Re: OT Robert Bunsen.
Mild&Bitter
> Just out of interest, does anybody know if these are still used in
> schools, or have they been ousted by some Health and Safety
> regulation?
They still use them but the scholars wear plastic googles which adds to
the general appearance of incompetence.
I wonder if they still play with sodium?
--
M0WYM
www.radiowymsey.org
Sales @ radiowymsey
http://shop.ebay.co.uk/gnome7763/m.html?
Brian Reay.
news:in2cfj$ga7$1...@dont-email.me...
> On 31/03/11 17:16, lu...@eternal-flames.gov wrote:
>
>> Just out of interest, does anybody know if these are still used in
>> schools, or have they been ousted by some Health and Safety
>> regulation?
>
>
> They still use them but the scholars wear plastic googles which adds to
> the general appearance of incompetence.
>
> I wonder if they still play with sodium?
I'm not sure "play" is the right word but the old sodium "skating" on water
demo is still done I believe.
--
73
Brian G8OSN/W8OSN
www.g8osn.net
Brian Howie
<mas...@radiowymsey.org> writes
>On 31/03/11 17:16, lu...@eternal-flames.gov wrote:
>
>> Just out of interest, does anybody know if these are still used in
>> schools, or have they been ousted by some Health and Safety
>> regulation?
>
>
>They still use them but the scholars wear plastic googles which adds to
>the general appearance of incompetence.
>
>I wonder if they still play with sodium?
>
We were allowed to make cider from fermenting apples, then distilled it
to get ethanol. The Chem master let us taste it. He probably passed the
rest round the staff room.
We also played with mercury, radioactive sources, experimented on
ourselves with nitric acid, anodised aluminium in hot sulphuric acid.
It's a wonder we survived to 6th year.
B
--
Brian Howie
Brian Morrison
Brian Howie <br...@nospam.demon.co.uk> wrote:
> It's a wonder we survived to 6th year.
What other way to learn how to do these things is there? If you don't
do it, you can't learn anything.
--
Brian Morrison
Serendipity
we had to light all the bunsen burners in both labs to keep the place warm.
We had a store cupboard which contained such delights as sticks of white
phosphorous (kept in water), lumps of potassium metal, sodium metal,
concentrated sulphuric and hydrochloric acid. An unusual one was
hydrofluoric acid that was stored in (I believe) a gutta-percha bottle
because it would have eaten its way through a glass vessel!
I remember an interesting experiment where the teacher dissolved Iodine
crystals in some ammonia solution. The resulting black solid was left to dry
on some filter paper. When it was stoked with a feather, it detonated with a
loud bang accompanied by a purple cloud!
Calcium carbide was interesting stuff too!
Eee - they don't know they're born today!
Ian Jackson
lu...@eternal-flames.gov writes
>On Thu, 31 Mar 2011 18:09:07 +0100, Mild&Bitter
><mas...@radiowymsey.org> wrote:
>
>>On 31/03/11 17:16, lu...@eternal-flames.gov wrote:
>>
>>> Just out of interest, does anybody know if these are still used in
>>> schools, or have they been ousted by some Health and Safety
>>> regulation?
>>
>>
>>They still use them but the scholars wear plastic googles which adds to
>>the general appearance of incompetence.
>>
>>I wonder if they still play with sodium?
>
>Potassium Nitrate used to be a favourite of the Autumn term, right up
>until November 5th... There was never a shortage of Sulphur and
>Charcoal.
>
I could never make good gunpowder from those ingredients. Others were
far more effective!
--
Ian
Ashley Booth
My school had a caving club so carbide was easy to come by. Half fill
an ink bottle with water (explain what that is to a youngster), drop in
a few lumps of carbide, quinkly screw on the lid and lob :)
--
Ashley
For Windsor Weather see www.snglinks.com/wx
Neil Evans
"Serendipity" wrote in message news:lh4lp.1462$5t2...@newsfe06.ams2...
>I remember an interesting experiment where the teacher dissolved Iodine
>crystals in some ammonia solution. The resulting black solid was left to
>dry on some filter paper. When it was stoked with a feather, it detonated
>with a loud bang accompanied by a purple cloud!
Ammonium Triiodide NH4I3 or ‘touch explosive’ as it was known to our circle
of
sixth formers dedicated all things that went bang. Several distinguished
careers
in chemical engineering began whilst mixing sugar and weedkiller (allegedy
!)
Happy days
Neil
lu...@eternal-flames.gov
To work really well you have to compress it into some sort of
container.
We used empty Smarties tubes. Cut in half and with a new false bottom
put in what had been the top and a cardboard disk with a small hole in
for the fuse, waxed to the new top. Wrap the tube with paper
parcel-tape to build up the thickness and strengthen it. Use
crepe-paper to hold the contents within. Got a hell of a bang if you
made them right. :-)
Nick
lu...@eternal-flames.gov
wrote:
>Ammonium Triiodide NH4I3 or ‘touch explosive’ as it was known to our circle
>of
>sixth formers dedicated all things that went bang. Several distinguished
>careers
>in chemical engineering began whilst mixing sugar and weedkiller (allegedy
>!)
>Happy days
>
>Neil
Good to see that so many agree the school chem-lesson - aka Bangs and
Smells - was so enjoyable. :-)
Nick.
Serendipity
and it was said he banged two lumps of Uranium together - we never saw him
again, but where the shed stood was a huge suspicious-looking crater next
morning!
Steve Eldridge
> Good to see that so many agree the school chem-lesson - aka Bangs and
> Smells - was so enjoyable. :-)
You must have gone to a progressive school, bangs and smells were
restricted to the bike-shed at mine, but they were enjoyable! - Oh Carol!
--
Steve
lu...@eternal-flames.gov
wrote:
>You must have gone to a progressive school, bangs and smells were
>restricted to the bike-shed at mine, but they were enjoyable! - Oh Carol!
If kids don't get to do these sorts of things in school anymore
they're really missing out on a lot (including the chance to blow
themselves to bits).
But as Brian M. said, if you don't do it, you don't learn.
Nick.
Brian Reay.
news:Lf5lp.2362$9z4...@newsfe14.ams2...
Lucky you, I went to an all boys school. Bike sheds were strictly for
smoking ;-)
(And bikes).
Steve Eldridge
Quite, in between bangs and smells, us boys managed to misappropriate
several yards of magnesium ribbon which gave us endless fun and the girls
scares, not to mention a bit of fire damage to a hut or two!
Happy Days and we learnt to make better pyrotechnics from our
experiments!
--
Steve
Chris
We were fortunate in that there was a mines rescue unit close by the school
so every few months they would generate about 30 litres of liquid oxygen
for us to play with.
It's quite fun actually trying to find something that won't burn in liquid
oxygen as it happens - aluminium windowframes are quite good when you
finally persuade them to get going.
Phister
The best gunowder container was a sparklets cylinder, using a length of
jetex fuse as the timer..........ha ha
--
DNA signature encryption key........
ATTGGTGCATTACTTCAGGCTCT
Chris Kirby
>Lucky you, I went to an all boys school. Bike sheds were strictly for
>smoking ;-)
>(And bikes).
Ah Yes; the school bike. Every school had one...
--
Chris
G4FZN
Pointer
"Brian Morrison" <b...@fenrir.org.uk> wrote in message
news:20110331185...@surtees.fenrir.org.uk...
Many, many years ago our physics teacher was demonstrating the
iodine/starch test over a bunsen,
From the back row of the crowded lab I attached a rubber hose, opened the
gas tap and blew hard.
Pop went his bunsen.
Great hilarity!
and it wasn't Apl 1st.
memories!
P
Brian Morrison
"Neil Evans" <g1...@ntlworld.com> wrote:
>
>
> "Serendipity" wrote in message
> news:lh4lp.1462$5t2...@newsfe06.ams2...
>
> >I remember an interesting experiment where the teacher dissolved
> >Iodine crystals in some ammonia solution. The resulting black solid
> >was left to dry on some filter paper. When it was stoked with a
> >feather, it detonated with a loud bang accompanied by a purple cloud!
>
> Ammonium Triiodide NH4I3 or ‘touch explosive’ as it was known to our
> circle of sixth formers dedicated all things that went bang.
We used to leave it on the chapel floor so that when the teachers
entered it exploded beneath their shoes. But remaining anonymous was a
shade tricky.
> Several distinguished careers in chemical engineering began whilst
> mixing sugar and weedkiller (allegedy !)
Dangerous if sufficient care is not taken, when I was at school a pupil
tried this in his garden shed using a pestle and mortar, the resulting
explosion killed him.
Later on one of my friends came back to lunch with holes burned in his
tie and shirt and a scorched face because he'd put powdered zinc and
sulphur in a test tube being heated instead of lumps of the stuff. The
accelerated reaction rate led to an explosion, he was lucky he wore
glasses as otherwise he might have been blinded.
On another occasion someone in an A level Chemistry lesson was doing
something with organic solvents and managed to explode a condenser,
luckily for him he was wearing a lab coat and safety goggles and
luckily for me I had my back to him and only had to remove the glass
from my jacket rather than from my face.
Someone else was in a lesson where hydrogen was being made and sucked
into a large ground glass syringe through a pipette-ended pipe. One of
the other pupils decided to take the pipe out of the water trough it
was in, and apply a lighted taper to the end of it. This spat the
plunger out of the end of the syringe at high speed, it shattered on the
next bench and then made a very nasty mess of someone else's chin. IIRC
the person responsible was expelled for that.
--
Brian Morrison
Brian Morrison
Chris <ng...@chris-street.demon.co.uk> wrote:
> It's quite fun actually trying to find something that won't burn in
> liquid oxygen as it happens
Ritz crackers go up with a bright pink flash followed by ash, but one
thing we couldn't get to burn at all was school shepherds' pie that had
been soaked in LOX for about an hour. I think there's a moral in there
somewhere....
--
Brian Morrison
Catweazel
[snip]
Several distinguished careers in chemical engineering began whilst
mixing sugar and weedkiller (allegedy !)
> Happy days
>
When sodium chlorate could be obtained in cardboard boxes, strips of
newspaper soaked in a strong solution made excellent rocket fuel.
a demonstration of a rocket propelled dink-toy to my (then 6yr old
sin) launched a fascination that took him to a degree in chemistry.
--
Thomas the Tank Driver
All boys school. You were a deprived child then ? :o)