You do not have permission to delete messages in this group
Copy link
Report message
Show original message
Either email addresses are anonymous for this group or you need the view member email addresses permission to view the original message
to gen...@soe.ucsc.edu
I have received ‘funny’ results of BLAT mapping on several occasions and I want to understand what the results mean.
For example, I BLAT’d the sequence of MIR22-5p (AGUUCUUCAGUGGCAAGCUUUA) and, in addition to the results that nailed the mapping to reference ch17:1713952-1713973, I received a result that included “17_KI270867v1 alt”.
How do I interpret the second result?
Thank you,
Pat Hartz
Patricia A. Hartz, PhD
Science Writer, OMIM
(www.omim.org)
Institute of Genetic Medicine
Johns Hopkins University
Matthew Speir
unread,
Feb 6, 2015, 6:04:58 PM2/6/15
Reply to author
Sign in to reply to author
Forward
Sign in to forward
Delete
You do not have permission to delete messages in this group
Copy link
Report message
Show original message
Either email addresses are anonymous for this group or you need the view member email addresses permission to view the original message
I hope this is helpful. If you have any further questions, please
reply to gen...@soe.ucsc.edu. All messages sent to that address are
archived on a publicly-accessible Google Groups forum. If your
question includes sensitive data, you may send it instead to
genom...@soe.ucsc.edu.