
> http://news.sky.com/home/uk-news/article/16199277

And the Tory/Lib Dem siding with Purdy over allowing even more immigrants,
that was not cheap opportunism?

--

Praise be to Jahbulon, holy god of Royal Arch Freemasons

http://www.freemasonrywatch.org/jahbulon.html

[Richard McKenzie]

On Mar 30, 10:31 am, "DVH" <d...@vhvhvhvh.com> wrote:

I love the statement by Sky.

"However, somehow the petrol ignited and set fire to her."

and

"It is unclear whether the woman's actions were the response of advice
given by the Government."

Maybe she was pouring it to drink.

[DVH]

"Phister" <phi...@inbox.com> wrote in message
news:6fidnYUIN91z4ujS...@bt.com...

> Was she smoking at the time ?

I checked her Facebook profile and she wasn't that hot.

[DVH]

"Jahbulon" <inv...@invalid.net> wrote in message
news:XnsA02671D9C76EE...@69.16.185.250...

> "DVH" <d...@vhvhvhvh.com> wrote in news:F3fdr.47319$ch4....@fx17.am4:
>
>> A horrific, yet heaven-sent story of a woman suffering
>> 40% burns while transferring petrol will have Labour
>> and the newspapers squirming with delight.
>>
>> http://news.sky.com/home/uk-news/article/16199277
>
> And the Tory/Lib Dem siding with Purdy over allowing even more immigrants,
> that was not cheap opportunism?

I confess I don't know who Purdy is...

[Michael Swift]

In article <6fidnYUIN91z4ujS...@bt.com>, Phister
<phi...@inbox.com> writes

>Was she smoking at the time ?

No, but according to Ceefax news she was doing it in the kitchen and the
gas ring was lit, one up to Darwinism.

Mike

--
Michael Swift We do not regard Englishmen as foreigners.
Kirkheaton We look on them only as rather mad Norwegians.
Yorkshire Halvard Lange

[sutartsorric]

On Mar 30, 11:18 am, Michael Swift <mike.sw...@yeton.co.uk> wrote:
> In article <6fidnYUIN91z4ujSnZ2dnUVZ8mudn...@bt.com>, Phister
> <phis...@inbox.com> writes

>
> >Was she smoking at the time ?
>
> No, but according to Ceefax news she was doing it in the kitchen and the
> gas ring was lit, one up to Darwinism.
>
> Mike
>
> --
> Michael Swift           We do not regard Englishmen as foreigners.
> Kirkheaton              We look on them only as rather mad Norwegians.
> Yorkshire                                       Halvard Lange

Crikey! You have Ceefax in Yorkshire, already?

[Richard McKenzie]

Im in Cumbria its only recently that they stopped pointing at planes

[Richard McKenzie]

On Mar 30, 11:18 am, Michael Swift <mike.sw...@yeton.co.uk> wrote:
> In article <6fidnYUIN91z4ujSnZ2dnUVZ8mudn...@bt.com>, Phister

> <phis...@inbox.com> writes

>
> >Was she smoking at the time ?
>
> No, but according to Ceefax news she was doing it in the kitchen and the
> gas ring was lit, one up to Darwinism.
>
> Mike
>
> --
> Michael Swift           We do not regard Englishmen as foreigners.
> Kirkheaton              We look on them only as rather mad Norwegians.
> Yorkshire                                       Halvard Lange

I recall in CSYS Chemistry a friend was heating up petrol, the fume
cupboard set alight!

[Sgt. Pinback]

"DVH" <d...@vhvhvhvh.com> wrote in message
news:jMfdr.28482$o93....@fx05.am4...

TV character played by Joanna Lumley years ago.

[DVH]

"Sgt. Pinback" <e...@off.com> wrote in message
news:OvudnYzxIeX-D-jS...@eclipse.net.uk...

Oh. In that case, no.

The fundamental purpose of being a country is to secure one's land and
people against the marauding huns. Anyone contributing directly to achieving
that purpose gets special treatment.

The sight of Woolas looking a fool was just an added extra.

[Ophelia]

"DVH" <d...@vhvhvhvh.com> wrote in message

news:F3fdr.47319$ch4....@fx17.am4...

.. and it is all the gov's fault!!!!!

--
http://www.shop.helpforheroes.org.uk/

[Ophelia]

"Phister" <phi...@inbox.com> wrote in message
news:6fidnYUIN91z4ujS...@bt.com...

> Was she smoking at the time ?

She transferred petrol from on container to another in the kitchen with her
cooker on ...

Of course... gov told her to do exactly that!
--
http://www.shop.helpforheroes.org.uk/

[Mike P]

On Fri, 30 Mar 2012 13:50:31 +0100, Ophelia drooled:

> "DVH" <d...@vhvhvhvh.com> wrote in message
> news:F3fdr.47319$ch4....@fx17.am4...
>> The timing couldn't be better. A horrific, yet heaven-sent story of a
>> woman suffering 40% burns while transferring petrol will have Labour
>> and the newspapers squirming with delight.
>>
>> http://news.sky.com/home/uk-news/article/16199277
>
> .. and it is all the gov's fault!!!!!

Well, it is really. Being the government, they have to take into account
the less intelligent in society, and Maude clearly didn't when he made
his comment.

You or I might have the nouse to store petrol safely, but thousands
don't..

[Big Les Wade]

DVH <d...@vhvhvhvh.com> posted

If she had not existed, it would have been necessary to invent her.

I wonder what her name is.

--
Les

[Ophelia]

"Mike P" <n...@here.com> wrote in message news:jl4ai1$ajn$5...@dont-email.me...

> On Fri, 30 Mar 2012 13:50:31 +0100, Ophelia drooled:
>
>> "DVH" <d...@vhvhvhvh.com> wrote in message
>> news:F3fdr.47319$ch4....@fx17.am4...
>>> The timing couldn't be better. A horrific, yet heaven-sent story of a
>>> woman suffering 40% burns while transferring petrol will have Labour
>>> and the newspapers squirming with delight.
>>>
>>> http://news.sky.com/home/uk-news/article/16199277
>>
>> .. and it is all the gov's fault!!!!!

> ans

> Well, it is really. Being the government, they have to take into account
> the less intelligent in society, and Maude clearly didn't when he made
> his comment.
>
> You or I might have the nouse to store petrol safely, but thousands
> don't..

Suppose I can't argue about the nouse of the general public but for heavens
sake ... anyway, she wasn't storing it, she was bloody well tranferring it
from one container to another???? I mean wouldn't the smell alone in your
kitchen put you off doing that??


--
http://www.shop.helpforheroes.org.uk/

[R. Thompson]

I bet the legal vultures are homing in on her now, ready to bring the
case to court.
Compensation for being less than intelligent perhaps?

[sutartsorric]

I think her name is Petronella Blazes

[Ophelia]

"Big Les Wade" <L...@nowhere.com> wrote in message
news:qXgpyeNR...@obviously.invalid...

I could think of a few names but it might not be kind since she suffered 40%
burns.

--
http://www.shop.helpforheroes.org.uk/

[Mrcheerful]

many years ago a neighbour was stripping lino tiles in his kitchen, he ran
out of the special solvent, so used petrol instead, the washing machine was
running and a spark from the brushes or the timer caused a large explosion
which blew the manhole covers off for the surrounding houses, burnt out the
kitchen and put him in hospital. He was not too bright, a pleasant bloke to
know, but ....

[steve robinson]

Its amazing how moronic some people are, we all know how volatile
petrol is ,

[The Todal]

"steve robinson" <st...@colevalleyinteriors.co.uk> wrote in message
news:xn0hw7my...@reader80.eternal-september.org...

Many years ago I tried to light a fire in the garden, in one of those garden
incinerators which looks like a metal dustbin with a lid fitted with a
chimney. It simply wouldn't light and in frustration I poured some petrol
through the "chimney" at the top.

The next thing I remember was an enormous bang, the lid had risen about 15
feet into the air and I was, mysteriously, lying at a considerable distance
from the incinerator. Uninjured but dazed.

Moronic? Moi?

[Big Les Wade]

steve robinson <st...@colevalleyinteriors.co.uk> posted

>Its amazing how moronic some people are, we all know how volatile
>petrol is ,

But what is happening now is that people with an axe to grind - e.g. FBU
- are hinting that *all* storage of petrol is dangerous, even in
jerrycans, just so that they can get the knife into Francis Maude.

Millions of people have stored petrol in cans in their garages for
decades with next to no safety risk. Quite aside from anything else, you
need it if you have a petrol lawnmower.


--
Les

[Norman Wells]

I'm not sure about that. I don't know anything about the woman, but
it's prefectly possible that she's never played with petrol before,
quite possibly because she's never been allowed to under all the health
and safety legislation we have. When do you get an opportunity to
experiment with anything even a little bit dangerous these days?

[sutartsorric]

Thats right. I have a petrol strimmer for the paths around our
allotment. I have a gallon can full of petrol stored for that and it
causes no problems as I only pour the petrol from can to the small
strimmer tank in the open air.

It is the petrol vapour that ignites with such force, and petrol will
vapourise readily at room temperature.

[steve robinson]

That answers many questions , now we all know why your a
cantancourous bugger you suffered brain damage :)

[steve robinson]

Just reading all the literature and signs around fuel stations , car
handbooks even in the press should give you an inkling , plus the
fact she drives a car with an internal COMBUSTION engine

[DVH]

"Ophelia" <Oph...@Elsinore.me.uk> wrote in message
news:9tlpmp...@mid.individual.net...

Q: How d'you make a Yorkshirewoman go Woof!

[DVH]

"Big Les Wade" <L...@nowhere.com> wrote in message
news:qXgpyeNR...@obviously.invalid...

Ethyl Burns.

[JohnR]

Just so, I can see this being a golden opportunity for those scummy
authoritarian types who look for such opportunities.

[JohnR]

Don't think it's wise to assume that people who drive cars have the
first clue how they actually work. It's just a seat, wheel and pedals to
many imho.

[R. Thompson]

Priceless!

[Norman Wells]

steve robinson wrote:
> Norman Wells wrote:

>>> Its amazing how moronic some people are, we all know how volatile
>>> petrol is ,
>>
>> I'm not sure about that. I don't know anything about the woman,
>> but it's prefectly possible that she's never played with petrol
>> before, quite possibly because she's never been allowed to under
>> all the health and safety legislation we have. When do you get an
>> opportunity to experiment with anything even a little bit dangerous
>> these days?
>
> Just reading all the literature and signs around fuel stations , car
> handbooks even in the press should give you an inkling , plus the
> fact she drives a car with an internal COMBUSTION engine

Well yes, but it may well be a diesel, and I think diesel is rather more
difficult to set aflame. She had bought the petrol for her daughter.
Anyway, none of what you say is 'experimentation', which is the way real
lessons are learnt.

In any case, she may well have been so saturated with stupid wolf-crying
health and safety warnings in the past like 'may contain nuts' that,
like most of us, she took none of them seriously any more.

[Norman Wells]

Maybe, but petrol is not ethyl anything, but largely a mixture of
octanes.

However, I do accept that Mixture of Octanes Burns doesn't work
tremendously well as a joke.

[The Todal]

"steve robinson" <st...@colevalleyinteriors.co.uk> wrote in message

news:xn0hw7oh...@reader80.eternal-september.org...

Yup :)

[R. Thompson]

Not quite accurate Norman but you're right about killing the joke.

https://en.wikipedia.org/wiki/Ethanol_fuel

[Richard McKenzie]

On Mar 30, 2:09 pm, "Ophelia" <Ophe...@Elsinore.me.uk> wrote:
> "Mike P" <n...@here.com> wrote in messagenews:jl4ai1$ajn$5...@dont-email.me...

> --http://www.shop.helpforheroes.org.uk/- Hide quoted text -
>
> - Show quoted text -

http://uk.news.yahoo.com/woman-burned-while-decanting-petrol-091318813.html

Apparently there is more

..A woman who was badly burned when petrol ignited as she transferred
it between containers in her kitchen has been named by neighbours.

Diane Hill, of Acomb, York, was decanting petrol from one container to
another when vapours ignited and set fire to her clothing, North
Yorkshire Fire and Rescue Service said.

It is thought she may have had the cooker on as she transferred the
fuel from "an appropriate petrol container" to a glass jug.

Next-door neighbour Margot Johnston, 86, said: "I had been gardening
and came in to make myself a cup of tea and I was aware of a cloud of
smoke coming over the hedge.

"I thought because it was a lovely day that they must be having a
barbecue. THEN I NOTICED THERE WAS SOMEONE IN THE GARDEN IN THE GARDEN
WHO SEEMED TO BE ON FIRE.

"One of the daughters was in the garden and I said 'Have you phoned
for the ambulance?' and she said she had. Even all through the war I
had never seen anything like it."

Ms Johnston added that both of her neighbour's daughters, Lauren and
Grace, were in the garden at the time of the incident.

She said: "Diane had obviously got home and started to cook dinner
while decanting petrol.

"Diane was conscious the whole time. They put her in the ambulance and
took her away."

Asked whether the threat of strikes by oil tanker drivers or poor
advice from the Government were to blame, Ms Johnston said: "People
are to blame for panicking, for panic-buying."

..

[Richard McKenzie]

> Compensation for being less than intelligent perhaps?- Hide quoted text -

>
> - Show quoted text -

If she had her sat nav on no doubt it would be to blame

[sutartsorric]

On Mar 30, 4:17 pm, Richard McKenzie

<richardmckenzi...@googlemail.com> wrote:


> She said: "Diane had obviously got home and started to cook dinner
> while decanting petrol.

Obviously! We do that kind of thing all the time. Decanted petrol -
cant beat it.

>
> "Diane was conscious the whole time. They put her in the ambulance and
> took her away."

It is debateable whether a person who comes home and decants petrol in
her kitchen qualifies as reaching the "conscious" level any of the
time.

But it was Yorkshire, so allowances must be made.

[Phi]

Natural de-selection

[Phi]

Clearly, she didn't think about the contamination of food either.

[Bod]

On 30/03/2012 10:42, Phister wrote:
> Was she smoking at the time ?
>
>
I think she cut out the formalities and just burst into flames.

--
Bod

[Bod]

On 30/03/2012 14:02, Big Les Wade wrote:
> DVH <d...@vhvhvhvh.com> posted

>> The timing couldn't be better. A horrific, yet heaven-sent story of a
>> woman
>> suffering 40% burns while transferring petrol will have Labour and the
>> newspapers squirming with delight.
>>
>> http://news.sky.com/home/uk-news/article/16199277
>>
>

> If she had not existed, it would have been necessary to invent her.
>
> I wonder what her name is.
>
>

Blaze?

--
Bod

[sutartsorric]

There's nothing like repeating something that has already appeared on
the same thread about three hours previously.

Do read the thread before trying to be 'clever'.

[Ophelia]

"The Todal" <deadm...@beeb.net> wrote in message
news:9tlreq...@mid.individual.net...

Glory be to St Patrick and all the saints !!!!!!!!!!!!


--
http://www.shop.helpforheroes.org.uk/

[Ophelia]

"Big Les Wade" <L...@nowhere.com> wrote in message

news:iGs72lPg...@obviously.invalid...

Quite so!
--
http://www.shop.helpforheroes.org.uk/

[Ophelia]

"steve robinson" <st...@colevalleyinteriors.co.uk> wrote in message
news:xn0hw7my...@reader80.eternal-september.org...
> Ophelia wrote:
>
>>

>> "Big Les Wade" <L...@nowhere.com> wrote in message

>> news:qXgpyeNR...@obviously.invalid... >DVH <d...@vhvhvhvh.com>
>> posted
>> > > The timing couldn't be better. A horrific, yet heaven-sent
>> > > story of a woman suffering 40% burns while transferring petrol
>> > > will have Labour and the newspapers squirming with delight.
>> > >
>> > > http://news.sky.com/home/uk-news/article/16199277
>> > >
>> >
>> > If she had not existed, it would have been necessary to invent
>> > her.
>> >
>> > I wonder what her name is.
>>
>> I could think of a few names but it might not be kind since she
>> suffered 40% burns.
>

> Its amazing how moronic some people are, we all know how volatile
> petrol is ,

You would think so eh?


--
http://www.shop.helpforheroes.org.uk/

[Ophelia]

"DVH" <d...@vhvhvhvh.com> wrote in message

news:cujdr.84461$IZ3....@fx11.am4...

I don't know but be VERY careful how you respond to this ....

O, a Yorkshire lassie

--
http://www.shop.helpforheroes.org.uk/

[abelard]

On Fri, 30 Mar 2012 14:05:57 +0100, "Mrcheerful"
<g.odon...@yahoo.co.uk> wrote:

>Mike P wrote:
>> On Fri, 30 Mar 2012 13:50:31 +0100, Ophelia drooled:
>>
>>> "DVH" <d...@vhvhvhvh.com> wrote in message
>>> news:F3fdr.47319$ch4....@fx17.am4...
>>>> The timing couldn't be better. A horrific, yet heaven-sent story of
>>>> a woman suffering 40% burns while transferring petrol will have
>>>> Labour and the newspapers squirming with delight.
>>>>
>>>> http://news.sky.com/home/uk-news/article/16199277
>>>
>>> .. and it is all the gov's fault!!!!!
>>

>> Well, it is really. Being the government, they have to take into
>> account the less intelligent in society, and Maude clearly didn't
>> when he made his comment.
>>
>> You or I might have the nouse to store petrol safely, but thousands
>> don't..
>

>many years ago a neighbour was stripping lino tiles in his kitchen, he ran
>out of the special solvent, so used petrol instead, the washing machine was
>running and a spark from the brushes or the timer caused a large explosion
>which blew the manhole covers off for the surrounding houses, burnt out the
>kitchen and put him in hospital. He was not too bright, a pleasant bloke to
>know, but ....

as long as socialists exist it is obvious petrol should be banned

--
web site at www.abelard.org - news comment service, logic, economics
energy, education, politics, etc over 1 million document calls in year past
--------------------------------------------------------------------------------
all that is necessary for [] walk quietly and carry
the triumph of evil is that [] a big stick.
good people do nothing [] trust actions not words
only when it's funny -- roger rabbit
--------------------------------------------------------------------------------

[abelard]

On Fri, 30 Mar 2012 14:02:09 +0100, Big Les Wade <L...@nowhere.com>
wrote:

>DVH <d...@vhvhvhvh.com> posted

>>The timing couldn't be better. A horrific, yet heaven-sent story of a woman
>>suffering 40% burns while transferring petrol will have Labour and the
>>newspapers squirming with delight.
>>
>>http://news.sky.com/home/uk-news/article/16199277
>>
>

>If she had not existed, it would have been necessary to invent her.
>
>I wonder what her name is.
>

>--
>Les

or maybe less

[abelard]

On Fri, 30 Mar 2012 13:31:34 +0000 (UTC), "steve robinson"
<st...@colevalleyinteriors.co.uk> wrote:

>Ophelia wrote:
>
>>
>> "Big Les Wade" <L...@nowhere.com> wrote in message
>> news:qXgpyeNR...@obviously.invalid... >DVH <d...@vhvhvhvh.com>

>> posted
>> > > The timing couldn't be better. A horrific, yet heaven-sent
>> > > story of a woman suffering 40% burns while transferring petrol
>> > > will have Labour and the newspapers squirming with delight.
>> > >
>> > > http://news.sky.com/home/uk-news/article/16199277
>> > >
>> >
>> > If she had not existed, it would have been necessary to invent
>> > her.
>> >
>> > I wonder what her name is.
>>

>> I could think of a few names but it might not be kind since she
>> suffered 40% burns.
>
>Its amazing how moronic some people are, we all know how volatile
>petrol is ,

how volatile is it?

[Basil Jet]

40% burns on a Yorkshire woman! I didn't know there was enough petrol in
the country to burn that much skin.

[abelard]

On Fri, 30 Mar 2012 14:40:42 +0100, "The Todal" <deadm...@beeb.net>
wrote:

>
>"steve robinson" <st...@colevalleyinteriors.co.uk> wrote in message
>news:xn0hw7my...@reader80.eternal-september.org...

>> Ophelia wrote:
>>
>>>
>>> "Big Les Wade" <L...@nowhere.com> wrote in message
>>> news:qXgpyeNR...@obviously.invalid... >DVH <d...@vhvhvhvh.com>
>>> posted

>>> > > The timing couldn't be better. A horrific, yet heaven-sent
>>> > > story of a woman suffering 40% burns while transferring petrol
>>> > > will have Labour and the newspapers squirming with delight.
>>> > >
>>> > > http://news.sky.com/home/uk-news/article/16199277
>>> > >
>>> >

>>> > If she had not existed, it would have been necessary to invent
>>> > her.
>>> >
>>> > I wonder what her name is.
>>>
>>> I could think of a few names but it might not be kind since she
>>> suffered 40% burns.
>>
>> Its amazing how moronic some people are, we all know how volatile
>> petrol is ,
>

>Many years ago I tried to light a fire in the garden, in one of those garden
>incinerators which looks like a metal dustbin with a lid fitted with a
>chimney. It simply wouldn't light and in frustration I poured some petrol
>through the "chimney" at the top.
>
>The next thing I remember was an enormous bang, the lid had risen about 15
>feet into the air and I was, mysteriously, lying at a considerable distance
>from the incinerator. Uninjured but dazed.
>
>Moronic? Moi?

were you practicing to join the jihadis?

[®i©ardo]

On 30/03/2012 13:56, Mike P wrote:
> On Fri, 30 Mar 2012 13:50:31 +0100, Ophelia drooled:
>
>> "DVH"<d...@vhvhvhvh.com> wrote in message
>> news:F3fdr.47319$ch4....@fx17.am4...

>>> The timing couldn't be better. A horrific, yet heaven-sent story of a
>>> woman suffering 40% burns while transferring petrol will have Labour
>>> and the newspapers squirming with delight.
>>>
>>> http://news.sky.com/home/uk-news/article/16199277
>>

>> .. and it is all the gov's fault!!!!!
>

> Well, it is really. Being the government, they have to take into account
> the less intelligent in society, and Maude clearly didn't when he made
> his comment.
>
> You or I might have the nouse to store petrol safely, but thousands
> don't..

The trouble, as they say around here, you can't educate pork, so, as in
this case, when it ended up as crackling it was self-inflicted stupidity.


--
Moving things in still pictures

[abelard]

On Fri, 30 Mar 2012 14:54:28 +0100, "Norman Wells" <h...@unseen.ac.am>
wrote:

>steve robinson wrote:
>> Ophelia wrote:
>>
>>>
>>> "Big Les Wade" <L...@nowhere.com> wrote in message
>>> news:qXgpyeNR...@obviously.invalid... >DVH <d...@vhvhvhvh.com>
>>> posted

>>>>> The timing couldn't be better. A horrific, yet heaven-sent
>>>>> story of a woman suffering 40% burns while transferring petrol
>>>>> will have Labour and the newspapers squirming with delight.
>>>>>
>>>>> http://news.sky.com/home/uk-news/article/16199277
>>>>>
>>>>

>>>> If she had not existed, it would have been necessary to invent
>>>> her.
>>>>
>>>> I wonder what her name is.
>>>
>>> I could think of a few names but it might not be kind since she
>>> suffered 40% burns.
>>
>> Its amazing how moronic some people are, we all know how volatile
>> petrol is ,
>

>I'm not sure about that. I don't know anything about the woman, but
>it's prefectly possible that she's never played with petrol before,
>quite possibly because she's never been allowed to under all the health
>and safety legislation we have. When do you get an opportunity to
>experiment with anything even a little bit dangerous these days?

are you arguing that she should have been allowed to practice on
dynamite?

[abelard]

On Fri, 30 Mar 2012 14:31:38 +0000 (UTC), "steve robinson"
<st...@colevalleyinteriors.co.uk> wrote:

>Norman Wells wrote:
>
>> steve robinson wrote:
>> > Ophelia wrote:
>> >
>> > >
>> >>"Big Les Wade" <L...@nowhere.com> wrote in message
>> > > news:qXgpyeNR...@obviously.invalid... >DVH
>> > > <d...@vhvhvhvh.com> posted
>> > > > > The timing couldn't be better. A horrific, yet heaven-sent
>> > > > > story of a woman suffering 40% burns while transferring
>> > > > > petrol will have Labour and the newspapers squirming with
>> > > > > delight.
>> > > > >
>> > > > > http://news.sky.com/home/uk-news/article/16199277
>> > > > >
>> > > >
>> > > > If she had not existed, it would have been necessary to invent
>> > > > her.
>> > > >
>> > > > I wonder what her name is.
>> > >
>> > > I could think of a few names but it might not be kind since she
>> > > suffered 40% burns.
>> >
>> > Its amazing how moronic some people are, we all know how volatile
>> > petrol is ,
>>
>> I'm not sure about that. I don't know anything about the woman,
>> but it's prefectly possible that she's never played with petrol
>> before, quite possibly because she's never been allowed to under
>> all the health and safety legislation we have. When do you get an
>> opportunity to experiment with anything even a little bit dangerous
>> these days?
>

>Just reading all the literature and signs around fuel stations , car
>handbooks even in the press should give you an inkling , plus the
>fact she drives a car with an internal COMBUSTION engine

at least it isn't an internal explosion engine

[Ophelia]

"Basil Jet" <jo...@journeyflow.spamspam.com> wrote in message
news:4f75e4da$0$6414$5b6a...@news.zen.co.uk...

You ain't met this one then, pal! Oh yes, and, *thwap*


--
http://www.shop.helpforheroes.org.uk/

[Norman Wells]

abelard wrote:
> On Fri, 30 Mar 2012 14:54:28 +0100, "Norman Wells" h...@unseen.ac.am

>> I'm not sure about that. I don't know anything about the woman, but
>> it's prefectly possible that she's never played with petrol before,
>> quite possibly because she's never been allowed to under all the
>> health and safety legislation we have. When do you get an
>> opportunity to experiment with anything even a little bit dangerous
>> these days?
>
> are you arguing that she should have been allowed to practice on
> dynamite?

What's childhood for, if not a bit of fun?

[Zapp Brannigan]

"DVH" <d...@vhvhvhvh.com> wrote in message
news:F3fdr.47319$ch4....@fx17.am4...
> The timing couldn't be better. A horrific, yet heaven-sent story of a
> woman suffering 40% burns while transferring petrol will have Labour and
> the newspapers squirming with delight.
>
> http://news.sky.com/home/uk-news/article/16199277

Sky's North of England correspondent Gerard Tubb, in York, said: "Ms Hill
was tipping petrol from a plastic petrol container for which she did not
have a spout into the jug because her daughter, in her late teens or early
20s, needed petrol for her car. The vapour from the petrol in the
open-topped jug was ignited by the gas cooker which was on."

www.darwinawards.com

[Mentalguy2k8]

"Norman Wells" <h...@unseen.ac.am> wrote in message
news:G6mdr.95251$e07....@fx16.am4...

And if you make it into adulthood... then you learned well!

[Bod]

More like, ignorance.

--
Bod

[Joe]

On Fri, 30 Mar 2012 18:52:30 +0200
abelard <abel...@abelard.org> wrote:

> On Fri, 30 Mar 2012 13:31:34 +0000 (UTC), "steve robinson"
> <st...@colevalleyinteriors.co.uk> wrote:
>
> >Ophelia wrote:
> >
> >>
> >> "Big Les Wade" <L...@nowhere.com> wrote in message
> >> news:qXgpyeNR...@obviously.invalid... >DVH <d...@vhvhvhvh.com>
> >> posted
> >> > > The timing couldn't be better. A horrific, yet heaven-sent
> >> > > story of a woman suffering 40% burns while transferring petrol
> >> > > will have Labour and the newspapers squirming with delight.
> >> > >
> >> > > http://news.sky.com/home/uk-news/article/16199277
> >> > >
> >> >
> >> > If she had not existed, it would have been necessary to invent
> >> > her.
> >> >
> >> > I wonder what her name is.
> >>
> >> I could think of a few names but it might not be kind since she
> >> suffered 40% burns.
> >
> >Its amazing how moronic some people are, we all know how volatile
> >petrol is ,
>
> how volatile is it?
>

It has a flash point well below zero Celsius, meaning that at all
normally encountered temperatures it will evaporate well enough to form
an explosive mixture with air. The other common fire-related organics,
paraffin and diesel, have much higher flash points and will certainly
burn well but won't form the explosive mixture at normal temperatures.
If you drop a lighted match into them, they will burn enthusiastically,
but the match would never even hit the surface of petrol. The
petrol-air mixture is denser than air, and will spread across the
ground, towards, for example, a nearby oven.

But even in my day, school science didn't cover that kind of thing,
and it really isn't something you can experiment with. People who have
used petrol instead of paraffin on bonfires and barbecues know, at least
the ones still living.

--
Joe

[abelard]

well, at least i'm now at step towards now knowing
'how volatile petrol is'!
but i'm not sure of whether i count as 'all'
in order that my expertise is not found overbearing...

i should ask, is it as volatile as hydrogen in common uk kitchens?

regards

[Ian Jackson]

In message <9tloj3...@mid.individual.net>, Ophelia
<Oph...@Elsinore.me.uk> writes
>
>"Phister" <phi...@inbox.com> wrote in message
>news:6fidnYUIN91z4ujS...@bt.com...

>> Was she smoking at the time ?
>

>She transferred petrol from on container to another in the kitchen with
>her cooker on ...
>
>Of course... gov told her to do exactly that!

Do modern gas cookers have pilot lights? If so, maybe the cooker wasn't
actually on, but she forgot about the pilot light?
--
Ian

[Norman Wells]

Most adults do. And they benefit from it.

[Ophelia]

"Ian Jackson" <ianREMOVET...@g3ohx.demon.co.uk> wrote in message
news:rFRKh8Fi...@g3ohx.demon.co.uk...

Well, I read that she had the gas ring on, but whatever it was it was a big
mistake :( Apart from anything else, why in the world would anyone want to
decant petrol from on container into another ... her a kitchen!!! Hell the
smell should have knocked her out apart from the fumes igniting!

--
http://www.shop.helpforheroes.org.uk/

[sutartsorric]

On Mar 30, 9:07 pm, "Ophelia" <Ophe...@Elsinore.me.uk> wrote:
> "Ian Jackson" <ianREMOVETHISjack...@g3ohx.demon.co.uk> wrote in message
>
> news:rFRKh8Fi...@g3ohx.demon.co.uk...
>
> > In message <9tloj3Fgj...@mid.individual.net>, Ophelia
> > <Ophe...@Elsinore.me.uk> writes
>
> >>"Phister" <phis...@inbox.com> wrote in message

> >>news:6fidnYUIN91z4ujS...@bt.com...
> >>> Was she smoking at the time ?
>
> >>She transferred petrol from on container to another in the kitchen with
> >>her cooker on ...
>
> >>Of course... gov told her to do exactly that!
>
> > Do modern gas cookers have pilot lights? If so, maybe the cooker wasn't
> > actually on, but she forgot about the pilot light?
>
> Well, I read that she had the gas ring on, but whatever it was it was a big
> mistake :(  Apart from anything else, why in the world would anyone want to
> decant petrol from on container into another ... her a kitchen!!!  Hell the
> smell should have knocked her out apart from the fumes igniting!
>
> --http://www.shop.helpforheroes.org.uk/

Stop it now, you are making me worried.

I used to have an old Mk2 Cortina which must have had a small hole in
the petrol tank and after filling up at a petrol station the car would
smell of petrol, and yet we used to drive along smoking fags without
giving it another thought. Bugger, I could have been in a fireball.

[Basil Jet]

On 2012\03\30 21:07, Ophelia wrote:
>
> Well, I read that she had the gas ring on, but whatever it was it was a
> big mistake :( Apart from anything else, why in the world would anyone
> want to decant petrol from on container into another ... her a
> kitchen!!! Hell the smell should have knocked her out apart from the
> fumes igniting!

Some people have no sense of smell.

[Michael Swift]

In article <4f76bd2a$0$10730$5b6a...@news.zen.co.uk>, Basil Jet
<jo...@journeyflow.spamspam.com> writes

Some people have no sense, full stop.

Mike

--
Michael Swift We do not regard Englishmen as foreigners.
Kirkheaton We look on them only as rather mad Norwegians.
Yorkshire Halvard Lange

[abelard]

that doesn't stop chloroform working....

and some adventurous souls even sniff for kicks...

[sutartsorric]

On Mar 31, 11:08 am, Michael Swift <mike.sw...@yeton.co.uk> wrote:
> In article <4f76bd2a$0$10730$5b6aa...@news.zen.co.uk>, Basil Jet

It was not the vapour igniting that directly produced the 40% burns.

It was because either she jumped because of the sudden fireball, or
she panicked, or both, and she spilled some petrol on herself. This
also ignited and burnt her.

[Basil Jet]

On 2012\03\31 11:08, Michael Swift wrote:
> In article <4f76bd2a$0$10730$5b6a...@news.zen.co.uk>, Basil Jet
> <jo...@journeyflow.spamspam.com> writes
>>> Well, I read that she had the gas ring on, but whatever it was it was a
>>> big mistake :( Apart from anything else, why in the world would anyone
>>> want to decant petrol from on container into another ... her a
>>> kitchen!!! Hell the smell should have knocked her out apart from the
>>> fumes igniting!
>>
>> Some people have no sense of smell.

Anosmia

> Some people have no sense, full stop.

Me a anus.

[Steve Firth]

Ian Jackson <ianREMOVET...@g3ohx.demon.co.uk> wrote:
> In message <9tloj3...@mid.individual.net>, Ophelia <Oph...@Elsinore.me.uk> writes

[snip]

>> She transferred petrol from on container to another in the kitchen with >her cooker on ...
>>
>> Of course... gov told her to do exactly that!

Err no they didn't.

> Do modern gas cookers have pilot lights? If so, maybe the cooker wasn't
> actually on, but she forgot about the pilot light?

No, and as far as I recall pilot lights were never a feature of "cookers".
I do recall that they once featured on ovens, back when dinosaurs ruled the
land.

[Steve Firth]

abelard <abel...@abelard.org> wrote:
[snip]

> well, at least i'm now at step towards now knowing
> 'how volatile petrol is'!
> but i'm not sure of whether i count as 'all'
> in order that my expertise is not found overbearing...

Be assured that I am fully prepared to accept any of your admissions of
complete ignorance without requiring any further proof than that of your
previous posts to usenet.

[Janet]

In article <83357047354896525.205703%steve%-mallo...@news.eternal-
september.org>, %steve%@malloc.co.uk says...

>
> Ian Jackson <ianREMOVET...@g3ohx.demon.co.uk> wrote:
> > In message <9tloj3...@mid.individual.net>, Ophelia <Oph...@Elsinore.me.uk> writes
>
> [snip]
>
> >> She transferred petrol from on container to another in the kitchen with >her cooker on ...
> >>
> >> Of course... gov told her to do exactly that!
>
> Err no they didn't.
>
> > Do modern gas cookers have pilot lights? If so, maybe the cooker wasn't
> > actually on, but she forgot about the pilot light?
>
> No, and as far as I recall pilot lights were never a feature of "cookers".

Many gas hobs still ignite from a standing pilot light flame.

Janet.

[JohnR]

Is that really true? I don't know of any, which I know doesn't mean
much, but surely anyone from the 20th century and beyond would have a
spark ignition where that is an option.

[Ophelia]

"Steve Firth" <%steve%@malloc.co.uk> wrote in message
news:83357047354896525.205703%steve%-mallo...@news.eternal-september.org...

> Ian Jackson <ianREMOVET...@g3ohx.demon.co.uk> wrote:
>> In message <9tloj3...@mid.individual.net>, Ophelia
>> <Oph...@Elsinore.me.uk> writes
>
> [snip]
>
>>> She transferred petrol from on container to another in the kitchen with
>>> >her cooker on ...
>>>
>>> Of course... gov told her to do exactly that!
>
> Err no they didn't.

I was being sarcastic. Has anyone else noticed that when the bbe gives
the news, they say 'The goverment has changed their advice on the storage of
petrol ... AGAIN!!!

Every damned time!!

>
>> Do modern gas cookers have pilot lights? If so, maybe the cooker wasn't
>> actually on, but she forgot about the pilot light?
>
> No, and as far as I recall pilot lights were never a feature of "cookers".
> I do recall that they once featured on ovens, back when dinosaurs ruled
> the
> land.

I haven't seen a cooker with a pilot light for years. The ones I have seen
(and have) use an ignition system.


--
http://www.shop.helpforheroes.org.uk/

[Andy Burns]

JohnR wrote:

> On 31/03/2012 16:17, Janet wrote:
>

>> %steve%@malloc.co.uk says...

>>
>>> as far as I recall pilot lights were never a feature of "cookers".
>>
>> Many gas hobs still ignite from a standing pilot light flame.
>>

> Is that really true? I don't know of any, which I know doesn't mean
> much, but surely anyone from the 20th century and beyond would have a
> spark ignition where that is an option.

I don't know how many will *still* exist, but presumably more than zero.

I remember free-standing cookers with a central pilot light and metal
tubes leading to each burner. In at least one student hovel we had a
cooker with a "gas wand" that you could light from the top pilot light
for lighting the oven.

[Ophelia]

"Andy Burns" <usenet....@adslpipe.co.uk> wrote in message
news:ya-dnX7OwNHAterS...@brightview.co.uk...

Heh I remember those:)


--
http://www.shop.helpforheroes.org.uk/

[Paul Cummins]

We were about to embark at Dover, when H...@invalid.net (Janet) came up to
me and whispered:

>
> Many gas hobs still ignite from a standing pilot light flame.

I've never come across one. Can you exemplify please?

--
Paul Cummins - Always a NetHead
Wasting Bandwidth since 1981
IF you think this http://bit.ly/u5EP3p is cruel
please sign this http://bit.ly/sKkzEx

---- If it's below this line, I didn't write it ----

[Charles Bryant]

In article <gVjdr.49098$ch4....@fx17.am4>,
Norman Wells <h...@unseen.ac.am> wrote:
} and I think diesel is rather more
}difficult to set aflame.

In one sense it is (and that is the sense which is important here). If
you spill petrol, unless there is good ventilation to prevent it
accumulating, the evaporating vapour will explode if an ignition
source is presented. This will happen above about -40 degress, which
is just about anywhere on Earth you're likely to be. Diesel, however,
only does this at a temperature over at least 50 degrees, so nowhere
you're likely to be. This is the "flash point".

However, in another sense petrol is harder to burn. If you want it to
burn *without* a source of ignition (e.g. in a diesel engine where the
fuel must be ignited by merely being heated by compression), petrol
must be heated to 280 degrees while diesel only to 210. This is the
autoignition temperature. And this is why you can't drive a diesel-engined
vehicle for long if you put petrol in the tank by mistake.

The low flash point of petrol means it is very dangerous to store or
handle in an an enclosed space as any leak can easily lead to an
explosive mixture. Filling stations have a very open design to ensure
that the vapour from any small spills is immediately dispersed.

[Stephen Wolstenholme]

On Sat, 31 Mar 2012 18:40 +0100 (BST), uset...@stedtelephone.invalid
(Paul Cummins) wrote:

>We were about to embark at Dover, when H...@invalid.net (Janet) came up to
>me and whispered:
>
>>
>> Many gas hobs still ignite from a standing pilot light flame.
>
>I've never come across one. Can you exemplify please?

We had one ages ago that had a pilot light in the centre of the hob
and a metal "tube" from each burner. When a burner was turned on the
tube filled up with gas. When the gas reached the pilot light it
flashed back up the tube and lit the burner.

We also had a hob before (1960s) that had little spiral gadgets that
glowed red hot when the gas touched them. Apparently they were
radioactive!

Steve

--
Neural Network Software. http://www.npsl1.com
EasyNN-plus. Neural Networks plus. http://www.easynn.com
SwingNN. Forecast with Neural Networks. http://www.swingnn.com
JustNN. Just Neural Networks. http://www.justnn.com

[Martin]

On 01/04/2012 10:09, Stephen Wolstenholme wrote:

> We also had a hob before (1960s) that had little spiral gadgets that
> glowed red hot when the gas touched them. Apparently they were
> radioactive!

Probably just platinum

[Cynic]

On Fri, 30 Mar 2012 18:58:37 +0200, abelard <abel...@abelard.org>
wrote:

>>Just reading all the literature and signs around fuel stations , car
>>handbooks even in the press should give you an inkling , plus the
>>fact she drives a car with an internal COMBUSTION engine
>
>at least it isn't an internal explosion engine

In fact, that is exactly what it *is*.

--
Cynic

[Ian Jackson]

In message <4f7997fb.69237718@localhost>, Cynic <cyni...@yahoo.co.uk>
writes

All such explosions are "combustions". The only difference is the speed
of the combustion.

And the last thing you want in a car is for the fuel/air mixture in the
cylinders to "explode". What takes place is a carefully controlled
(albeit pretty rapid) combustion.
--
Ian

[Phi]

"Ian Jackson" <ianREMOVET...@g3ohx.demon.co.uk> wrote in message

news:xN$MDrAV0...@g3ohx.demon.co.uk...

Or even, the rapid expansion of gases to develop an instant pressure on the
the piston.

[Cynic]

On Mon, 2 Apr 2012 13:35:33 +0100, Ian Jackson
<ianREMOVET...@g3ohx.demon.co.uk> wrote:

>>>at least it isn't an internal explosion engine

>>In fact, that is exactly what it *is*.

>All such explosions are "combustions". The only difference is the speed
>of the combustion.

>And the last thing you want in a car is for the fuel/air mixture in the
>cylinders to "explode". What takes place is a carefully controlled
>(albeit pretty rapid) combustion.

The combustion is rapid enough to be legitimately called an
"explosion".

If the same petrol/air mixture at the same pressure were to be ignited
inside a sealed tin can of the same size and shape as the
cylinder/piston cavity, I can assure you that you would be in no doubt
of its explosive nature.

--
Cynic

[Ian Jackson]

In message <-dCdnZQlZY1OMOTS...@bt.com>, Phi
<phi...@inbox.com> writes

The pressure isn't "instant". It's a rapid, controlled build up of
pressure, progressively increasing as the air/fuel mixture burns, heats
up and expands. If the pressure was "instant", your car would sound like
a tin can full of nails, it would run badly, and the parts bearing the
pressure (especially the big ends, little ends and their shell surfaces)
would get hammered. Effectively, your engine would have a short - and
unhappy - life.
--
Ian

[Cynic]

On Mon, 2 Apr 2012 15:55:04 +0100, Ian Jackson
<ianREMOVET...@g3ohx.demon.co.uk> wrote:

>>> All such explosions are "combustions". The only difference is the
>>>speed of the combustion.

>>> And the last thing you want in a car is for the fuel/air mixture in
>>>the cylinders to "explode". What takes place is a carefully controlled
>>>(albeit pretty rapid) combustion.
>>> -- Ian

>>Or even, the rapid expansion of gases to develop an instant pressure on
>>the the piston.

>The pressure isn't "instant".

Nor is the pressure buildup in an explosion.

> It's a rapid, controlled build up of
>pressure, progressively increasing as the air/fuel mixture burns, heats
>up and expands.

The same could be said of the combustion that occurs inside the
cartridge of a firearm or canon.

There is a grey area between "rapid combustion" and "explosion", but
IMO that threshold is reached in the cylinder of a car engine, and the
fuel/air misxture could be accurately described as "exploding" - the
same as the cordite in a rifle cartridge explodes, or the gunpowder in
a canon explodes despite both being controlled.

--
Cynic

[Ophelia]

"sutartsorric" <sutart...@googlemail.com> wrote in message
news:02cc835a-6c67-457c...@b14g2000vbz.googlegroups.com...
> On Mar 30, 4:17 pm, Richard McKenzie
> <richardmckenzi...@googlemail.com> wrote:
>
>
>> She said: "Diane had obviously got home and started to cook dinner
>> while decanting petrol.
>
> Obviously! We do that kind of thing all the time. Decanted petrol -
> cant beat it.
>
>
>>
>> "Diane was conscious the whole time. They put her in the ambulance and
>> took her away."
>
>
> It is debateable whether a person who comes home and decants petrol in
> her kitchen qualifies as reaching the "conscious" level any of the
> time.
>
> But it was Yorkshire, so allowances must be made.

OI! Wotchit pal!!!


--
http://www.shop.helpforheroes.org.uk/

[Ophelia]

"sutartsorric" <sutart...@googlemail.com> wrote in message

news:944881e4-a579-461e...@t16g2000yqt.googlegroups.com...

nodnodnodnodnod!!!!!


--
http://www.shop.helpforheroes.org.uk/

[abelard]

how exactly?

[Cynic]

On Fri, 30 Mar 2012 13:32:05 -0700 (PDT), sutartsorric
<sutart...@googlemail.com> wrote:

>I used to have an old Mk2 Cortina which must have had a small hole in
>the petrol tank and after filling up at a petrol station the car would
>smell of petrol, and yet we used to drive along smoking fags without
>giving it another thought. Bugger, I could have been in a fireball.

A lit cigarette is safe enough as it is not hot enough to ignite
petrol vapour. The danger is when lighting the cigarette using a
flame, because a flame is hot enough.

--
Cynic

[Basil Jet]

Does that mean that the scene in a movie where someone throws a
cigarette butt away and the petrol blows up is not possible?

[Tim Richards]

On Tue, 03 Apr 2012 18:31:46 +0100, Basil Jet
<jo...@journeyflow.spamspam.com> wrote:

>
>Does that mean that the scene in a movie where someone throws a
>cigarette butt away and the petrol blows up is not possible?

You mean the thousands of scenes in thousands of movies.

I remember Airplane II from almost 40 years ago where some guy
obliviously throws a discarded match into a load of petrol drums and
the whole lot goes up with an impressive bang.

Cynic obviously knows better than all those Hollywood directors and we
should salute him.

I'm saluting him right now - can you see my fingers?

[Cynic]

On Tue, 03 Apr 2012 18:31:46 +0100, Basil Jet

<jo...@journeyflow.spamspam.com> wrote:

>>> I used to have an old Mk2 Cortina which must have had a small hole in
>>> the petrol tank and after filling up at a petrol station the car would
>>> smell of petrol, and yet we used to drive along smoking fags without
>>> giving it another thought. Bugger, I could have been in a fireball.
>>
>> A lit cigarette is safe enough as it is not hot enough to ignite
>> petrol vapour. The danger is when lighting the cigarette using a
>> flame, because a flame is hot enough.
>>
>
>Does that mean that the scene in a movie where someone throws a
>cigarette butt away and the petrol blows up is not possible?

Correct. I have experimented by throwing lit cigarette ends into a
small bowl of petrol. The petrol extinguishes the cigarette.

Sparks OTOH will readily ignite petrol fumes, whether caused by
something hard striking metal or stones, or an electric spark that
occurs inside a switch or a motor etc.

--
Cynic

[Cynic]

On Tue, 03 Apr 2012 19:14:52 +0100, Tim Richards
<tricha...@googlemail.com> wrote:

>>Does that mean that the scene in a movie where someone throws a
>>cigarette butt away and the petrol blows up is not possible?

>You mean the thousands of scenes in thousands of movies.

>I remember Airplane II from almost 40 years ago where some guy
>obliviously throws a discarded match into a load of petrol drums and
>the whole lot goes up with an impressive bang.

You obviously don't know the difference between a match and a
cigarette. And you probably think that Airplane II was a documentary.

>Cynic obviously knows better than all those Hollywood directors and we
>should salute him.

>I'm saluting him right now - can you see my fingers?

Carry on believing everthing that Hollywood depicts. Maybe try
letting someone hit you over the head with a chair hard enough for the
chair to shatter like they do in the movies and see if you shrug it
off without a hair out of place. Or jump through a closed window,
smashing the glass, and see if you are in a fit state to carry on
running after the baddie.

--
Cynic