Dear UCSC Genome Informatics Group,
I've done several alignments using BLAT and have some doubts about the results I've seen.
Basically, I would like to know why when I align the sequence below to the human genome no matches were found
>BP2_1697
TCTTGCGACCCGGGTTCGTTTCCCGGGCGGC
but when the alignment is done using the following sequence (that contains the first sequence) matches found
>BP2_2
ATCATGCAAGATTCCCATTCTTGCGACCCGGGTTCGTTTCCCGGGCGGCGCACCA
Shouldn't the first sequence also match to human genome?
Many thanks for your reply.
Best wishes,
Mariana
--
Mariana Flores-Torres
Consorcio Metabolismo RNA y Vesiculas Extracelulares
Instituto Nacional de Medicina Genomica