Liftover mm10 to CBAJ mouse

Manoj Hariharan

unread,

Jan 9, 2026, 4:00:14 PMJan 9

to gen...@soe.ucsc.edu

Hello,

I am working on a project using CBA mouse [CBA_J_v1 Apr. 2016 house mouse (CBA_J v1 2016) (GCA_001624475.1)]

But I need the blacklist file for this genome. Since there are not many genome-wide biochemical assays performed, I was hoping to do a liftOver of the mm10 genome to the CBA_J genome.

Hoever, I am not able to find this genome in the LiftOver pull down options. Could you please help with this.

Thanks

Manoj.

----------------------------------

Manoj Hariharan, Ph.D.

Senior Staff Scientist

Genomic Analysis Laboratory

Salk Institute for Biological Studies, La Jolla, CA

Luis Nassar

unread,

Jan 9, 2026, 5:47:01 PMJan 9

to Manoj Hariharan, gen...@soe.ucsc.edu

Hi, Manoj.

We started computing the liftOver file for you. It typically takes a few days, so we'll email you next week when it's done.

--

---
You received this message because you are subscribed to the Google Groups "UCSC Genome Browser Public Support" group.
To unsubscribe from this group and stop receiving emails from it, send an email to genome+un...@soe.ucsc.edu.
To view this discussion visit https://groups.google.com/a/soe.ucsc.edu/d/msgid/genome/83A662AB-E4D9-4919-8CA9-AF54207561A7%40salk.edu.

--

I hope this is helpful. Please include gen...@soe.ucsc.edu in any replies to ensure visibility by the team. All messages sent to that address are archived on our public forum. If your question includes sensitive information, you may send it instead to genom...@soe.ucsc.edu.

Lou Nassar
UCSC Genomics Institute

Manoj Hariharan

unread,

Jan 9, 2026, 6:00:16 PMJan 9

to Luis Nassar, gen...@soe.ucsc.edu

Hi Luis,

Thanks so much. Looking forward to it!

Regards,

Manoj.

----------------------------------

Manoj Hariharan, Ph.D.

Senior Staff Scientist

Genomic Analysis Laboratory

Salk Institute for Biological Studies, La Jolla, CA

Luis Nassar

unread,

Jan 14, 2026, 7:07:18 PMJan 14

to Manoj Hariharan, gen...@soe.ucsc.edu

Hi, Manoj.

The request liftOver file is now on our download server:

https://hgdownload.gi.ucsc.edu/goldenPath/mm10/liftOver/mm10ToGCA_001624475.1.over.chain.gz

Since the 2nd assembly (GCA_001624475.1) is not one of our native assemblies, you will need to use the liftOver utility for the coordinate conversion: https://genome.ucsc.edu/goldenPath/help/hgTracksHelp.html#Liftover

Let us know if you need any assistance with that process.

Manoj Hariharan

unread,

Jan 20, 2026, 6:30:25 PM (11 days ago) Jan 20

to Luis Nassar, gen...@soe.ucsc.edu

Hi Luis,

Thanks so much for generating the chain file required for liftOver.

I tried to use it on my local cluster as per the instructions using CLI version of liftOver.

Command used:

liftOver blacklist.mm10.v2.sorted.bed6.bed mm10ToGCA_001624475.1.over.chain.gz blacklist_GCA_001624475.bed blacklist.unmapped.bed

Reading liftover chains

Mapping coordinates

I don’t see any errors, but the output file had chromosome names as “CMxxx” or "LVXxxx”.

Here are a few lines of output file:

head blacklist_GCA_001624475.bed

CM004014.1 17950958 17952864 HighSignalRegion 0 +

CM004014.1 21751425 21753319 HighSignalRegion 0 +

CM004014.1 26376979 26388383 HighSignalRegion 0 +

CM004014.1 51593465 51597845 HighSignalRegion 0 +

CM004014.1 74907721 74912230 HighSignalRegion 0 +

CM004014.1 104239430 104241410 HighSignalRegion 0 +

CM004014.1 134522017 134527201 HighSignalRegion 0 +

CM004014.1 202621258 202623146 HighSignalRegion 0 +

CM004023.1 1733727 1735633 HighSignalRegion 0 +

CM004023.1 11508430 11511979 HighSignalRegion 0 +

But I am sure that the genome has regular “chr” format for all chromosomes when I download the genome of CBA_J_V1 mouse (GCA_001624475.1) from NCBI. I have pasted a few lines of each chromosome here:

>chr1

AAAATAAATATCTTTGCAGGGAAGGCTGGTAGACACTGTCTTAACTACATGATCAAAATCAGTTAGTGAGAAGAGGATGC

>chr2

AGATCTCActacatgtcttagttagggctttacagcagagaacagacaccatgaccaaggaaagatGTAGAAAACCCAAC

>chr3

tgggtggatatgggggacttttggtatagcattggaaatgtaaatgagctaaatacctaataaaaaaaaaggtaaagtaa

>chr4

TCCTAATCCCCACATGAAAGAGACAGCCGTAAAGCATATAGGTCCTCTTCATGTAACCCAGTAATCATTCCAAacgtctc

>chr5

TCTGTGGACAGAAAGTATTGAATGGAAAATTCCCAAAATAATTCATAcatttgttctattttatttgtaGTAGTTGTGGC

>chr6

TCGTCTCTCACTGTGAGTGTGGCCCATGGTATCTGGCAGCAGAAGTCTGTGGGTGGTAGAGGAGGAACAAGGTTTGAAAC

>chr7

AGTCTAATCTGTCCTTAATGTGCATGTGGACCACAGTGTCTTATTTTCTCTCCCAGGCTGCAAAACATTCCCAGACTTGG

>chr8

tttttttttttttttttgcttttacctCTATATTAATTGAACTTTTaaaacctgtttttaaaaaaaaatctatttcttaT

>chr9

tatatatatatatatacatacatacacatacatacatacacatacatacatacacatacatatatatacacatacatata

>chr10

tcctttcatgggtattttgttccctattctaaggaggaatgaagtatccacccattggtcttccctcttcttgactttct

>chr11

TCATTATTCACGTTTTTAACTTTTTCTTGGCATATTTTAGTGCTTATAGTGTGAGTTTCTCCTTTTgaacgtttttcagt

>chr12

TCTGAAACATCCCACGATTTCTGTTGCAAGGAGGAATTTGTTCAGCCATGTTACAGCTTCctatttctctcctctcccaa

>chr13

TCCAATCTGATTTTCACCTTTCAGTGCTACACACAGGTTAATACAGTAACTGCATTAAATCACTATAAAAATGTGAGTTT

>chr14

gcagattatttgtttaccacttagaacacagctgtcagcgccatcttgtaacggcgaatgtgggcgcggctcccaacaga

>chr15

ATGCAAATTCACATGTGAAATGGCATGTTTGTGCATCACATTTCTCAATGCAAATACTTGTGATCATATTACCTTTTTGC

>chr16

GTTACAGCCTTATGAATTTTTTATAGTATCAGAATACAGACAGTCATGGATACCTCTCAATGCATTGATAGAAACATCAA

>chr17

ACTCTTTGAActcaggaagcgggtgggtggaggaaggaatgtcgctatctgctttatgattagcataccttggagcattg

>chr18

ATATTATAAAACTTCAGagtttattcccctcctggtctacccACTTGTTCCTCcaaatcccatacctccttctgCAACAC

>chr19

atatttttaaaaattagttatcCTTGTTATTAgcttaaaaatgaataattaagTCAAACTCTATCCTGATCTGGATGTCT

>chrX

gtgttgaagtctcccactattattgtgtgaggtgcaatgtgcgctttgagctttactaaagtttctttaatgaatgtggc

>chrX_KV417257_scaffold_X_unloc

AGAAGACTTAGGGACTTTTATAAAAGTGAGGGAACATTTCTTTCTTGCTCAATGGTAATTGGAATATCTTATGTGCCTAA

>chrL

GGGCGGCGACCTCGCGGGTTTTCGCTATTTATGAAAATTTTCCGGTTTAA

>chrY

NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

My input file is the ENCODE Blacklist regions from mm10 genome. I have attached the full input file, which is sorted and has six fields (blacklist.mm10.v2.sorted.bed6.bed), and also the original blacklist file (blacklist.mm10.v2.bed.gz).

I am not sure why the actual chromosome names (chr1, chr2 etc) is not showing in the liftOver output. Could you please take a look and help?

Thanks,

Manoj.

----------------------------------

Manoj Hariharan, Ph.D.

Senior Staff Scientist

Genomic Analysis Laboratory

Salk Institute for Biological Studies, La Jolla, CA

blacklist.mm10.v2.sorted.bed6.bed

blacklist.mm10.v2.bed.gz

Hiram Clawson

unread,

Jan 20, 2026, 6:53:52 PM (11 days ago) Jan 20

to Manoj Hariharan, Luis Nassar, gen...@soe.ucsc.edu

The NCBI assembly would be using the CM... named sequences.
There would not be chrN names in the NCBI assembly.

You can convert names with the alias file:

https://hgdownload.soe.ucsc.edu/hubs/GCA/001/624/475/GCA_001624475.1/GCA_001624475.1.chromAlias.txt

and the sizes file:

https://hgdownload.soe.ucsc.edu/hubs/GCA/001/624/475/GCA_001624475.1/GCA_001624475.1.chrom.sizes.txt

Combining those two files, you can make a 'lift' file to convert
the names. I will forward you the command to do this in a second email
later.

You may have obtained the sequence with chrN names from
our initial track hub from ten years ago. Those were replaced
with the standard NCBI assemblies and the NCBI names.

--Hiram

On 1/20/26 3:14 PM, Manoj Hariharan wrote:
> Hi Luis,
>

> https://hgdownload.gi.ucsc.edu/goldenPath/mm10/liftOver/mm10ToGCA_001624475.1.over.chain.gz<https://urldefense.com/v3/__https://hgdownload.gi.ucsc.edu/goldenPath/mm10/liftOver/mm10ToGCA_001624475.1.over.chain.gz__;!!GX6Nv3_Pjr8b-17qtCok029Ok438DqXQ!woAVAM3oFFur6XoCdiXMmnS52EX1-CpQ3ZYnNswDvSzSjRRK4k9x_cOjdhrcd5RO5LyRZsH2WzhOmQwLmlI$>
>
> Since the 2nd assembly (GCA_001624475.1) is not one of our native assemblies, you will need to use the liftOver utility for the coordinate conversion: https://genome.ucsc.edu/goldenPath/help/hgTracksHelp.html#Liftover<https://urldefense.com/v3/__https://genome.ucsc.edu/goldenPath/help/hgTracksHelp.html*Liftover__;Iw!!GX6Nv3_Pjr8b-17qtCok029Ok438DqXQ!woAVAM3oFFur6XoCdiXMmnS52EX1-CpQ3ZYnNswDvSzSjRRK4k9x_cOjdhrcd5RO5LyRZsH2WzhO5vlaRDs$>

> To unsubscribe from this group and stop receiving emails from it, send an email to genome+un...@soe.ucsc.edu<mailto:genome+un...@soe.ucsc.edu>.
> To view this discussion visit https://groups.google.com/a/soe.ucsc.edu/d/msgid/genome/83A662AB-E4D9-4919-8CA9-AF54207561A7%40salk.edu<https://urldefense.com/v3/__https://groups.google.com/a/soe.ucsc.edu/d/msgid/genome/83A662AB-E4D9-4919-8CA9-AF54207561A7*40salk.edu?utm_medium=email&utm_source=footer__;JQ!!GX6Nv3_Pjr8b-17qtCok029Ok438DqXQ!wG4ObV-Ndv7ArU34IN7TPjCqKqB8oz9VWUhXJ_28U9SCRR05vZoq8FVObqZ29M41WurJuP0ICARuY5jfGik$>.
>
>
> --
> I hope this is helpful. Please include gen...@soe.ucsc.edu<mailto:gen...@soe.ucsc.edu> in any replies to ensure visibility by the team. All messages sent to that address are archived on our public forum. If your question includes sensitive information, you may send it instead to genom...@soe.ucsc.edu<mailto:genom...@soe.ucsc.edu>.

>
> Lou Nassar
> UCSC Genomics Institute
>
>
>
> --

> I hope this is helpful. Please include gen...@soe.ucsc.edu<mailto:gen...@soe.ucsc.edu> in any replies to ensure visibility by the team. All messages sent to that address are archived on our public forum. If your question includes sensitive information, you may send it instead to genom...@soe.ucsc.edu<mailto:genom...@soe.ucsc.edu>.

Matthew Speir

unread,

Jan 21, 2026, 12:55:34 PM (10 days ago) Jan 21

to Manoj Hariharan, Luis Nassar, gen...@soe.ucsc.edu, Hiram Clawson

Hello, Manoj.

We also provide the "chromToUcsc" command-line utility for converting chromosome names. It's available from our download server: https://hgdownload.gi.ucsc.edu/downloads.html#utilities_downloads.

This should be the command for the conversion after downloading the utility and the chromAlias file my colleague mentioned:

chromToUcsc -i blacklist_GCA_001624475.bed -o blacklist_GCA_001624475.ucsc_names.bed -a GCA_001624475.1.chromAlias.txt

I hope this is helpful. If you have any further questions, please reply to gen...@soe.ucsc.edu. All messages sent to that address are archived on a publicly-accessible Google Groups forum. If your question includes sensitive data, you may send it instead to genom...@soe.ucsc.edu.

---

Matthew Speir

UCSC Genome Browser, User Support

To unsubscribe from this group and stop receiving emails from it, send an email to genome+un...@soe.ucsc.edu.
To view this discussion visit https://groups.google.com/a/soe.ucsc.edu/d/msgid/genome/44a616fc-6ceb-47ca-b691-998147358342%40soe.ucsc.edu.

Manoj Hariharan

unread,

Jan 21, 2026, 1:00:23 PM (10 days ago) Jan 21

to Hiram Clawson, Luis Nassar, gen...@soe.ucsc.edu

Hi Hiram,

Thank you. I look forward to the second email you mentioned — with a command to lift.

Regards,

Manoj.

-----------------------------------------------------

Manoj Hariharan

Senior Staff Scientist

Genomic Analysis Laboratory

Salk Institute for Biological Studies, La Jolla, CA

On Jan 20, 2026, at 3:53 PM, Hiram Clawson <hi...@soe.ucsc.edu> wrote:

The NCBI assembly would be using the CM... named sequences.
There would not be chrN names in the NCBI assembly.

You can convert names with the alias file:

https://urldefense.com/v3/__https://hgdownload.soe.ucsc.edu/hubs/GCA/001/624/475/GCA_001624475.1/GCA_001624475.1.chromAlias.txt__;!!GX6Nv3_Pjr8b-17qtCok029Ok438DqXQ!1UVBSTzYTQ3at42MZQ1yUAa4I7rgexBn5NAAKypCtBc1Nlo6lthkNSx-DcmmVKx22-2q_E00ylUwfoZM_u4$
and the sizes file:

https://urldefense.com/v3/__https://hgdownload.soe.ucsc.edu/hubs/GCA/001/624/475/GCA_001624475.1/GCA_001624475.1.chrom.sizes.txt__;!!GX6Nv3_Pjr8b-17qtCok029Ok438DqXQ!1UVBSTzYTQ3at42MZQ1yUAa4I7rgexBn5NAAKypCtBc1Nlo6lthkNSx-DcmmVKx22-2q_E00ylUw3F1Xh6A$

https://urldefense.com/v3/__https://hgdownload.gi.ucsc.edu/goldenPath/mm10/liftOver/mm10ToGCA_001624475.1.over.chain.gz__;!!GX6Nv3_Pjr8b-17qtCok029Ok438DqXQ!1UVBSTzYTQ3at42MZQ1yUAa4I7rgexBn5NAAKypCtBc1Nlo6lthkNSx-DcmmVKx22-2q_E00ylUwAV6zU9U$<https://urldefense.com/v3/__https://hgdownload.gi.ucsc.edu/goldenPath/mm10/liftOver/mm10ToGCA_001624475.1.over.chain.gz__;!!GX6Nv3_Pjr8b-17qtCok029Ok438DqXQ!woAVAM3oFFur6XoCdiXMmnS52EX1-CpQ3ZYnNswDvSzSjRRK4k9x_cOjdhrcd5RO5LyRZsH2WzhOmQwLmlI$>
Since the 2nd assembly (GCA_001624475.1) is not one of our native assemblies, you will need to use the liftOver utility for the coordinate conversion: https://urldefense.com/v3/__https://genome.ucsc.edu/goldenPath/help/hgTracksHelp.html*Liftover__;Iw!!GX6Nv3_Pjr8b-17qtCok029Ok438DqXQ!1UVBSTzYTQ3at42MZQ1yUAa4I7rgexBn5NAAKypCtBc1Nlo6lthkNSx-DcmmVKx22-2q_E00ylUwWGpVYNM$<https://urldefense.com/v3/__https://genome.ucsc.edu/goldenPath/help/hgTracksHelp.html*Liftover__;Iw!!GX6Nv3_Pjr8b-17qtCok029Ok438DqXQ!woAVAM3oFFur6XoCdiXMmnS52EX1-CpQ3ZYnNswDvSzSjRRK4k9x_cOjdhrcd5RO5LyRZsH2WzhO5vlaRDs$>

To view this discussion visit https://urldefense.com/v3/__https://groups.google.com/a/soe.ucsc.edu/d/msgid/genome/83A662AB-E4D9-4919-8CA9-AF54207561A7*40salk.edu__;JQ!!GX6Nv3_Pjr8b-17qtCok029Ok438DqXQ!1UVBSTzYTQ3at42MZQ1yUAa4I7rgexBn5NAAKypCtBc1Nlo6lthkNSx-DcmmVKx22-2q_E00ylUw_SBNDZI$<https://urldefense.com/v3/__https://groups.google.com/a/soe.ucsc.edu/d/msgid/genome/83A662AB-E4D9-4919-8CA9-AF54207561A7*40salk.edu?utm_medium=email&utm_source=footer__;JQ!!GX6Nv3_Pjr8b-17qtCok029Ok438DqXQ!wG4ObV-Ndv7ArU34IN7TPjCqKqB8oz9VWUhXJ_28U9SCRR05vZoq8FVObqZ29M41WurJuP0ICARuY5jfGik$>.

Hiram Clawson

unread,

Jan 21, 2026, 1:13:26 PM (10 days ago) Jan 21

to Manoj Hariharan, Luis Nassar, gen...@soe.ucsc.edu

As Matthew mentioned, you can use the chromToUcsc
command to convert names.

Here is an alternative. This makes the 'lift' file which is
then used by the 'liftUp' command to change the names. Check
the usage message from the 'liftUp' for discussion of types of
files it can lift. Example here is a bed file.

bigBedToBed
'https://hgdownload.soe.ucsc.edu/hubs/GCA/001/624/475/GCA_001624475.1/GCA_001624475.1.chromAlias.bb'
stdout \
| awk -F$'\t' '{printf "0\t%s\t%d\t%s\t%d\n", $7, $3, $1, $3}' \
| sort -k1 > chrToGenBank.lift

liftUp -type=.bed genBankNames.bed chrToGenBank.lift error chrNames.bed

> On Fri, Jan 9, 2026 at 2:50 PM Manoj Hariharan <mhari...@salk.edu<mailto:mhari...@salk.edu><mailto:mhari...@salk.edu>> wrote:
> Hi Luis,
> Thanks so much. Looking forward to it!
> Regards,
> Manoj.
> ----------------------------------
> Manoj Hariharan, Ph.D.
> Senior Staff Scientist
> Genomic Analysis Laboratory
> Salk Institute for Biological Studies, La Jolla, CA

> On Jan 9, 2026, at 2:46 PM, Luis Nassar <lrna...@ucsc.edu<mailto:lrna...@ucsc.edu><mailto:lrna...@ucsc.edu>> wrote:
> Hi, Manoj.
> We started computing the liftOver file for you. It typically takes a few days, so we'll email you next week when it's done.

> On Fri, Jan 9, 2026 at 1:00 PM Manoj Hariharan <mhari...@salk.edu<mailto:mhari...@salk.edu><mailto:mhari...@salk.edu>> wrote:
> Hello,
> I am working on a project using CBA mouse [CBA_J_v1 Apr. 2016 house mouse (CBA_J v1 2016) (GCA_001624475.1)]
> But I need the blacklist file for this genome. Since there are not many genome-wide biochemical assays performed, I was hoping to do a liftOver of the mm10 genome to the CBA_J genome.
> Hoever, I am not able to find this genome in the LiftOver pull down options. Could you please help with this.
> Thanks
> Manoj.
> ----------------------------------
> Manoj Hariharan, Ph.D.
> Senior Staff Scientist
> Genomic Analysis Laboratory
> Salk Institute for Biological Studies, La Jolla, CA
> --
> ---
> You received this message because you are subscribed to the Google Groups "UCSC Genome Browser Public Support" group.

> To unsubscribe from this group and stop receiving emails from it, send an email to genome+un...@soe.ucsc.edu<mailto:genome+un...@soe.ucsc.edu><mailto:genome+un...@soe.ucsc.edu>.

> To view this discussion visit https://urldefense.com/v3/__https://groups.google.com/a/soe.ucsc.edu/d/msgid/genome/83A662AB-E4D9-4919-8CA9-AF54207561A7*40salk.edu__;JQ!!GX6Nv3_Pjr8b-17qtCok029Ok438DqXQ!1UVBSTzYTQ3at42MZQ1yUAa4I7rgexBn5NAAKypCtBc1Nlo6lthkNSx-DcmmVKx22-2q_E00ylUw_SBNDZI$<https://urldefense.com/v3/__https://groups.google.com/a/soe.ucsc.edu/d/msgid/genome/83A662AB-E4D9-4919-8CA9-AF54207561A7*40salk.edu?utm_medium=email&utm_source=footer__;JQ!!GX6Nv3_Pjr8b-17qtCok029Ok438DqXQ!wG4ObV-Ndv7ArU34IN7TPjCqKqB8oz9VWUhXJ_28U9SCRR05vZoq8FVObqZ29M41WurJuP0ICARuY5jfGik$>.
> --

> I hope this is helpful. Please include gen...@soe.ucsc.edu<mailto:gen...@soe.ucsc.edu><mailto:gen...@soe.ucsc.edu> in any replies to ensure visibility by the team. All messages sent to that address are archived on our public forum. If your question includes sensitive information, you may send it instead to genom...@soe.ucsc.edu<mailto:genom...@soe.ucsc.edu><mailto:genom...@soe.ucsc.edu>.

> Lou Nassar
> UCSC Genomics Institute
> --

> I hope this is helpful. Please include gen...@soe.ucsc.edu<mailto:gen...@soe.ucsc.edu><mailto:gen...@soe.ucsc.edu> in any replies to ensure visibility by the team. All messages sent to that address are archived on our public forum. If your question includes sensitive information, you may send it instead to genom...@soe.ucsc.edu<mailto:genom...@soe.ucsc.edu><mailto:genom...@soe.ucsc.edu>.

Manoj Hariharan

unread,

Jan 22, 2026, 2:30:21 PM (9 days ago) Jan 22

to Hiram Clawson, msp...@ucsc.edu, Luis Nassar, gen...@soe.ucsc.edu

Hi Hiram and Matthew,

Thank you both for providing me with options to convert the chromosome names. I could still not resolve the issue.

My input file “blacklist_GCA_001624475.bed” has 167 lines:

(liftover)x-hariharan@login03 genomes/LiftOver » head blacklist_GCA_001624475.bed

CM004014.1 17950958 17952864 HighSignalRegion 0 +

CM004014.1 21751425 21753319 HighSignalRegion 0 +

CM004014.1 26376979 26388383 HighSignalRegion 0 +

CM004014.1 51593465 51597845 HighSignalRegion 0 +

CM004014.1 74907721 74912230 HighSignalRegion 0 +

CM004014.1 104239430 104241410 HighSignalRegion 0 +

CM004014.1 134522017 134527201 HighSignalRegion 0 +

CM004014.1 202621258 202623146 HighSignalRegion 0 +

CM004023.1 1733727 1735633 HighSignalRegion 0 +

CM004023.1 11508430 11511979 HighSignalRegion 0 +

Using Matthew’s approach, I used “GCA_001624475.1.chromAlias.txt” (5467 line)

head GCA_001624475.1.chromAlias.txt

# genbank assembly ncbi ucsc

CM004014.1 1 1 chr1

CM004015.1 2 2 chr2

CM004016.1 3 3 chr3

CM004017.1 4 4 chr4

CM004018.1 5 5 chr5

CM004019.1 6 6 chr6

CM004020.1 7 7 chr7

CM004021.1 8 8 chr8

CM004022.1 9 9 chr9

(liftover)x-hariharan@login03 genomes/LiftOver » chromToUcsc -i blacklist_GCA_001624475.bed -o blacklist_GCA_001624475.ucsc_names.bed -a GCA_001624475.1.chromAlias.txt

However, the output still has the CM IDs only. Eg., output file:

(liftover)x-hariharan@login03 genomes/LiftOver » head blacklist_GCA_001624475.ucsc_names.bed

CM004014.1 17950958 17952864 HighSignalRegion 0 +

CM004014.1 21751425 21753319 HighSignalRegion 0 +

CM004014.1 26376979 26388383 HighSignalRegion 0 +

CM004014.1 51593465 51597845 HighSignalRegion 0 +

CM004014.1 74907721 74912230 HighSignalRegion 0 +

CM004014.1 104239430 104241410 HighSignalRegion 0 +

CM004014.1 134522017 134527201 HighSignalRegion 0 +

CM004014.1 202621258 202623146 HighSignalRegion 0 +

CM004023.1 1733727 1735633 HighSignalRegion 0 +

CM004023.1 11508430 11511979 HighSignalRegion 0 +

------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------

Using Hiram’s approach, I was able to create the chrToGenBank.lift file (5466 lines).

head chrToGenBank.lift

0 chr10 144777665 CM004023.1 144777665

0 chr11 135364629 CM004024.1 135364629

0 chr12 131957000 CM004025.1 131957000

0 chr1 216633511 CM004014.1 216633511

0 chr13 131261213 CM004026.1 131261213

0 chr14 132271376 CM004027.1 132271376

0 chr15 113655413 CM004028.1 113655413

But when I did liftUp, I get this error, although the “CM004014.1” is clearly present in chrToGenBank.lift corresponding to chr1 in line 4, as seen above.

Here is the error:

(liftover)x-hariharan@login03 genomes/LiftOver » liftUp -type=.bed genBankNames.bed chrToGenBank.lift error blacklist_GCA_001624475.bed

Got 5466 lifts in chrToGenBank.lift

Lifting blacklist_GCA_001624475.bed

CM004014.1 isn't in liftSpec file line 1 of blacklist_GCA_001624475.bed

(liftover)x-hariharan@login03 genomes/LiftOver »

——————————————————————————————————————————————————————————————————————————————————————————

----------------------------------

Manoj Hariharan, Ph.D.

Senior Staff Scientist

Genomic Analysis Laboratory

Salk Institute for Biological Studies, La Jolla, CA

On Jan 21, 2026, at 10:13 AM, Hiram Clawson <hi...@soe.ucsc.edu> wrote:

As Matthew mentioned, you can use the chromToUcsc
command to convert names.

Here is an alternative. This makes the 'lift' file which is
then used by the 'liftUp' command to change the names. Check
the usage message from the 'liftUp' for discussion of types of
files it can lift. Example here is a bed file.

bigBedToBed 'https://urldefense.com/v3/__https://hgdownload.soe.ucsc.edu/hubs/GCA/001/624/475/GCA_001624475.1/GCA_001624475.1.chromAlias.bb__;!!GX6Nv3_Pjr8b-17qtCok029Ok438DqXQ!xPTL7fWFKB4UpQO_XxMl883fLt4uA8lnXVjBpNfgTmvIaKqe9lU58HGOuJKw4S1xW9WYnOgOYiQCd2KmERk$ ' stdout \

Hiram Clawson

unread,

Jan 22, 2026, 2:34:10 PM (9 days ago) Jan 22

to Manoj Hariharan, msp...@ucsc.edu, Luis Nassar, gen...@soe.ucsc.edu

Good Morning Manoj:

I'm confused. Your .bed file: blacklist_GCA_001624475.bed
has the correct GenBank accession names and that file will
function in the browser.

What names are you trying to convert for what purpose ?

Actually, both sets of names will function in the browser because
the browser display will automatically apply the chromAlias
translations as the file is presented to the browser.

--Hiram

> On Fri, Jan 9, 2026 at 2:50 PM Manoj Hariharan <mhari...@salk.edu<mailto:mhari...@salk.edu><mailto:mhari...@salk.edu><mailto:mhari...@salk.edu>> wrote:
> Hi Luis,
> Thanks so much. Looking forward to it!
> Regards,
> Manoj.
> ----------------------------------
> Manoj Hariharan, Ph.D.
> Senior Staff Scientist
> Genomic Analysis Laboratory
> Salk Institute for Biological Studies, La Jolla, CA

> On Jan 9, 2026, at 2:46 PM, Luis Nassar <lrna...@ucsc.edu<mailto:lrna...@ucsc.edu><mailto:lrna...@ucsc.edu><mailto:lrna...@ucsc.edu>> wrote:
> Hi, Manoj.
> We started computing the liftOver file for you. It typically takes a few days, so we'll email you next week when it's done.

> On Fri, Jan 9, 2026 at 1:00 PM Manoj Hariharan <mhari...@salk.edu<mailto:mhari...@salk.edu><mailto:mhari...@salk.edu><mailto:mhari...@salk.edu>> wrote:
> Hello,
> I am working on a project using CBA mouse [CBA_J_v1 Apr. 2016 house mouse (CBA_J v1 2016) (GCA_001624475.1)]
> But I need the blacklist file for this genome. Since there are not many genome-wide biochemical assays performed, I was hoping to do a liftOver of the mm10 genome to the CBA_J genome.
> Hoever, I am not able to find this genome in the LiftOver pull down options. Could you please help with this.
> Thanks
> Manoj.
> ----------------------------------
> Manoj Hariharan, Ph.D.
> Senior Staff Scientist
> Genomic Analysis Laboratory
> Salk Institute for Biological Studies, La Jolla, CA
> --
> ---
> You received this message because you are subscribed to the Google Groups "UCSC Genome Browser Public Support" group.

> To unsubscribe from this group and stop receiving emails from it, send an email to genome+un...@soe.ucsc.edu<mailto:genome+un...@soe.ucsc.edu><mailto:genome+un...@soe.ucsc.edu><mailto:genome+un...@soe.ucsc.edu>.

> To view this discussion visit https://urldefense.com/v3/__https://groups.google.com/a/soe.ucsc.edu/d/msgid/genome/83A662AB-E4D9-4919-8CA9-AF54207561A7*40salk.edu__;JQ!!GX6Nv3_Pjr8b-17qtCok029Ok438DqXQ!1UVBSTzYTQ3at42MZQ1yUAa4I7rgexBn5NAAKypCtBc1Nlo6lthkNSx-DcmmVKx22-2q_E00ylUw_SBNDZI$<https://urldefense.com/v3/__https://groups.google.com/a/soe.ucsc.edu/d/msgid/genome/83A662AB-E4D9-4919-8CA9-AF54207561A7*40salk.edu?utm_medium=email&utm_source=footer__;JQ!!GX6Nv3_Pjr8b-17qtCok029Ok438DqXQ!wG4ObV-Ndv7ArU34IN7TPjCqKqB8oz9VWUhXJ_28U9SCRR05vZoq8FVObqZ29M41WurJuP0ICARuY5jfGik$>.
> --

> I hope this is helpful. Please include gen...@soe.ucsc.edu<mailto:gen...@soe.ucsc.edu><mailto:gen...@soe.ucsc.edu><mailto:gen...@soe.ucsc.edu> in any replies to ensure visibility by the team. All messages sent to that address are archived on our public forum. If your question includes sensitive information, you may send it instead to genom...@soe.ucsc.edu<mailto:genom...@soe.ucsc.edu><mailto:genom...@soe.ucsc.edu><mailto:genom...@soe.ucsc.edu>.

> Lou Nassar
> UCSC Genomics Institute
> --

> I hope this is helpful. Please include gen...@soe.ucsc.edu<mailto:gen...@soe.ucsc.edu><mailto:gen...@soe.ucsc.edu><mailto:gen...@soe.ucsc.edu> in any replies to ensure visibility by the team. All messages sent to that address are archived on our public forum. If your question includes sensitive information, you may send it instead to genom...@soe.ucsc.edu<mailto:genom...@soe.ucsc.edu><mailto:genom...@soe.ucsc.edu><mailto:genom...@soe.ucsc.edu>.

Manoj Hariharan

unread,

Jan 22, 2026, 4:30:25 PM (9 days ago) Jan 22

to Hiram Clawson, msp...@ucsc.edu, Luis Nassar, gen...@soe.ucsc.edu

Hi Hiram,

The blacklist bed file I am trying to create is for using in another analysis, not for genome browser purposes.

Since all my analysis has bed files with chromosome names like chr1, chr2 etc. I would need this file also to have chr1, chr2 etc instead of having CM IDs like CM004014, CM004043 etc.

I also noticed something strange when doing the liftOver that out of ~3,500 rows present in my input mm10.blacklist file, the output has only 167 line. Most of them in the unmapped file has error “Split in new”. Would that be reasonable to expect?

If it is not too much trouble for you, can you please run this and see if this is the same output that you are getting? I am attaching the input file here again — “blacklist.mm10.v2.sorted.bed6.bed”.

Tx

Manoj.

On Jan 22, 2026, at 11:34 AM, Hiram Clawson <hi...@soe.ucsc.edu> wrote:

Good Morning Manoj:

blacklist.mm10.v2.sorted.bed6.bed

Hiram Clawson

unread,

Jan 22, 2026, 9:58:03 PM (8 days ago) Jan 22

to Manoj Hariharan, msp...@ucsc.edu, Luis Nassar, gen...@soe.ucsc.edu

Good Evening Manoj:

To convert the names from the NCBI accessions to the chrN names,
swap the name columns in that awk statement I indicated:

instead of this order:

$7, $3, $1, $3

Use: $1, $3, $7, $3

As in:

bigBedToBed
'https://hgdownload.soe.ucsc.edu/hubs/GCA/001/624/475/GCA_001624475.1/GCA_001624475.1.chromAlias.bb'
stdout \
| awk -F$'\t' '{printf "0\t%s\t%d\t%s\t%d\n", $1, $3, $7, $3}' \
| sort -k1 > genBankToChr.lift

liftUp -type=.bed chrNames.bed genBankToChr.lift error genBankNames.bed

This 'lift' file is a direct name to name translation without any change in
coordinates using the 'liftUp' command.

The 'liftOver' command with the 'over.chain.gz' file will require your
input to be in the same name space as in the 'over.chain.gz' file.

The alignment between GCA_001624475.1_CBA_J_v1 and mm10 is approximately
%77 of GCA_001624475.1 matching to sequence in mm10, and %87
of mm10 sequence matching to GCA_001624475.1 so there could indeed be
lifts that will not be successful. Examining the gap and chain tracks
on GCA_001624475.1 will give you an idea of how well mm10 will match
to this assembly.

--Hiram

Manoj Hariharan

unread,

Jan 23, 2026, 2:30:21 PM (8 days ago) Jan 23

to Hiram Clawson, msp...@ucsc.edu, Luis Nassar, gen...@soe.ucsc.edu

Thanks Hiram. Appreciate your help.

It has now worked perfectly well. Sorry for the naive question.

Thanks for explaining the difference % between CBA and mm10 assemblies. I shall dig deeper into that.

Regards,

Manoj.

----------------------------------

Manoj Hariharan, Ph.D.

Senior Staff Scientist

Genomic Analysis Laboratory

Salk Institute for Biological Studies, La Jolla, CA

On Jan 22, 2026, at 6:57 PM, Hiram Clawson <hi...@soe.ucsc.edu> wrote:

Good Evening Manoj:

To convert the names from the NCBI accessions to the chrN names,
swap the name columns in that awk statement I indicated:

instead of this order:

$7, $3, $1, $3

Use: $1, $3, $7, $3

As in:

bigBedToBed 'https://urldefense.com/v3/__https://hgdownload.soe.ucsc.edu/hubs/GCA/001/624/475/GCA_001624475.1/GCA_001624475.1.chromAlias.bb__;!!GX6Nv3_Pjr8b-17qtCok029Ok438DqXQ!wE1B1u3c03PrnhBpPj_1gjQUVfy2OU6Zrtt0z3IMLoqb3SCVg6imeGMJnpVp_0_d14n3o80ROUeFpkuPFCY$ ' stdout \

Reply all

Reply to author

Forward