Is there a way to make BLAT handle IUPAC base mixtures?

[Guinevere Q. Lee]

Dear all,

In general, does BLAT accept any IUPAC base mixtures?

Here's my input:

>S3120_Cluster1_n17_ConSeq

YAGTAGTGTGTGCCCGTCTGTCCTAACTGCTGTGCCACTGAATTCAGATCTCCCMMHWCYKKKKBSCCCMAWWWWWAAAWYYYCSSSSMCCTMWSTKSYGYBSCA

Web BLAT returns "Sorry no match found."

If I get rid of the 3' mixtures

>S3120_Cluster1_n17_ConSeq

YAGTAGTGTGTGCCCGTCTGTCCTAACTGCTGTGCCACTGAATTCAGATCTCCC

Web BLAT maps it to chr1+

Thank you very much in advance!

Regards,

Guin

[Cath Tyner]

Hello Guin,

Thank you for contacting the UCSC Genome Browser support team. Unfortunately, at this time, we do not provide support for IUPAC codes in our BLAT tool. When BLAT encounters nucleotides that are not A C G or T, they are assumed to be N. Thus, IUPAC codes are the same as N's as far as blat is concerned.

You may be interested in software that can do this, PatMatch:

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC1160129/

We do have some limited IUPAC support in our "Short Match" track in the "Mapping and Sequencing" category. By going to the browser you are interested in and clicking on the track labeled "Short Match" you will see a search box (limit 2-30 bases) which does support IUPAC codes. Once your search is entered, you'll see the results displayed in the Short Match track. This track is not meant to be a search function, it is only a display tool. If the results are not in the current window, the browser will not automatically take you to the results loci; you'll only see results for the current window or unless you navigate to the region where your results are. I'm guessing that this won't solve your problem, but thought I would mention it as an option. 

You might also want to inquire about NCBI's BLAST tool as a possible option. 

https://blast.ncbi.nlm.nih.gov/Blast.cgi?PAGE_TYPE=BlastDocs

https://blast.ncbi.nlm.nih.gov/Blast.cgi?CMD=Web&PAGE_TYPE=BlastDocs&DOC_TYPE=BlastHelp

Please respond to this list if you have further questions, and please always feel free to search our mailing list archives for related posts.

Thank you for contacting the UCSC Genome Browser support team. 

​

Please send new and follow-up questions to one of our mailing lists below:

  * Post to the Public Help Forum: E

mail 

gen...@soe.ucsc.edu

​ or search the Public Archives

​  * Post to the Mirror Help Forum: Email

 genome...@soe.ucsc.edu 

or search the Mirror Archives​

​  * Confidential/private help: Email

 genom...@soe.ucsc.edu

Join us on Social Media! Facebook, Twitter, Wordpress Blog, YouTube

UCSC Genome Browser Announcements List (for new data & software)

Request on-site training & workshops at your institution

​Enjoy,​

Cath
. . .

Cath Tyner

UCSC Genome Browser, Software QA & User Support

UC Santa Cruz Genomics Institute

UCSC Genome Browser

--

---
You received this message because you are subscribed to the Google Groups "UCSC Genome Browser Public Support" group.
To unsubscribe from this group and stop receiving emails from it, send an email to genome+un...@soe.ucsc.edu.
To post to this group, send email to gen...@soe.ucsc.edu.
Visit this group at https://groups.google.com/a/soe.ucsc.edu/group/genome/.
To view this discussion on the web visit https://groups.google.com/a/soe.ucsc.edu/d/msgid/genome/CAKcPFxjy_SSepjeibSfdDQARtQERQxNuZ10S8%3Dvid8QRwK%3D-%2Bg%40mail.gmail.com.
For more options, visit https://groups.google.com/a/soe.ucsc.edu/d/optout.