Warning/Error(s)

[FG alice]

Dear Madam/Sir,

I tried yesterday and too day to make BLAST in the human genoma and i got the following

-Warning/Error(s): No name in line starting with ‘>’-; however my sequence have a correct FASTA symbol (already used many times for BLAT).

Would you please help me.

With my best regards,

Franco Gabrielli

[Matthew Speir]

Hi Franco,

Thank you for your question about using BLAT. This error indicates that your "definition line" is blank after the ">", such as in this example:
   
    >
    TTCACATTTGAGTTTTTCCAAAATTAAAGGTTGTAGAAGAGTCACAGTAT

Your definition line should have some text following the ">". This text can be anything that you want, such as an accession number or chromosome number and coordinate range. You can find a detailed description and examples of the fasta format on the following pages: http://genetics.bwh.harvard.edu/pph/FASTA.html and http://www.cbs.dtu.dk/services/NetGene2/fasta.php. To make a valid fasta format using the previous example, we could name the sequence "seq1":

      >seq1
    TTCACATTTGAGTTTTTCCAAAATTAAAGGTTGTAGAAGAGTCACAGTAT

If you have a single sequence that you are trying to BLAT, you can submit your sequence without the ">" definition line. I wouldn't recommend trying to submit multiple sequences without the ">" definition line, as it becomes hard to discern which result belongs with which input sequence. Using the same sequence as example, you could submit the following to BLAT without any issues:

    TTCACATTTGAGTTTTTCCAAAATTAAAGGTTGTAGAAGAGTCACAGTAT

You can find more information about using BLAT on the following pages:

• http://genome.ucsc.edu/goldenPath/help/hgTracksHelp.html#BLATAlign
• http://genome.ucsc.edu/FAQ/FAQblat.html
  

I hope this is helpful. If you have any further questions, please reply to gen...@soe.ucsc.edu. All messages sent to that address are archived on a publicly-accessible Google Groups forum. If your question includes sensitive data, you may send it instead to genom...@soe.ucsc.edu.

Matthew Speir
UCSC Genome Bioinformatics Group