blat command line output completely empty but webserver output correct

[Federica Luppino]

Hello,

I have an important topic concerning the comparison between blat command line and webserver version at (Human BLAT Search). 

I am using BLAT v38 (and I have reproduced the error as well with version v39). As suggested in the FAQ, I am using the following command line arguments to reproduce the webserver results:

blat -stepSize=5 -repMatch=2253 -minScore=20 -minIdentity=0 database.2bit query.fa output.psl

The command I am using is:

blat ../reference/hg38.2bit try_chr7.fa -stepSize=5 -repMatch=2253 -minScore=20 -minIdentity=0 out.psl

Some examples on the fasta sequence of the try_chr7.fa:

>chr7:38290616-38291666/rc_sliding:6-25

GAAAGAAGATGAGGTGGTGT

>chr7:38290616-38291666/rc_sliding:10-29

GAAGATGAGGTGGTGTACCA

>chr7:38290616-38291666/rc_sliding:11-30

AAGATGAGGTGGTGTACCAC

>chr7:38290616-38291666/rc_sliding:40-59

TGGATTAGGCACCACAGTGT

The output file out.psl is completely empty, while if I run those sequences on the webserver I get the correct results. In addition, the problem is only related to sequences on chromosome7.

Would you be able to assist me with that? 

Thank you a lot,

Dr. Federica Luppino