how to narrow down different gRNA to individual exon

6 views
Skip to first unread message

Liu, Hao

unread,
Feb 1, 2018, 6:05:54 PM2/1/18
to gen...@soe.ucsc.edu

Hi,

 

After blat the different gRNA sequence , how to narrow down to individual exon of  that gene ?

 

 

Thanks

 

 

Hao

 

 

Cath Tyner

unread,
Feb 2, 2018, 8:25:48 PM2/2/18
to Liu, Hao, gen...@soe.ucsc.edu
Hello Hao,

  Option 1   
Below is an option that may work for you if 1) your exon sequence that you're searching for is a perfect match 2) you are doing this manually for only a few exons. See "Option 2" below for a batch option that doesn't need perfect matches.

In summary, the steps below will do the following: 

1) Blat sequence (I'll use RefSeq NM_004958.3) to a genome (I've used hg38 here). 
2) Use the "Short Match" track/tool to enter a short sequence, where (only perfectly) matching results will appear as a custom track.

In the example below, we'll blat fasta from NCBI RefSeq NM_004958.3, and then we'll use the "Short Match" track under the "Mapping and Sequence" category to input the sequence of a certain exon (I'll use exon 53/58), which will create a separate visualization on a new track (similar to blat results) as a block that aligns to the exon in that accession.

One feature/limitation of the "Short Track" tool is that only perfectly found matches are displayed. In the example below, if you try the same steps but remove one of the nucleotides in the accession sequence, Short Match won't show you a 'block' for that exon, even though it's only off by 1 bp. 

Here are example steps that I took to search for a particular exon's sequence within a blat result:

* Go to chr1:11,106,245-11,131,772
* Top blue menu "View" > get DNA > select all + copy (or, simply copy the fasta for NCBI RefSeq NM_004958.3
* Tools > Blat > paste sequence > submit
* Click the "browser" link in top hit (takes you to the browser page for that top blat result)
* Copy the sequence of an exon. e.g., NCBI RefSeq NM_004958.3, exon 53/58 (below)

>hg38_dna range=chr1:11114317-11114453 5'pad=0 3'pad=0 strand=+ repeatMasking=none
CTGTCCATCAGCCTCCAGTTCAGCAAGGGGTCATAGACAAAGGCTTCCAGCACGGCCATGACACTGTCCTTGTGCTCTCGCAGCACCTCCATCACTGTGTGGCATGTGATTCTGTAGTTGCCATCCAGGCCTGTAAC

From the browser window, click on the track name "Short Match"  and paste the exon sequence that you are searching for into the text field, and press submit. Again, note that only perfectly found matches are displayed. 

Even though exon 53/58 sequence is 137bp, I can still paste it into the Short Match text field (which says the sequence should be "2-30 base"), press submit, and I still see good results. In this example, Short Match sees a perfect match to exon 53/58 in our top blat hit, NCBI RefSeq NM_004958.3, as seen in this session. In this session, you'll see the blue highlight that I added to show you the top blat hit, and you'll see the Short Match tool's result showing a block representing a prefect match to the exon we looked for.

  Option 2   
In summary, the steps below will do the following:

1. Create a custom track of your gDNA blat results.
2. Create a custom track of your exon blat results.
3. Create an intersection to show a 3rd custom track of only the exons that overlap with your gDNA blat results. 

Create a custom track of your gDNA blat results

* Perform your gDNA blat search. In this example, I'll simply use the fasta for NCBI RefSeq NM_004958.3.
* Click "make custom track with these results" and then go to the browser.
* Note that you can click onto the blat result within the browser to see the details of all results.

Create a custom track of your exon blat results
Follow the same steps as above to create another custom track of blat results for your exon. 
Note that you can instead upload a file, where you can perform batch queries.

Now you should have both blat custom tracks loaded (your NM_004958.3 blat results as a custom track, and your exon sequence blat results as a custom track).

Create an intersection
At this point, blat may have found some matches to your exon sequence that lie outside of the regions from the 1st blat, so we'll want to exclude those. 

1st blat .........[----------].............[---------]...................
2nd blat..............[--]...........................................[--] <---we want to ignore this one, no overlap with above.

Now, let's create a 3rd custom track which will show us only the exons that have overlapped with the 1st set of blat results. 

* Tools > Table Browser
* group  = Custom Tracks, track = exonBlatResults
* output format = "custom track"
* intersection - click on "create"

Next, on the "Intersect with exonBlatResults" page, set the following:

* group = Custom Tracks, track = blat_NM_004958.3, table = blat_NM_004958.3 ...

Then select the 1st radio button: "All exonBlatResults records that have any overlap with blat NM_004958.3"
* Click "submit"
* Back at the Table Browser form, click "get output" and then click "get custom track in genome browser".

You'll now have 3 custom tracks "as seen in this final session":http://genome.ucsc.edu/cgi-bin/hgTracks?hgS_doOtherUser=submit&hgS_otherUserName=cath&hgS_otherUserSessionName=MLQ20922finalSession, which shows these 3 custom tracks:

1) your 1st blat results (for this example, blat sequence of NM_004958.3 to hg38)
2) your 2nd set of exon blat results
3) only the 2nd blat results (exon blat) that have any overlap with the 1st blat results (accession blat).

Finally, go back to the browser and click the "configure button" > check the checkbox for "Next/previous item navigation" and "submit".
You now have 2 little gray arrows << or >> at either end of the genome browser graphic, each set of arrows for each track. You can click the little arrows at the left of the browser or at the right of the browser to go to the next downstream or upstream location for that 3rd intersection track. 

View results of "blat within blat results"

You can also now go to the Table Browser and set 'group' = Custom Tracks and 'track' = intersection (or whatever you named your "intersection" 3rd custom track, "clear" the intersection, and then you can change output to "BED" to see all of the items in this intersection track and their regions:

chr1 11114316 11114453 YourSeq 1000 + 11114316 11114453 0

In this example, there is only one result of your "blat within blat results" but if there were any other matches found which were only overlapping with the 1st blat, you would see them in the Table Browser output. 

As you move forward, please feel free to respond to this forum at any time if our support team can provide further assistance, and please always feel free to search our mailing list archives for related posts.

Thank you for contacting the UCSC Genome Browser support team. 
Please send new and follow-up questions to one of our mailing lists below:

  * Post to the Public Help Forum: E
mail 
gen...@soe.ucsc.edu
​ or search the Public Archives
​  * Post to the Mirror Help Forum: Email
 
genome...@soe.ucsc.edu 
or search the Mirror Archives​
​  * Confidential/private help: Email
 
genom...@soe.ucsc.edu

Join us on Social Media! FacebookTwitter, Wordpress BlogYouTube
UCSC Genome Browser Announcements List (for new data & software)
Request on-site training & workshops at your institution

​Enjoy,​
Cath
. . .
Cath Tyner
UCSC Genome Browser, Software QA & User Support
UC Santa Cruz Genomics Institute


--

---
You received this message because you are subscribed to the Google Groups "UCSC Genome Browser Public Support" group.
To unsubscribe from this group and stop receiving emails from it, send an email to genome+un...@soe.ucsc.edu.
To post to this group, send email to gen...@soe.ucsc.edu.
Visit this group at https://groups.google.com/a/soe.ucsc.edu/group/genome/.
To view this discussion on the web visit https://groups.google.com/a/soe.ucsc.edu/d/msgid/genome/CO1P135MB000528FA7D8A910A4CE8047AC0FA0%40CO1P135MB0005.NAMP135.PROD.OUTLOOK.COM.
For more options, visit https://groups.google.com/a/soe.ucsc.edu/d/optout.

Reply all
Reply to author
Forward
0 new messages