UCSC pairwise alignment

[沖 真弥]

Dear UCSC Genome Informatics Group

I downloaded Pairwise alignment file (monDom5 vs mm9) from following URL:

http://hgdownload.soe.ucsc.edu/goldenPath/monDom5/vsMm9/axtNet/chrX.monDom5.mm9.net.axt.gz

I found that many of alignment positions seemed to be different from the sequences. For example:

11497   chrX    79276715        79276938        chrX    36191914        36192136        -       13983

GCACACACGCTCACTCACGTCTGCAGTAGGCTGTCCCAGACCAGCGCCGGCTTGGCAGGCAGTTCACGGACCTCTGGCCGATCAGCCGATAGCCCCGGTCGCAGGACAGCTCACACCGGGTGCCCAAGCTGCTGTGATAGTTACCCCCCCTTGGGGAGTAGCAAGTGGCTTCTCCATCTTGAATGTTCAAAGTATAGCACCATCGGGGCACTAGAGAAACAGAA

GCTCACATGC-AACTTACGCCTGCAGTAGGCAGTTCCAGACCAACGCCGGCTTGGCAAACATTGCACTGACTTCCGTCCAATCAATCGAAAGCCCCGGTCACAGGAGAGCTCACAACGTGTGCCTAGGCTACTGTGATAATTTCCTCCCCTTGGTGAGTAGCATGTGGCTTCTCCATCCTGGATATTCAATGTGTAACACCATCGGGGGACTGTAGTAGCAGAA

Although the line 2 sequence is exactly matched with monDom5 chrX:79276715-79276938, the line 3 is not with mm9 chrX:36191914-36192136, rather chrX:130458383-130458161 would be correct.

Is it a bug?

Best wishes,

Shinya Oki

-　-　-　-　-　-　-　-　-　-　-　-　-　-　-
so...@dev.med.kyushu-u.ac.jp
Department of developmental Biology
Graduate School of Medical Sciences
Kyushu University
3-1-1 Maidashi, Higashi-ku, Fukuoka 812-8582
tel: +81-92-642-6259
fax: +81-92-642-6260

[Jairo Navarro Gonzalez]

Dear Shinya,

Thank you for using the UCSC Genome Browser and your inquiry.

The discrepancy is due to how we store the alignment coordinates. Minus strand coordinates in axt files are handled differently from how they are handled in the Genome Browser. Specifically,

1. Coordinates positions are stored with respect to the positive strand
2. Start position, chromStart, is 0-based (add 1 to get the actual base position) and the chromEnd is 1-based.
3. If the strand is negative, the start position is the chromEnd and the end position is the chromStart.

According to the axt format page, http://genome.ucsc.edu/goldenPath/help/axt.html:

If the strand value is "-", the values of the aligning organism's start and end fields are relative to the reverse-complemented coordinates of its chromosome.

You can use the following formula to convert minus-strand axt coordinates to Genome Browser display coordinates: 

start = (chromSize - axtEnd) + 1 
end = chromSize - (axtStart - 1) 

In this case, the size of chrX in mm9 is 166,650,296, so: 

Start: (166,650,296 - 36,191,914) + 1 = 130,458,383 
End: 166,650,296 - (36,192,136 - 1) = 130,458,161

These coordinates match the position you shared: chrX:130458383-130458161.

I hope this is helpful. If you have any further questions, please reply to gen...@soe.ucsc.edu.
All messages sent to that address are archived on a publicly-accessible Google Groups forum.
If your question includes sensitive data, you may send it instead to genom...@soe.ucsc.edu.

Jairo Navarro 
UCSC Genomics Institute

--

---
You received this message because you are subscribed to the Google Groups "UCSC Genome Browser Public Support" group.
To unsubscribe from this group and stop receiving emails from it, send an email to genome+un...@soe.ucsc.edu.
To post to this group, send email to gen...@soe.ucsc.edu.
Visit this group at https://groups.google.com/a/soe.ucsc.edu/group/genome/.
To view this discussion on the web visit https://groups.google.com/a/soe.ucsc.edu/d/msgid/genome/7CE4BC8A-5BC5-4C9B-A09D-40FE25BFD50B%40dev.med.kyushu-u.ac.jp.
For more options, visit https://groups.google.com/a/soe.ucsc.edu/d/optout.

[沖 真弥]

Dear Jairo,

Thank you for your nice reply!

Shinya

2017/09/27 1:23、Jairo Navarro Gonzalez <jnav...@ucsc.edu>のメール: