Amino acid sequence to the corresponding nucleotide

[Pandurang, Pujari Ganesh (Ganesh), M.D.]

Greetings Ms. Giardine,

 

I am a research fellow in Proteomics at Mayo Clinic, Rochester.

I am trying to synthesize peptides in mutational alpha thalassemia from the nucleotide sequence of the alpha hemoglobin gene (HBA1).

The following primers have been used –

Forward: CCCCTCGCCAAGTCCACCC

Reverse: AAAGCACTCTAGGGTCCAGCG

 

I cannot locate the corresponding nucleotide sequence in the gene, thereby unable to get the peptide sequence.

 

I would greatly appreciate if you can help me on this.

 

Thanks & Regards-

 

Ganesh Pujari, M.D.

 

 

[Ross Hardison]

Dear Dr. Pujari, 

I used the "BLAT" tool at the UCSC Genome Browser to find your primers in the human genome sequence (GRCh38). I had to add another nucleotide to the Forward string (the tool requires at least 20 nts) , and I found that adding C to the 3' end gave a hit. If this elongated sequence is an accurate proxy for what you are looking for, then it looks like your primers would amplify an interval containing the genes HBA2 and HBA1. This DNA interval is about 6 kb in size, and it may be a challenge to amplify. Of course, you have the duplicated HBA genes within it, which may complicate things. The primers to not appear to be targeting an exclusively protein-coding region.

A browser view illustrating the interval is attached.

Best wishes,

Ross Hardison
T. Ming Chu Professor of Biochemistry and Molecular Biology
Associate Director, Huck Genome Sciences Institute
304 Wartik Lab
The Pennsylvania State University
University Park, PA 16802
Phone: 814-863-0113
E-mail: rc...@psu.edu

---------- Forwarded message ----------
Date: Wed, 02 Mar 2022 21:36:02 +0000
From: "Pandurang, Pujari Ganesh (Ganesh), M.D." <Panduran...@mayo.edu>
To: "'giar...@bx.psu.edu'" <giar...@bx.psu.edu>,
   "'gen...@soe.ucsc.edu'" <gen...@soe.ucsc.edu>
Subject: Amino acid sequence to the corresponding nucleotide

Greetings Ms. Giardine,

I am a research fellow in Proteomics at Mayo Clinic, Rochester.
I am trying to synthesize peptides in mutational alpha thalassemia from the nucleotide sequence of the alpha hemoglobin gene (HBA1).

The following primers have been used -

[Robert Kuhn]

Hello, Drs. Hardison and Pujari,

thanks for your reply, Ross.  The isPrc tool on the Browser will find the sequence as well,

without the added nucleotide, but you must change the setting "Max Product Size" from 

the default 4000 to around 6000.

best wishes,

    --b0b kuhn

    ucsc genome bioinformatics group

--

---
You received this message because you are subscribed to the Google Groups "UCSC Genome Browser Public Support" group.
To unsubscribe from this group and stop receiving emails from it, send an email to genome+un...@soe.ucsc.edu.
To view this discussion on the web visit https://groups.google.com/a/soe.ucsc.edu/d/msgid/genome/1E48297E-B09C-4487-81B8-EC7E1231E33F%40psu.edu.

[Pandurang, Pujari Ganesh (Ganesh), M.D.]

Greetings Drs. Hardison and Kuhn,

 

Thanks for the prompt and courteous reply.

Dr Hardison you are spot-on with the fact that there are polymorphisms that interfere with the submitted sequence.

The primer sequences belong to the -3.7kb deletion and have been curated from the literature (file attached).

How should I proceed to arrive at a translatable nucleotide sequence for this -3.7kb deletion?

I downloaded the FASTA file for HBA gene and could not find the primer sequence there.

 

Thanks & regards-

 

Ganesh

[Robert Kuhn]

Hello, Ganesh,

As Dr. Hardison pointed out, the primers are =not= contained in the coding region of either of

the HBA genes.  They bracket the two genes.  Any PCR using them would include both genes.  

I have looked at the region and the paper with one of my colleagues and we conclude that you 

may be expecting the PCR primers to work in the case of the 3.7 deletion described in the paper.  

> The primer sequences belong to the -3.7kb deletion 

The primers do not belong to the deletion, but in the paper are described as being on either side of 

the deletion and capable of amplifying the DNA in between, resulting in a 2.02 kb product.

> I downloaded the FASTA file for HBA gene and could not find the primer sequence there.

The gene file will not have the primer sequences.  They will be found if you get the sequence of 

the region shown in Dr. Hardison's image including the DNA on both sides of the gene duplication, 

which you can do using the top bluebar menu and "View > DNA".  

See also the session I have made:

https://genome.ucsc.edu/s/example/hg38_hbaMLQ

The primers are shown in a custom track made from blat using the extra C nucleotide as

described by Dr. Hardison.  You can see that they are =not= in the coding regions of the gene.  

The track marked "3.7 kb deletion -- possibly shifted right or left" was made by removing a copy 

of the DNA spanning both copies presuming that the deletion was mediated by homologous 

recombination and blatting it back to the genome.  The breakpoint was chosen randomly, and

could not be determined anyway, even by sequencing the region, unless the duplication was

accompanied by a repeat of some nucleotides at the breakpoint.

I made a little video of the process and will attach.  It will be sent via a link to google drive.

best regards,

   --b0b kuhn

   ucsc bioinformatics group

 hbaMLQ.mp4

[Robert Kuhn]

> I am looking forward to the video.

I do not understand.  did you not receive the link to the video?  I included it in my reply:

https://drive.google.com/file/d/14hb_yrV4Hyaoi8bx3dGA-roGzJ-jqLkQ/view?usp=drive_web

       --b0b

On Mon, Mar 7, 2022 at 4:00 PM Pandurang, Pujari Ganesh (Ganesh), M.D. <Panduran...@mayo.edu> wrote:

Dear Dr. Kuhn,

Thank you so much for this.

My heartfelt appreciation for the session you made, it is really very helpful.

Further to my understanding through your e-mail, I am attaching a presentation, where I BLASTed these sequences on Genome Data Viewer, and I could get the deleted regions, and clearly as you said, at the end of the probe sequences that I submitted, there were non-coding sequences that could not be translated from these deleted regions!! Hence, I believe, as you rightly pointed out, this approach is not working and I need to think of something else for detection of these deletions by using mass-spectrometry.

I will stay in touch with you and the team and update as and when I hit upon something.

Kindly review the presentation and revert with any input so that we can take this forward.

I am looking forward to the video.

 

Thanks & Regards,

[Pandurang, Pujari Ganesh (Ganesh), M.D.]

Dear Dr. Kuhn,

Thank you so much for this.

My heartfelt appreciation for the session you made, it is really very helpful.

Further to my understanding through your e-mail, I am attaching a presentation, where I BLASTed these sequences on Genome Data Viewer, and I could get the deleted regions, and clearly as you said, at the end of the probe sequences that I submitted, there were non-coding sequences that could not be translated from these deleted regions!! Hence, I believe, as you rightly pointed out, this approach is not working and I need to think of something else for detection of these deletions by using mass-spectrometry.

I will stay in touch with you and the team and update as and when I hit upon something.

Kindly review the presentation and revert with any input so that we can take this forward.

I am looking forward to the video.

 

Thanks & Regards,

 

Ganesh

 

 

From: Robert Kuhn <ku...@soe.ucsc.edu>
Sent: Monday, March 7, 2022 4:15 PM
To: Pandurang, Pujari Ganesh (Ganesh), M.D. <Panduran...@mayo.edu>
Cc: Ross Hardison <rc...@psu.edu>; Belinda M. Giardine <giar...@bx.psu.edu>; gen...@soe.ucsc.edu; Robert Kuhn <ku...@soe.ucsc.edu>