[Shiaoching Gong]

Hi Sir/Madam,

I am looking for a link to find a similar plot for other genes. Could you please let me know where I can get the similar plot.

Thank you so much.

Best,

Shiaoching

[Luis Nassar]

Hello, Shiaoching.

Thank you for your interest in the Genome Browser.

That graphic you share looks similar to our interact (https://genome.ucsc.edu/goldenPath/help/interact.html) track type. Could you share some more information on what kind of data you are looking for, and where the shared image is from?

For reference, here is a session displaying one of our interact tracks: http://genome.ucsc.edu/s/Lou/RM29095

I hope this is helpful. Please include gen...@soe.ucsc.edu in any replies to ensure visibility by the team. All messages sent to that address are archived on our public forum. If your question includes sensitive information, you may send it instead to genom...@soe.ucsc.edu.

Lou Nassar
UCSC Genomics Institute

--

---
You received this message because you are subscribed to the Google Groups "UCSC Genome Browser Public Support" group.
To unsubscribe from this group and stop receiving emails from it, send an email to genome+un...@soe.ucsc.edu.
To view this discussion on the web visit https://groups.google.com/a/soe.ucsc.edu/d/msgid/genome/BL0PR11MB32188BC5CE7E5AF9FF1263E8B60F9%40BL0PR11MB3218.namprd11.prod.outlook.com.

[Shiaoching Gong]

Thanks so much Luis for your kind note and the links. They are very helpful.

I have another question about the finding the transcription factors binding sites. For MEF2C, I was able to get the TFs for human, but could not get the mouse Mef2C TFs binding sites. 

I checked the 2022 mouse genome, was unable to find the same for mouse Mef2C TFs binding sites. Could you please advise?

Thank you very much for your time and help.

Best,

Shiaoching

---

From: Luis Nassar <lrna...@ucsc.edu>
Sent: Monday, March 14, 2022 8:16 PM
To: Shiaoching Gong <go...@mail.rockefeller.edu>
Cc: gen...@soe.ucsc.edu <gen...@soe.ucsc.edu>
Subject: Re: [genome]

 

Caution: External email

[Shiaoching Gong]

Good afternoon Luis,

I have the following link showing the transcription factors. Is it possible for me to put them in an excel sheet to include all the TFs potentially involved in MEF2c transcriptional regulation? 

 

https://genome.ucsc.edu/cgi-bin/hgTracks?db=hg19&lastVirtModeType=default&lastVirtModeExtraState=&virtModeType=default&virtMode=0&nonVirtPosition=&position=chr5%3A87828193%2D88385787&hgsid=1304857063_E5lSUAUg2wy6A00bLXeorzPKQvZT 

 

Thanks so much, 

Shiaoching 

---

From: Shiaoching Gong <go...@rockefeller.edu>
Sent: Tuesday, March 15, 2022 11:36 AM
To: Luis Nassar <lrna...@ucsc.edu>; Shiaoching Gong <go...@mail.rockefeller.edu>

[Shiaoching Gong]

Hi Brian,

Hope this email finds you well.

Sorry to have another question for you.

I have a gene, named MEF2C. I need to know how it is regulated by other transcription factors, I found the following information:

Do you know how to get rid of the unreal transcription factors and keep the strong transcription factors? The above TFs are too many to be true. I need to focus on a few important ones. I also need to know how to put them in an excel file.

Thanks so much for your time and help.

Best,

Shiaoching

[Brian Lee]

Dear Shiaoching,

Thank you for using the UCSC Genome Browser. It may help to know we have an archive of previously answered questions. Here is a link to the previous answers that include some of your own questions: https://groups.google.com/u/1/a/soe.ucsc.edu/g/genome/search?q=Shiaoching

You can search this archive by entering terms of interest. Please take a moment to review our archived list of previously answered mailing list questions before sending multiple similar questions, as you might find help from other investigators who have asked similar questions, or even find the resources shared previously that could answer your current question.

From your questions you have a gene MEF2C and you want to know how it is regulated by transcription factors.  From the screenshots shared in one email you are looking at human data, and from another email you are also looking at the mouse genome and the Mef2C gene, and seeking the transcription factor binding sites (TFBS) in the mouse genome.  In another message you have tracks you have found on human (TFBS Clusters), and you share that you are interested in filtering out a "strong" set and to put them in an excel file.

I will start by looking at the human TFBS clusters track, and share  an option for filtering on score to subselect some items, and how to output this data into an excel loadable document.  Then for the mouse question I'll share the JASPAR TFBS data as a source (available on both the mouse and human genomes), and how it can also be put into an excel loadable file.

PART1 Human TFBS clusters track

How to start from scratch to find tracks

Here are the step-by-step directions, please follow along in the browser as you read these steps. First in a new browser tab, reset your browser. Go to the main page, https://genome.ucsc.edu and go up to the "Genome Browser" menu and select the drop down "Reset All User Settings."  Next go to the "Genomes" tab and select "Human GRCh38/hg38".  Next find the "hide all" button just below the main view, this will hide all default tracks.  Next go to the "Genome Browser" menu and select "Track Search."  Here you can search for items of interest.  Enter "TF" for transcription factor and then click the box for the "TF Clusters" and "JASPAR Transcription Factors" tracks. By clicking the box, the Visibility column should automatically change from "hide" where you can set both to "pack" and then click the "View in Browser" button.

How to view data in the region of interest and adjust display

Now you will be in the main browser view and have these two tracks on hg38 with transcription factor information. You can then enter your gene of interest,  MEF2C, and click the "go" button on the far right.  There will be several potential matches, the assumption is that you will want MEF2C (ENST00000424173.6) at chr5:88718241-88904257, click that link. Note you can adjust the view by using the "zoom in" and "zoom out" buttons.  Click the zoom out "1.5x" button to see the entire MEF2C gene region. 

After following those above steps, here is a session that you can open in a separate browser tab to see what should be matching results: http://genome.ucsc.edu/s/brianlee/hg38_MEF2C_zoomout

Now you can tailor this view if you wish. For instance, you can click the long grey box on the far right side of the display for the top gene track to arrive at the "GENCODE V39 Track Setting" page.  On this page you can look at "Tagged Sets:" and click the box for "MANE only" which will reduce the transcripts to only transcripts with Matched Annotation from NCBI and EMBL-EBI (MANE).  Then click "submit" this will reduce the gene track display and reduce the number of transcripts, which likely will be of interest.  Next you can click into the grey box on the left-hand side to arrive at the "TF Clusters Track Settings" page.  Here you could use the "Filter by factor" option to reduce the displayed TFs to a subset of specific interest.  Also, take a moment here to read the Track Description page, it will explain many things about this data.  Of importance, read in the "Methods" section the details about how the "score" value is calculated. You can use the score as a way to filter the TFBS to a stronger set as desired.

How to export the TFBS Clustered Data on the Table Browser to a file that will load in Excel.

While on the "TF Clusters Track Settings" page, which again you can go to by clicking the left-side grey box when browsing the track, you need to find and then click the "view table schema" link, this will open a new tab. This new schema page will show you the fields for this table of data, and the table name will be displayed, "Primary Table: encRegTfbsClustered".  When you are on a schema description page like this, you can go to the top blue "Tools" option from the menu bar and then select the "Table Browser" selection. This will automatically set into th Table Browser the very table already being viewed, already selected.  However, if you needed to find it, you would set the "group: Regulation" and the "track: TF Clusters" and the "table: encRegTfbsClustered" to narrow down on this table on hg38 (again the above step of accessing the Table Browser from a schema description page will have done this for you automatically). Note too that at this point the position as well will be prefilled for the region you were browsing, chr5:88,671,736-88,950,761, in this case when zoomed out by 1.5x around the gene.

At this point, with the encRegTfbsClustered selected in the Table Browser for the position around the gene of interest, you can go to the "output filename" box and put in a name like "MEF2C_TfbsClustered.csv", however, be absolutely sure to also select radio button next to "csv (for excel)" before you click "get output" so the file will indeed be a .csv file downloaded.  The resulting downloaded MEF2C_TfbsClustered.csv file can then be opened in Excel.  Note that the first column will be "bin" which is an internal number used in our system that you may not want.  If you didn't want that column, or other columns, you could change the "output format" in the Table Browser from "all fields from selected table" to the option of "selected fields from primary and related fields" where upon clicking "get output" a new screen would allow you to pick only the fields of interest, or even add fields from related tables (such as hg38.factorbookMotifCanonical in this case).

How to reduce the number of items in the TFBS Clustered Data on the Table Browser

If you wish to reduce the number of the items in the output from the encRegTfbsClustered table in the Table Browser for the position around the gene of interest, you can use the "filter" option.   Go back to the step before "get output" on the Table Browser and click the "create" button next to "filter" so that you will arrive on a new page.  Here you will see those fields again from the encRegTfbsClustered table, with many options to select upon them.  You can go to the "score is" row, and change the dropdown option from "ignored" to ">" for greater than and then enter a number like 700 on the far right (score is between 0 and 1000, as explained on the referenced Track Description page). Click "submit" to leave the filter page and then "get output" and the newly downloaded MEF2C_TfbsClustered.csv file will only have items with a score of 700 or above, reducing many of the items.

Please spend some time on your own trying these steps. You can save your selections for the future by using the "My Data" and "My Sessions" menu.  To save sessions, you will need to create an account with an email, but this will allow you to stop and create as many snapshots of your steps as you wish.  At any moment in your selection process you can go to "My Data" and then "My Sessions" and enter a new name to save explaining your steps.  With saved sessions you can revisit in the future what you have done in the past, you can also click a "details" link to paste steps (such as these shared) for your session. And it will allow you to amend some of your selections so you can find different results.   Here is a session from making some of these steps: http://genome.ucsc.edu/s/brianlee/hg38_MEF2C_TableSelections

PART2  Mouse mm10 JASPAR TFBS data

Review the above "How to start from scratch to find tracks" and "How to view data in the region of interest and adjust display" sections and instead of using hg38 go to "GRCm38/mm10" and then use "TF" in the track search step.  Set the "JASPAR Transcription Factors" track on mm10 to "pack" and then search "Mef2C" and select "Mef2c (ENSMUST00000198199.4) at chr13:83504034-83663343" from the search results, and then zoom out "1.5x" as well.  Next click into the grey box for the "JASPAR Transcription Factors Track Settings" and click the "Schema" link on the far right.  By clicking the Schema link you will see the fields for the "Primary Table: jaspar2022" and from this page you can use the Tools menu to arrive at the Table Browser, so this table will be automatically selected for you.  Here click the "create" button next to "filter:" and for the "score is" field set it from "ignored" to ">" for greater than and put in a value such as 700 and then click submit.  Then put in the "output filename:" field a name like "mm10Jaspar_Mef2c_score700.csv" and be sure that you click the button next to "csv (for excel)" and then click "get output" to download the results. Open the resulting file in Excel.

It is highly recommended you make sessions as you step through these processes. With session links you create you will then have bookmark links back to familiar steps in case in the future you need to return to these steps.  Or if you make minor adjustments, or pick other data tables, these session links will let you return to intermediate steps.

Also, sessions can be shared, and made public, where the details about steps can be viewed.  In fact, here is one of the mouse steps to check only after you try doing the above steps on your own: https://genome.ucsc.edu/cgi-bin/hgPublicSessions?search=Shiaoching

Thank you again for your inquiry and for using the UCSC Genome Browser. If you have any further public questions, please send new questions to gen...@soe.ucsc.edu. All messages sent to that address are archived on a publicly accessible forum to help others find answers to similar questions. If your question includes sensitive data, you may send it instead to genom...@soe.ucsc.edu, which is a private internal list to our support team.

All the best,

--

---
You received this message because you are subscribed to the Google Groups "UCSC Genome Browser Public Support" group.
To unsubscribe from this group and stop receiving emails from it, send an email to genome+un...@soe.ucsc.edu.

To view this discussion on the web visit https://groups.google.com/a/soe.ucsc.edu/d/msgid/genome/BL0PR11MB32187A096DDCADB3F64CBE4CB6109%40BL0PR11MB3218.namprd11.prod.outlook.com.

[Brian Lee]

[Brian Lee]

Hi Shaioching,

You can click the grey box on the left side of tracks to jump to the Track Settings page. 

Another way is to click into an item for a track and often there will then be a lik that says "Go to TRACK_NAME track controls" where settings can be changed.

All the best,

Brian

On Wed, Mar 16, 2022 at 1:55 PM Shiaoching Gong <go...@mail.rockefeller.edu> wrote:

 

Thanks so much Brian.

I am sorry to have so many questions. 

I am on the above page and do not know how to get the "TF Clusters Track Settings" page.

I selected Genome Browser, Tools, Mirrors, Downloads, my data, or view, but was unable to get "TF Clusters Track Settings" page.

I am sorry for not being able to follow. Could you please advise?

Thank you very much.

Best,

Shiaoching

---

From: Brian Lee <bria...@soe.ucsc.edu>
Sent: Wednesday, March 16, 2022 4:04 PM

To: Shiaoching Gong <go...@mail.rockefeller.edu>
Cc: gen...@soe.ucsc.edu <gen...@soe.ucsc.edu>

Subject: Re: Fw:

 

Caution: External email

[Shiaoching Gong]

Thanks so much Brian.

I am sorry to have so many questions. 

I am on the above page and do not know how to get the "TF Clusters Track Settings" page.

I selected Genome Browser, Tools, Mirrors, Downloads, my data, or view, but was unable to get "TF Clusters Track Settings" page.

I am sorry for not being able to follow. Could you please advise?

Thank you very much.

Best,

Shiaoching

---

From: Brian Lee <bria...@soe.ucsc.edu>
Sent: Wednesday, March 16, 2022 4:04 PM
To: Shiaoching Gong <go...@mail.rockefeller.edu>
Cc: gen...@soe.ucsc.edu <gen...@soe.ucsc.edu>
Subject: Re: Fw:

 

Caution: External email

Dear Shiaoching,

[Shiaoching Gong]

Thanks so much Brian for your help, patience and kindness. I really want to know if I can do something for you.

I am very sorry for causing so much trouble for you. 

Have a great rest of your day!

All the best and with great appreciation,

Shiaoching

---

From: Brian Lee <bria...@soe.ucsc.edu>
Sent: Wednesday, March 16, 2022 5:01 PM

[Shiaoching Gong]

Dear Sir/Madam,

Hope all is well with you.

I searched IRF3 binding site on NPAS4 and got the following information.

 

 

I then got the following DNA sequence from your website. However, I could not find the IRF3 biding site in this sequence.

 

TGCAGAAGCGCTCCGGGAGCCGGGGAGGGAAGCCCGGGAAGTTGCAGGGA

TGGAGCTGCCTGAGCCTAGGGGAACATAGCTACTGTCCGCGGTGCTGAAA

GGGATCTCCTGTCGCCTTCGGGGCGCTGCCCATGGTGCTGACGGCTGCGC

CGGCCGTGTATGGCTCTGTCCATGGTTCTGAACCCACAGTCGGCTTCGGA

GCTCTGTCCGCGGTTCTGAAATTCAGAGCCGCTTTGGAGCTCTGTCCGCG

GTTCTGAAATTAAGAGCCGAGAGGAGCCGACCCCGCTTTAGAAGTCGAGG

GCTTGTGGGCTATGGAGATACAGCAACAGGTTCCCTGGCCAAGAGCTGCG

GGCAGCGGGTCAACAGGTGTTTGCAGAGGCAGGTCCATGAGAAATTCCTC

TGGATTCTCTGAAACTCAGACCATGCCTTCCTCACTTCTTCTCTGCCTCC

CAGTCTTACTCCTGACGCACTACGTCTTCTCGCCCTACAGG

Could you please advise of where is the IRF binding site in the above sequence? I need to target it.

Thanks so much.

Best,

Shiaoching

 

 

 

 

 

From: Brian Lee <bria...@soe.ucsc.edu>
Sent: Wednesday, March 16, 2022 4:04 PM
To: Shiaoching Gong <go...@mail.rockefeller.edu>
Cc: gen...@soe.ucsc.edu
Subject: Re: Fw:

 

Caution: External email

Dear Shiaoching,

[Benoit Ballester]

Hi Shiaoching, 

If I may give you some tip, you could combine the ReMap TF binding track with the JASPAR TFBS track to narrow down the regions that might interest you. 

Here both ReMap/JASPAR tracks are switched on (see screenshot), both are UCSC tracks. 

ReMap is filtered to show any IRF* ChIP-seq peaks. 

JASPAR is filtered to show all IRF* TFBS above a 280 score. 

By doing so, it highlight regions where any TF of the IRF* family binds to (sometimes with similar binding profiles than IRF3). 

Hope this helps, 

Ben

URL of screenshot : https://genome.ucsc.edu/cgi-bin/hgTracks?db=hg38&lastVirtModeType=default&lastVirtModeExtraState=&virtModeType=default&virtMode=0&nonVirtPosition=&position=chr11%3A66417195%2D66429569&hgsid=1593478071_vBdjHONlp4SBYUbZK4Lxzxresmm9 

--
Benoît Ballester, PhD
Inserm U1090, TAGC
Campus de Luminy
13288 Marseille Cedex 9
France
+33 4 91 82 87 28
(1st)  benoit.b...@inserm.fr
(2nd) benoit.b...@univ-amu.fr 

ReMap2022: http://remap.univ-amu.fr/

On 20 Mar 2023, at 22:28, Shiaoching Gong <go...@rockefeller.edu> wrote:

Dear Sir/Madam,

Hope all is well with you.

I searched IRF3 binding site on NPAS4 and got the following information. 

<image001.png>

 

 

I then got the following DNA sequence from your website. However, I could not find the IRF3 biding site in this sequence.

 

TGCAGAAGCGCTCCGGGAGCCGGGGAGGGAAGCCCGGGAAGTTGCAGGGA

TGGAGCTGCCTGAGCCTAGGGGAACATAGCTACTGTCCGCGGTGCTGAAA

GGGATCTCCTGTCGCCTTCGGGGCGCTGCCCATGGTGCTGACGGCTGCGC

CGGCCGTGTATGGCTCTGTCCATGGTTCTGAACCCACAGTCGGCTTCGGA

GCTCTGTCCGCGGTTCTGAAATTCAGAGCCGCTTTGGAGCTCTGTCCGCG

GTTCTGAAATTAAGAGCCGAGAGGAGCCGACCCCGCTTTAGAAGTCGAGG

GCTTGTGGGCTATGGAGATACAGCAACAGGTTCCCTGGCCAAGAGCTGCG

GGCAGCGGGTCAACAGGTGTTTGCAGAGGCAGGTCCATGAGAAATTCCTC

TGGATTCTCTGAAACTCAGACCATGCCTTCCTCACTTCTTCTCTGCCTCC

CAGTCTTACTCCTGACGCACTACGTCTTCTCGCCCTACAGG

<image002.png>

<image003.png>

 

Do you know how to get rid of the unreal transcription factors and keep the strong transcription factors? The above TFs are too many to be true. I need to focus on a few important ones. I also need to know how to put them in an excel file.

Thanks so much for your time and help.

Best, 

Shiaoching

 

<image004.png>

-- 

--- 
You received this message because you are subscribed to the Google Groups "UCSC Genome Browser Public Support" group.
To unsubscribe from this group and stop receiving emails from it, send an email to genome+un...@soe.ucsc.edu.

To view this discussion on the web visit https://groups.google.com/a/soe.ucsc.edu/d/msgid/genome/BL0PR11MB3218A6D64C7CA408A3ED69D7B6809%40BL0PR11MB3218.namprd11.prod.outlook.com.

[Gerardo Perez]

Hello, Shiaoching.

Thank you for your interest in the Genome Browser and for your question about the IRF3 binding site.

You could use the JASPAR track and filter for IRF3. You can first search for NPAS4 in the search bar. After finding the NPAS4 region on the genome browser display, you can click the JASPAR Transcription Factors Track (http://genome.ucsc.edu/cgi-bin/hgTrackUi?db=hg38&g=jaspar). Under “Filter by TF name” for JASPAR 2022, select IRF3. Change the display mode to full and click "submit". Here is a session that shows the result of these steps:
http://genome.ucsc.edu/s/gperez2/RM_30858

You can then click on the IRF3 annotation, click “View DNA for this feature”, and then click “get DNA”.

You can also use the Table Browser to find the IRF3 binding site using the JASPAR track. On the Table Browser (http://genome.ucsc.edu/cgi-bin/hgTables):
- Enter NPAS4 for position next to region and click "lookup"
- Select JASPAR Transcription Factors for track
- Click “create” for filter
- Enter IRF3 next to TFName does match
- Click "submit"
- Select sequence for output format
- Click "get output" then click "get sequence"

I hope this is helpful. If you have any further questions, please reply to gen...@soe.ucsc.edu. All messages sent to that address are archived on a publicly-accessible Google Groups forum. If your question includes sensitive data, you may send it instead to genom...@soe.ucsc.edu.

Gerardo Perez
UCSC Genomics Institute

--

[Shiaoching Gong]

Dear Dr. Perez,

Thank you so much for your kind note. It is very helpful especially the step by step instruction.

Have a great weekend.

Best,

Shiaoching

 

From: Gerardo Perez <gpe...@ucsc.edu>
Sent: Friday, March 24, 2023 9:31 PM
To: Shiaoching Gong <go...@mail.rockefeller.edu>
Cc: gen...@soe.ucsc.edu

Subject: Re: [genome] Fw: IRF3 binding site, thanks

 

Caution: External email

[Brian Lee]

Dear Schiaoching,

It is a pleasure to help you with your question. Please know, however, I am no longer part of the UCSC Genome Browser and questions are best directed to either their public (gen...@soe.ucsc.edu) or private (genom...@soe.ucsc.edu) mailing list.  

Also, there is an interactive public discussion forum of previous questions and answers that is searchable available from their contacts page, where one can also sign up for announcements about new software and data: https://genome.ucsc.edu/contacts.html

From your screenshots, there are indeed multiple isoforms for this gene in GRCmm39.  What will be of help is that there is a "NCBI RefSeq Select: One representative transcript per protein-coding gene" track that does identify the gene you are looking at as matching their requirements.  Reach more here: https://www.ncbi.nlm.nih.gov/refseq/refseq_select/

To illustrate this new track, here is a session link to try out:  https://genome.ucsc.edu/s/brianlee/mm39_NM_175130

The top track is the NCBI Select track with the accession of the gene you share in your first screenshot.  The second track consists of all the various isoforms that exist.  The lower GENCODE tracks, another gene prediction track separate from NCBI RefSeq, also indicates a matching transcript here.  You can interpret this to mean you have the version of the gene the community identifies as most appropriate to single out.

All the best,

Brian Lee

UCSC Genomics Institute

On Fri, Dec 20, 2024 at 8:05 AM Shiaoching Gong <go...@rockefeller.edu> wrote:

Good morning Brian,

Hope all is well with you.

I have a question regarding the isoforms. I found one isoform of Trpm4 on the top, but with GRcm39, I found another three isoforms. 

Can you please let me know which one I should trust? Does this mean we have 4 isoforms?

Thank you so much. Happy Holidays.

Best,

Shiaoching

---

From: Brian Lee <bria...@soe.ucsc.edu>
Sent: Tuesday, March 21, 2023 12:42 PM
To: Shiaoching Gong <go...@mail.rockefeller.edu>
Cc: Shiaoching Gong <go...@mail.rockefeller.edu>
Subject: Re: IRF3 binding site, thanks

 

Caution: External email

Thanks. Nope, that probably was another Brian Lee, it is a very common name. I routinely get emails for another Brian Lee that works here at UCSC too.  :-)

On Tue, Mar 21, 2023 at 9:40 AM Shiaoching Gong <go...@rockefeller.edu> wrote:

Thank you so much, Brian!

You have a great day!

Did you work at UCSD before? 

Best,

Shiaoching

---

From: Brian Lee <bria...@soe.ucsc.edu>
Sent: Tuesday, March 21, 2023 10:57 AM
To: Shiaoching Gong <go...@mail.rockefeller.edu>
Subject: Re: IRF3 binding site, thanks

 

Caution: External email

Best of luck to you!

On Tue, Mar 21, 2023 at 6:50 AM Shiaoching Gong <go...@rockefeller.edu> wrote:

Dear Brian,

Thank you so much for your kind help! You do not need to respond if you are not at work. I really appreciate it and feel guilty for bring up so much trouble for you. 

It is extremely nice of you! I will definitely take your advice.

Have a great day.

All the best,

Shiaoching

---

From: Brian Lee <bria...@soe.ucsc.edu>
Sent: Tuesday, March 21, 2023 9:39 AM

To: Shiaoching Gong <go...@mail.rockefeller.edu>
Subject: Re: IRF3 binding site, thanks

 

Caution: External email

Hi Shiaoching,

I do not know any better than you.  It may be worth doubting there is IRF3 binding.  Or possibly something more complex occurs in this location.  

The ChIP-seq process may generate artifacts, perhaps this isn’t a IRF3 spot. This is more now a research question. 

If I was you I would examine other IRF3 bindings spots and try to make an educated guess based on similar sequence spans that aren’t the exact motif but close to the one seen in this spot. 

All the best. 

On Tue, Mar 21, 2023 at 6:06 AM Shiaoching Gong <go...@rockefeller.edu> wrote:

Good morning Brian.

You do not need to respond right away if you do not have time.

 

I found IRF3 binding side in the first intron and we need to target it.

 

https://genome.ucsc.edu/cgi-bin/hgTracks?db=hg38&lastVirtModeType=default&lastVirtModeExtraState=&virtModeType=default&virtMode=0&nonVirtPosition=&position=chr11%3A66415362%2D66432380&hgsid=1593703957_ecHOO9EIWP7zyVEFCrNGvUfFIppK

 

 

 

 

 

 

 

>hg38_dna range=chr11:66421627-66422118 5'pad=0 3'pad=0 strand=+ repeatMasking=none

CAGTGCAGAAGCGCTCCGGGAGCCGGGGAGGGAAGCCCGGGAAGTTGCAG

GGATGGAGCTGCCTGAGCCTAGGGGAACATAGCTACTGTCCGCGGTGCTG

AAAGGGATCTCCTGTCGCCTTCGGGGCGCTGCCCATGGTGCTGACGGCTG

CGCCGGCCGTGTATGGCTCTGTCCATGGTTCTGAACCCACAGTCGGCTTC

GGAGCTCTGTCCGCGGTTCTGAAATTCAGAGCCGCTTTGGAGCTCTGTCC

GCGGTTCTGAAATTAAGAGCCGAGAGGAGCCGACCCCGCTTTAGAAGTCG

AGGGCTTGTGGGCTATGGAGATACAGCAACAGGTTCCCTGGCCAAGAGCT

GCGGGCAGCGGGTCAACAGGTGTTTGCAGAGGCAGGTCCATGAGAAATTC

CTCTGGATTCTCTGAAACTCAGACCATGCCTTCCTCACTTCTTCTCTGCC

TCCCAGTCTTACTCCTGACGCACTACGTCTTCTCGCCCTACA

 

The IFR3 binding site is 5’ – GAAACTGAAACT – 3’

 

According to literature, IRF3 binding has been shown to be highly dependent on the 5′ GAAA and 3′ GAAA core sequences, whereas other IRFs can tolerate some flexibility in these sequences.

Could you please let me know which one I can target?

Thank you so much!

Best,

Shiaoching

 

 

 

 

 

From: Brian Lee <bria...@soe.ucsc.edu>
Sent: Monday, March 20, 2023 6:19 PM
To: Shiaoching Gong <go...@mail.rockefeller.edu>
Cc: Shiaoching Gong <go...@mail.rockefeller.edu>
Subject: Re: IRF3 binding site, thanks

 

Caution: External email

I just recalled that JASPAR is another data set to look at.  They have TFBS information, if you email the UCSC help support, they'll probably share about JASPAR IRF3 data as well.

 

On Mon, Mar 20, 2023 at 3:13 PM Shiaoching Gong <go...@rockefeller.edu> wrote:

Dear Brain,

Thank you very much for your kind help as always!

Kind regards,

Shiaoching

 

From: Brian Lee <bria...@soe.ucsc.edu>
Sent: Monday, March 20, 2023 6:11 PM
To: Shiaoching Gong <go...@mail.rockefeller.edu>
Subject: Re: IRF3 binding site, thanks

 

Caution: External email

Hi,

 

I can only share what the data is showing.  I don't know either what the correct answer is for this situation.

 

I looked nearby, and look at this IRF3 site: https://genome.ucsc.edu/s/brianlee/IRF3_start

 

In that case there is only one GAAA sequence.

 

It might not hurt to contact the current ENCODE portal too, there is likely even more recent work that might be used to visualize these experimental data.

 

 

 

On Mon, Mar 20, 2023 at 3:02 PM Shiaoching Gong <go...@rockefeller.edu> wrote:

Dear Brain,

Thank you so much for being so kind and helpful. You have been so nice and I can’t thank you enough.

There are several GAAA in that sequence. Did you mean there are several IRF3 binding sites?

Thank you very much!

With great appreciation,

Shiaoching

 

From: Brian Lee <bria...@soe.ucsc.edu>
Sent: Monday, March 20, 2023 5:30 PM
To: Shiaoching Gong <go...@mail.rockefeller.edu>
Subject: Re: IRF3 binding site, thanks

 

Caution: External email

Sure, Shiaoching.  Thank you for your kind message. I'll try to help as best as I can when I have time.  I currently think that the highlight I shared is probably the IRF3 binding spot.

 

How the data was generated is with ChIP-Seq, where the antibody was pulled down with DNA, and then that DNA sequenced. 

 

That means there is experimental evidence that in this location IRF3 binds. 

 

Where exactly is not completely clear, but the motif analysis shows that GAAA is significant, and the Short Match tracks shows many GAAA strings in the region.

 

 

On Mon, Mar 20, 2023 at 2:26 PM Shiaoching Gong <go...@rockefeller.edu> wrote:

Dear Brain,

Thanks so much for your kind note and help. I really appreciat it.

It is sad to know that you are not in UCSC genome browser team. I will send an email to soe. Is it possible to get your help in the future?

With my best wishes,

Shiaoching

 

---

From: Brian Lee <bria...@soe.ucsc.edu>
Sent: Monday, March 20, 2023 5:07 PM
To: Shiaoching Gong <go...@mail.rockefeller.edu>
Subject: Re: IRF3 binding site, thanks

 

Caution: External email

Dear Shiaoching,

 

It is a great pleasure to hear from you.  Thank you for sharing your research.

 

Unfortunately decisions were made to remove me from the UCSC Genome Browser team.   For support, please contact their mailing list at  gen...@soe.ucsc.edu. All messages sent to that address are archived on a publicly accessible forum to help others find answers to similar questions. If your question includes sensitive data, you may send it instead to genom...@soe.ucsc.edu, which is a private internal list to their support team.

 

I took a quick look, and I see this is the motif page for IRF3:

https://www.factorbook.org/tf/human/IRF3/deeplearnedselexmotif

 

If you use the Short Match track and search GAAC in the region you'll find some hits.  For instance, see this highlighted region: https://genome.ucsc.edu/s/brianlee/IRF3

 

All the best,

Brian

 

 

 

 

On Fri, Mar 17, 2023 at 5:47 PM Shiaoching Gong <go...@mail.rockefeller.edu> wrote:

Dear Brian,

Hope all is well with you.

I searched IRF3 binding site on NPAS4 and got the following information.

 

 

I then got the following DNA sequence from your website. However, I could not find the IRF3 biding site in this sequence.

 

TGCAGAAGCGCTCCGGGAGCCGGGGAGGGAAGCCCGGGAAGTTGCAGGGA

TGGAGCTGCCTGAGCCTAGGGGAACATAGCTACTGTCCGCGGTGCTGAAA

GGGATCTCCTGTCGCCTTCGGGGCGCTGCCCATGGTGCTGACGGCTGCGC

CGGCCGTGTATGGCTCTGTCCATGGTTCTGAACCCACAGTCGGCTTCGGA

GCTCTGTCCGCGGTTCTGAAATTCAGAGCCGCTTTGGAGCTCTGTCCGCG

GTTCTGAAATTAAGAGCCGAGAGGAGCCGACCCCGCTTTAGAAGTCGAGG

GCTTGTGGGCTATGGAGATACAGCAACAGGTTCCCTGGCCAAGAGCTGCG

GGCAGCGGGTCAACAGGTGTTTGCAGAGGCAGGTCCATGAGAAATTCCTC

TGGATTCTCTGAAACTCAGACCATGCCTTCCTCACTTCTTCTCTGCCTCC

CAGTCTTACTCCTGACGCACTACGTCTTCTCGCCCTACAGG

Could you please advise of how to get the IRF binding site in the above sequence? I need to target it.

Thanks so much.

Best,

Shiaoching

 

 

 

 

 

From: Brian Lee <bria...@soe.ucsc.edu>
Sent: Wednesday, March 16, 2022 4:04 PM
To: Shiaoching Gong <go...@mail.rockefeller.edu>
Cc: gen...@soe.ucsc.edu
Subject: Re: Fw:

 

Caution: External email

Dear Shiaoching,

[Shiaoching Gong]

Thanks so much Brian for your kind help. This is very helpful.

 

I am sorry to keep bothering you. I will sent to gen...@soe.ucsc.edu next time.

 

Happy Holidays and New Year.

 

Best,

 

Shiaoching

[Brian Lee]

Hi Shiaching,

It is my pleasure. As I am no longer on the Browser, I actually enjoy the chance to revisit it.

All the best,

Brian

[Matthew Speir]

Hello, Schiaoching.

Both options suggested by Brian, RefSeq Select and GENCODE filtered using "MANE only", are a great place to start. In this case they both point to the same RefSeq transcript for Trpm4: NM_175130.4. 

If you have any further questions, please reply to gen...@soe.ucsc.edu. All messages sent to that address are archived on a publicly-accessible Google Groups forum. If your question includes sensitive data, you may send it instead to genom...@soe.ucsc.edu.

---

Matthew Speir

UCSC Genome Browser, User Support

To unsubscribe from this group and stop receiving emails from it, send an email to genome-www+...@soe.ucsc.edu.