Question

[Keyvān Karami]

 

 Hi, my question is that there is some genes like PEG3 and APEG3 in cattle (Bos taurus), these genes are in NCBI databse in cattle genome but i cant find them in Bos taurus 2014 (bos tau8) in UCSC . i want to know how can i search them in UCSC.

THANKS.

--
Regards,

Keyvan

[Mahboobe Akbari]

Hello,

I want to calculate cpg islands for some genes in UCSC, I want to know can I give name of genes in “identifiers (names/accessions)” or  define regions of these genes in “defined regions” I want to know are these two options are the same.

 

 

Sincerely, 

Mahboueh Akbari

[Luvina Guruvadoo]

Hello Mahboueh,

Thank you for your question. The “identifiers (names/accessions)” option will allow you to paste or upload a list of gene names (or identifiers), whereas “defined regions” allows you to enter up to 1,000 regions in a 3- or 4-field BED file format. For more information on how to use the Table Browser, please scroll down to the "Using the Table Browser" section on this page.

Some other useful links:
Table Browser User's Guide

UCSC Genome Browser Training Materials

If you have any further questions, please reply to gen...@soe.ucsc.edu. All messages sent to that address are archived on a publicly-accessible forum. If your question includes sensitive data, you may send it instead to genom...@soe.ucsc.edu.

Regards,

Luvina

--

Luvina Guruvadoo
UCSC Genome Browser
http://genome.ucsc.edu

--

[Brian Lee]

Dear Keyvan,

Thank you for using the UCSC Genome Browser and your question about locating genes like PEG3 and APEG3 in the bosTau8 assembly.

At the gateway page, you can search for "cow" in the box displaying "Enter species or common name" and then arrive at the bosTau8 assembly:http://genome.ucsc.edu/cgi-bin/hgGateway?db=bosTau8

In the box that displays "Enter position, gene symbol or search terms" you can type a gene name like PEG3" and see links that display such as the following:PEG3 at chr18:64267260-64290781 - (NM_001146187) paternally-expressed gene 3 protein isoform 3

By navigating to that region you will find there are some default tracks displayed, including the above hit on a human aligned mRNA in the "Non-Cow RefSeq Gene" track.

If you scroll down to see the other tracks displayed you will find a "Cow mRNAs from GenBank" track that includes a displayed item, AY427787. Clinking into the details page for this item will lead you back to the NCBI mRNA information page: link http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Search&db=Nucleotide&term=AY427787&doptcmdl=GenBank&tool=genome.ucsc.edu

In case it is helpful, here is session of this region with AY427787 displayed at the top (you can drag and drop to reorder tracks):
http://genome.ucsc.edu/cgi-bin/hgTracks?hgS_doOtherUser=submit&hgS_otherUserName=brianlee&hgS_otherUserSessionName=bosTau8.PEG

These tracks are created by aligning the ORIGIN mRNA displayed at NCBI. If you were to copy the DNA sequence on the above AY427787 page you could use the BLAT tool, http://genome.ucsc.edu/cgi-bin/hgBlat?db=bosTau8, to see how it will display at the same position.

Thank you again for your inquiry and using the UCSC Genome Browser. If you have any further questions, please reply to gen...@soe.ucsc.edu. All messages sent to that address are archived on a publicly-accessible forum. If your question includes sensitive data, you may send it instead to genom...@soe.ucsc.edu.

All the best,

Brian Lee
UCSC Genomics Institute

--

[Keyvān Karami]

Hi, My question is how can i "Extract Genomic DNA" and Extracting sequences with Interval output data type for whole genome (all genes) from UCSC like shown?

chr7 127475281 127475310 NM_000230 0 + GTAGGAATCGCAGCGCCAGCGGTTGCAAG

 

--
Regards,

Keyvan

[Christopher Lee]

Hi Keyvan,

Thank you for your question about extracting gene sequence data.

You will not be able to get this data in exactly the format you describe, but you
can use the following Table Browser steps to grab gene sequence in FASTA format, which
includes the gene position information and name in the FASTA header:

1. Navigate to the Table Browser: http://genome.ucsc.edu/cgi-bin/hgTables

2. Make the following selections:
clade, genome, assembly: Make the appropriate selections for your organism of interest
group: Genes and Gene Predictions
track: RefSeq Genes
table: refGene
region: genome
output format: sequence
output file: enter a name for this file

3. As this file can potentially be extremely large, you will probably want to select "gzip compressed"
next to "file type returned".

4. Click "get output".

5. On the "select sequence type" page, select "genomic" and click submit.

6. On the "RefSeq Genes Genomic Sequence" page make your formatting selections
and click "get sequence".

After the file finishes downloading it will be of the following form:

>bosTau8_refGene_NM_001102214 range=chr1:67082114-67116669 5'pad=0 3'pad=0 strand=- repeatMasking=none
TCTTGGCGAAGTGGTGCGTCGTGGACGGGTCGCTGATGAAGAAAGACACA
...
...
...

You can then write a script that arranges this file in your preferred order.

Thank you again for your inquiry and using the UCSC Genome Browser. If you have any further
questions, please reply to gen...@soe.ucsc.edu. All messages sent to that address are archived
on a publicly-accessible forum. If your question includes sensitive data, you may send it instead
to genom...@soe.ucsc.edu.

Christopher Lee
UCSC Genomics Institute

--

---
You received this message because you are subscribed to the Google Groups "UCSC Genome Browser discussion list" group.
To unsubscribe from this group and stop receiving emails from it, send an email to genome+un...@soe.ucsc.edu.