In-silico PCR No match

[Wei He]

Dear Sir or Madam:

 I found one thing that gave me a headache. I fed the primers I got from primer3 into the in-silico PCR and got 'No matches to ggagagctggtaatttggtca atcttggctcactgcaacct in Human Dec. 2013 (GRCh38/hg38) '. This is the first time I've come across something like this. I would like to know if there is any solution to this?

 

LEFT PRIMER         27   21   59.18   47.62  4.00  2.00 ggagagctggtaatttggtca

RIGHT PRIMER       612   20   59.87   50.00  4.00  1.00 atcttggctcactgcaacct

SEQUENCE SIZE: 663

 

University of Greenwich, a charity and company limited by guarantee, registered in England (reg no. 986729). Registered Office: Old Royal Naval College, Park Row, Greenwich SE10 9LS.

[Jairo Navarro Gonzalez]

Hello,

Thank you for using the UCSC Genome Browser and sending your inquiry.

Blatting the primers separately did find the left primer (ggagagctggtaatttggtca) in the genome but was unable to find a match for the second primer (atcttggctcactgcaacct). This is most likely due to the second primer being in a repeat region of the genome, which is a known limitation of isPCR and BLAT. If you extend your second primer by a few bases, you should be able to find a more specific match to the genome.

For comparison, the NCBI Primer Blast, https://www.ncbi.nlm.nih.gov/tools/primer-blast/, finds many locations for both database mRNA and database chromosomes, and the search results in many different PCR products.

I hope this is helpful. If you have any further questions, please reply to gen...@soe.ucsc.edu.
All messages sent to that address are archived on a publicly accessible Google Groups forum.
If your question includes sensitive data, you may send it instead to genom...@soe.ucsc.edu.

Jairo Navarro
UCSC Genome Browser

Want to share the Browser with colleagues?
Host a workshop: https://bit.ly/ucscTraining

--

---
You received this message because you are subscribed to the Google Groups "UCSC Genome Browser Public Support" group.
To unsubscribe from this group and stop receiving emails from it, send an email to genome+un...@soe.ucsc.edu.
To view this discussion on the web visit https://groups.google.com/a/soe.ucsc.edu/d/msgid/genome/CWXP265MB0598A03F4F46EC56B5594E9DF5939%40CWXP265MB0598.GBRP265.PROD.OUTLOOK.COM.