BLAT mapping results

Skip to first unread message

Pat Hartz

unread,
Feb 6, 2015, 3:03:31 PM2/6/15
to gen...@soe.ucsc.edu
I have received ‘funny’ results of BLAT mapping on several occasions and I want to understand what the results mean.

For example, I BLAT’d the sequence of MIR22-5p (AGUUCUUCAGUGGCAAGCUUUA) and, in addition to the results that nailed the mapping to reference ch17:1713952-1713973, I received a result that included “17_KI270867v1 alt”.

How do I interpret the second result?

Thank you,

Pat Hartz

Patricia A. Hartz, PhD
Science Writer, OMIM
(www.omim.org)
Institute of Genetic Medicine
Johns Hopkins University

Matthew Speir

unread,
Feb 6, 2015, 6:04:58 PM2/6/15
to Pat Hartz, gen...@soe.ucsc.edu
Hi Pat,

Thank you for your question about your BLAT results. The chr*_alt chromosomes are alternative sequences for different regions in the human genome. You can read more about them on the GRCh38/hg38 Gateway page, http://genome.ucsc.edu/cgi-bin/hgGateway?db=hg38, under the section titled " GRCh38 Highlights". You can also find more information on these alternate loci on the Genome Reference Consortium (GRC) website: http://www.ncbi.nlm.nih.gov/projects/genome/assembly/grc/info/definitions.shtml#ALTERNATE. You can see what regions these alternate sequences correspond to in the genome by using the "Alt Map Super-track", http://genome.ucsc.edu/cgi-bin/hgTrackUi?db=hg38&g=altSequence.

I hope this is helpful. If you have any further questions, please reply to gen...@soe.ucsc.edu. All messages sent to that address are archived on a publicly-accessible Google Groups forum. If your question includes sensitive data, you may send it instead to genom...@soe.ucsc.edu.

Matthew Speir
UCSC Genome Bioinformatics Group
Reply all
Reply to author
Forward
0 new messages