GREAT DEAL ON DNA SYNTHESIS!

[Koeng]

http://www.idtdna.com/pages/landing/dna-day-2013?utm_source=IDT+Customers&utm_campaign=3f82c0faab-DNA_Day_gBlocks_Special4_22_2013&utm_medium=email

Only today! IT IS ONLY 50 DOLLARS FOR 500 BASE PAIRS!!!! That is 10 cents a base pair! This is 5 cents less then the BEST normal deal! (gene art 1000 base pairs).

Also I do not want to advertise, but just wanted to share a great deal :)

-Koeng

[Dakota Hamill]

quick someone post all the cool genes worth synthesizing

> --
> -- You received this message because you are subscribed to the Google Groups
> DIYbio group. To post to this group, send email to diy...@googlegroups.com.
> To unsubscribe from this group, send email to
> diybio+un...@googlegroups.com. For more options, visit this group at
> https://groups.google.com/d/forum/diybio?hl=en
> Learn more at www.diybio.org
> ---
> You received this message because you are subscribed to the Google Groups
> "DIYbio" group.
> To unsubscribe from this group and stop receiving emails from it, send an
> email to diybio+un...@googlegroups.com.
> To post to this group, send email to diy...@googlegroups.com.
> Visit this group at http://groups.google.com/group/diybio?hl=en.
> To view this discussion on the web visit
> https://groups.google.com/d/msg/diybio/-/Unab-gtQojgJ.
> For more options, visit https://groups.google.com/groups/opt_out.
>
>

[Koeng]

PFU polymerase :D

Here are the files so you can put it together with the gibson assembly  :) The only payment I ask of is that you share the plasmid you make with me :D

(also note you will need snap gene viewer to look at these, it is free and you can get it here- http://www.snapgene.com/products/snapgene_viewer/)

In the stuff I included is everything, I mean like it has a Promoter, Lac operator, RBS, and ends that will fuse together when added into a solution of gibson assembly master mix. Just replace the 20 bp overlaps I put on both sides with the overhangs of your plasmid :D

Remember it is thermostable, so you can probably just use this http://www.openbiotech.com/v/vspfiles/assets/images/popentaq%20protocol.pdf

Cheers! Now time for me to prepare 4 biobrick restrictive enzymes for protein production in pMAL C5E... and possibly like HindIII too :)

[Koeng]

Oh I also got this. Get it synthesized for only 50 bucks. Share it with me.

(pUC19 cloning would be good with this one, or just add your own promoter)

Remember you need snapgene viewer to see em!

[Koeng]

Forgot to say what it was xD silly me

It is a toxin antitoxin system

http://en.wikipedia.org/wiki/Hok/sok_system

[Mega]

Interesting genes... 


TCTAGAAATTAACACTCACTAAAGGGAGACGAAGGACACGAAATGGGTAGCATTAACCTGCGTATTGACGATGAACTTAAAGCGCGTTCTTACGCCGCGCTTGAAAAAATGGGTGTAACTCCTTCTGAAGCGCTTCGTCTCATGCTCGAGTATATCGCTGACAATGAACGCTTGCCGTTCAAACAGACACTCCTGAGTGATGAAGATGCTGAACTTGTGGAGATAGTGAAAGAACGGCTTCGTAATCCTAAGCCAGTACGTGTGACGCTGGATGAACTCTGAAGACCGATAATGGCGTATTTTCTGGATTTTGACGAGCGGGCACTAAAGGAATGGCGAAAGCTGGGCTCGACGGTACGTGAACAGTTGAAAAAGAAGCTGGTTGAAGTACTTGAGTCACCCCGGATTGAAGCAAACAAGCTCCGTGGTATGCCTGATTGTTACAAGATTAAGCTCCGGTCTTCAGGCTATCGCCTTGTATACCAGGTTATAGACGAGAAAGTTGTCGTTTTCGTGATTTCTGTTGGGAAAAGAGAACGCTCGGAAGTATATAGCGAGGCGGTCAAACGCATTCTCTGAGGATCC

XbaI - T3 Promoter - RBS - RelB - RBS RelE - BamHI

Shelfish Gene sequence - build them into your plasmid and it 'll never get lost ;) 

[Dakota Hamill]

Yeah I went to order the hok sok last night but I only had $40 in my
account because I just payed a student loan. Twas a sad day. Got
payed today so I'll take a better look at all the sequences and see if
one would be useful enough to warrant getting it done. I don't want
to just get one and have no intended use for it because I can see it
just sitting around and never getting a home in a plasmid.

> --
> -- You received this message because you are subscribed to the Google Groups
> DIYbio group. To post to this group, send email to diy...@googlegroups.com.
> To unsubscribe from this group, send email to
> diybio+un...@googlegroups.com. For more options, visit this group at
> https://groups.google.com/d/forum/diybio?hl=en
> Learn more at www.diybio.org
> ---
> You received this message because you are subscribed to the Google Groups
> "DIYbio" group.
> To unsubscribe from this group and stop receiving emails from it, send an
> email to diybio+un...@googlegroups.com.
> To post to this group, send email to diy...@googlegroups.com.
> Visit this group at http://groups.google.com/group/diybio?hl=en.
> To view this discussion on the web visit

> https://groups.google.com/d/msg/diybio/-/UJBIJupSzPcJ.

[Koeng]

Hehe, funny thing about that. I had synthesized the gene for expressing XbaI (yes the restrictive enzyme, I wanna start producing it in my lab) and could order 1 other 500 bps with the 

I actually got the Hok Sok synthesized xD with primers that insert it RIGHT after ampicillin resistance in pUC19 (using gibson assembly), since that region with the origin is commonly used... such as in pMAL.

If you want some of the plasmid once I create it just email me!

-Koeng