Obtaining pre-mRNA sequence

[Amy Larson Gordon]

Hello!

 

I was wondering if you could give me instructions on how to get the pre-mRNA sequence when I am looking at a particular gene.  For example, DGKZ.  I would like to get the sequence of the UTRs, exons, and introns.  I have tried searching around the browser and feel like I am missing something obvious.

 

Thanks!

Amy

 

Amy Gordon, Scientist II | Skyhawk Therapeutics, Inc. | 35 Gatehouse Drive, Waltham MA | 617.858.0041 x.748 (o)  | AMY.G...@SKYHAWKTX.COM

 

[Jairo Navarro Gonzalez]

Hello,

Thank you for using the UCSC Genome Browser and sending your inquiry.

The best way to obtain the sequence for a gene is to use the Table Browser
(https://genome.ucsc.edu/cgi-bin/hgTables) to retrieve the sequence. Using
the steps below, you can obtain the information for the DGKZ gene on hg38
using the NCBI RefSeq track.

Step 1: Configure the Table Browser

Go to the Table Browser and apply the following settings.

clade: mammal
genome: Human
assembly: Dec. 2013 (GRCh38/hg38)
group: Genes and Gene Predictions
track: NCBI RefSeq
table: RefSeq All (ncbiRefSeq)
region: genome
output format: sequence

Step 2: Define region of interest

Next to identifiers (names/accessions):, click the paste list button.
You then should be able to paste the genes of interest, in this case, DGKZ.

Step 3: Get output

Once you have set your preferences on the Table Browser, click the get output
button. You will be taken to another page where you will select the genomic
option and click submit. You will then be able to select the UTRs, exons, and
introns for the genes you inserted in Step 2. Once you selected all the regions
you want, click the get sequence button.

You should then get output like the following:

>hg38_ncbiRefSeq_NM_001105540.2 range=chr11:46361606-46380551 5'pad=0 3'pad=0 strand=+ repeatMasking=none
CAAACTAGGACTTGCTCAGCAGAGGCCGCCAGCCCGGAGCTGGATCCAGA
GCCCGGCCTTGGGGACCCCAGCTCCCACCTGCGCCCTGCCTTCCAGATCA
GGTCAAAAGGGGCCCCCAGCCCCTCCTTGCTTTCTGCTTCCTCCCTCTGT
ATCTGGCTGGGTGGGTGCGGGGAGGGTTGGATCCGGGCGGACCCGGGCCC
CACCATCCCTAGGCAAGGAGCCTGCCCTGCCAGGTTCCTGAAGCTGATGG
AAAAGGGTCCCCCCGAGCTCCTGCTGAGCCAGGGCAGACCCTGCCGACTA
AACACTCACTGGCCTGGTCGCCTTCTTACCATCCAGCCTGGCCCACCTGC
...

If you are new to using the UCSC Genome Browser, you may find the following training page useful:
https://genome.ucsc.edu/training/

I hope this is helpful. If you have any further questions, please reply to gen...@soe.ucsc.edu.
All messages sent to that address are archived on a publicly accessible Google Groups forum.
If your question includes sensitive data, you may send it instead to genom...@soe.ucsc.edu.

Jairo Navarro
UCSC Genome Browser

Want to share the Browser with colleagues?
Host a workshop: https://bit.ly/ucscTraining

--

---
You received this message because you are subscribed to the Google Groups "UCSC Genome Browser Public Support" group.
To unsubscribe from this group and stop receiving emails from it, send an email to genome+un...@soe.ucsc.edu.
To view this discussion on the web visit https://groups.google.com/a/soe.ucsc.edu/d/msgid/genome/BLAPR19MB4595B16A5F2B948E8E4E5F9889139%40BLAPR19MB4595.namprd19.prod.outlook.com.