Re: Seller refuses to deliver...
Raj Kundra
"Toxic Waste" <Trabant Owners Cl...@nicksplace.co.com> wrote in message
news:UNZOm.8415$Ym4....@text.news.virginmedia.com...
> About 4 weeks ago I purchased 25 items on a BIN from a Platinum seller
> which I considered cheap.
>
> I then received the customary "good news, you are the successful bidder
> email".
>
> This was followed by the "Thank you for your payment" email.
>
> Then, the following day, I receive an email stating there had been a
> "huge" pricing error and would I cancel the purchase.
>
> While I was contemplating my position, another email arrived saying the
> items had been dispatched.
>
> This was followed by an email asking why I had not responded to their
> request to cancel the order. I reminded them, they had sent an email
> stating the items had been dispatched.
>
> I receive another email saying the dispatch notification was yet another
> mistake.
>
> I've offered the compromise, of them sending me 40% other original order,
> which they have refused to do.
>
> Emails have been flying back and forth in an effort to settle this
> amicably, however, they refuse to budge.
>
>
> Any thoughts on my position?
>
> Should I start a dispute or just give up, as it's a Platinum seller and
> Ebay will automatically side with them?
>
> Cheers all
>
> tox
>
>
>
I think there is no way you can force them to sell the item to you.
Name them so others can avoid them.
lurker
> Any thoughts on my position?
The fact that you bought 25 suggests to me that you were aware of the
pricing error.
Were you planning on selling them on for a profit? Hmm
If you had bought, say 1, the seller might have considered honouring the
sale.
Rob Morley
"Toxic Waste" <Trabant Owners Cl...@nicksplace.co.com> wrote:
<snip>
> Any thoughts on my position?
>
I'd have agreed to the cancellation and left neutral feedback already -
why make hassle and unpleasantness? So you thought you were onto a
good thing, and it turns out you weren't - get over it.
lurker
> "lurker" <grah...@googlemail.com> wrote in message
> news:hehprd$qaf$1...@aioe.org...
>> Toxic Waste wrote:
>>
>>> Any thoughts on my position?
>> The fact that you bought 25 suggests to me that you were aware of the
>> pricing error.
>>
>
Of course it depends on what you purchased. 25 ipods or 25 pencils...
> The price was cheap, however,
> it was not outrageously so.
That's subjective.
>> Were you planning on selling them on for a profit? Hmm
>>
>
> Hmm. What plans I had for the items, has no bearing on whether they honour a
> sale or not.
Indeed. They won't honour the sale because they will go at a loss.
MC
I disagree. We do not Know how much cheaper these items were. If they
normally sell for �10 each and the seller listed them at �6 each (�1
less than cost for example) I would not consider that obscenely cheap.
It may be a loss for the seller but could be considered a bargain to
the buyer who may believe that the seller is trying to get rid of the
items, for example.
If this scenario was similar to what actually happened then I would
open a dispute if the seller will not shift his position. The seller
accepted his payment and, therefore, the transaction has become a
binding contract to supply.
If the �10 items were only 10p, however, then ones conscious would have
to come into play.
MC
The Older Gentleman
Depends on the item. Let's say it was..., oh, I dunno, packs of lavatory
paper (unlikely, I know!). Something one always buys and uses, anyway.
Are you telling us you don't bulk buy from time to time when prices are
cheap or shops have an offer running?
I know I do.
OTOH, something like a top-line games console might be a different
kettle of fish.
I think his offer of accepting only 60% of the original order shows a
certain willingness to compromise, too.
If the seller won't sell, file a neg and move on.
--
BMW K1100LT Ducati 750SS Honda CB400F Triumph Street Triple
Suzuki TS250ER GN250 Damn, back to six bikes!
Try Googling before asking a damn silly question.
chateau dot murray at idnet dot com
Usenet Nutter
Sounds a lot like spackie talking, dosn't it?!
Niel J Humphreys
news:iN0Pm.8454$Ym4....@text.news.virginmedia.com...
>
> "MC" <a...@any.any> wrote in message
> news:xn0gi233...@bignews.usenetmonster.com...
>>> > Any thoughts on my position?
>>> >
>>> I'd have agreed to the cancellation and left neutral feedback already
>>> - why make hassle and unpleasantness? So you thought you were onto a
>>> good thing, and it turns out you weren't - get over it.
>>
>> I disagree. We do not Know how much cheaper these items were. If they
>> normally sell for �10 each and the seller listed them at �6 each (�1
>> less than cost for example) I would not consider that obscenely cheap.
>> It may be a loss for the seller but could be considered a bargain to
>> the buyer who may believe that the seller is trying to get rid of the
>> items, for example.
>
> therefore, they were hardly giving them away. However, I'm well aware that
> a large number of the subscribers to this forum are business sellers and
> as such, would support a lynch mob being immediately dispatched to any
> buyer who has the audacity to stumble upon a good deal on Ebay.
With all due respect that's a bit harsh as to be fair there is an obvious
unwillingness to give more clarity about the actual 'cheapness' of these
items by indicating the price you 'bought' them for against the normal
selling price. This does tend to give the impression that you were well
aware that it could be a genuine pricing error and were out to gouge the
seller for making an honest mistake and are now complaining because you have
been called on it.
petrolcan
Waste" says...
>
> About 4 weeks ago I purchased 25 items on a BIN from a Platinum seller which
> I considered cheap.
>
> I then received the customary "good news, you are the successful bidder
> email".
>
> This was followed by the "Thank you for your payment" email.
>
> Then, the following day, I receive an email stating there had been a "huge"
> pricing error and would I cancel the purchase.
How long had the items been listed for?
> While I was contemplating my position, another email arrived saying the
> items had been dispatched.
>
> This was followed by an email asking why I had not responded to their
> request to cancel the order. I reminded them, they had sent an email stating
> the items had been dispatched.
>
> I receive another email saying the dispatch notification was yet another
> mistake.
>
> I've offered the compromise, of them sending me 40% other original order,
> which they have refused to do.
>
> Emails have been flying back and forth in an effort to settle this amicably,
> however, they refuse to budge.
Just curious but have they refunded your payment during this time?
> Any thoughts on my position?
>
> Should I start a dispute or just give up, as it's a Platinum seller and Ebay
> will automatically side with them?
Personally, I would start a dispute.
Willy Eckerslyke
> Personally, I would start a dispute.
And how's that going to get him anything more than a refund?
petrolcan
says...
>
> petrolcan wrote:
>
> > Personally, I would start a dispute.
>
> And how's that going to get him anything more than a refund?
Its highly likely that that is all he will get.
TBH, I'm surprised that he has not been refunded as yet, or, if he has
been, that he failed to mention it in the original post.
Willy Eckerslyke
> In article <7n4979F...@mid.individual.net>, Willy Eckerslyke
> says...
>> petrolcan wrote:
>>
>>> Personally, I would start a dispute.
>> And how's that going to get him anything more than a refund?
>
> Its highly likely that that is all he will get.
Exactly. So he may as well just accept the seller's offer to cancel the
sale. Why bother starting a dispute?
> TBH, I'm surprised that he has not been refunded as yet, or, if he has
> been, that he failed to mention it in the original post.
Presumably the seller is waiting for him to agree to the cancellation so
that they can get their final value fees back and avoid being reported
as a NPS. So he can either go along with them, or do it the hard way.
Fran
"Willy Eckerslyke" <oss108...@bangor.ac.uk> wrote in message
news:7n4ditF...@mid.individual.net...
He can still neg the seller of course, and/or hit the DSRs. Seller is being
a tad silly.
TOG@Toil
> TBH, I'm surprised that he has not been refunded as yet, or, if he has
> been, that he failed to mention it in the original post.
Surprises me as well.
TOG@Toil
C...@nicksplace.co.com> wrote:
> "Willy Eckerslyke" <oss108no_s...@bangor.ac.uk> wrote in message
>
> news:7n4ditF...@mid.individual.net...
>
>
>
> > Exactly. So he may as well just accept the seller's offer to cancel the
> > sale. Why bother starting a dispute?
>
> >> been, that he failed to mention it in the original post.
>
> > that they can get their final value fees back and avoid being reported as
> > a NPS. So he can either go along with them, or do it the hard way.
>
>
Ah. Looks like seller is hoping to avoid a neg. Am I right in thinking
you can't leave a neg if you've both officially agreed not to complete
the deal?
Fran
"Niel J Humphreys" <ad...@sznzozwdzoznzczozmzpzuztzezrzs.co.uk> wrote in
message news:hej54o$1vud$1...@energise.enta.net...
>
> Not really the done thing but neither would be the seller refunding and
> then the buyer refusing to cancel the deal meaning the seller would have
> to pay the Ebay commission on money they have not had. This would be
> un-appealable even though there would be a refund on record and something
> Ebay needs to address to avoid some sellers feeling the need to do this to
> protect their fee refunds.
The Amazon model protects the seller far better. You, the seller, simply
cancel the order before any payment is made or taken from the buyer. That
automatically reverses out all fees in full. It does ding one of your seller
metrics, potentially, but even that doesn't necessarily cause any harm. The
buyer can still leave feedback if they are so inclined, but if you handle
things properly, that can be a positive.
Phister
--
DNA signature encryption key........
ATTGGTGCATTACTTCAGGCTCT
Moog
<snip>
> Any thoughts on my position?
>
> Should I start a dispute or just give up, as it's a Platinum seller and
> Ebay will automatically side with them?
Start a dispute. Ebay will side with you.
However, you *know* they made a mistake. Let them graciously bow out of
it. One day you may well be in a similar position.
There's too much "me, me, me" in the world today. We are humans, not
f*cking calculators.
Think on. Stop being a selfsh clunt.
Trust me. You'll feel better for it. Breadhead.
--
Moog
"Some mornings it doesn't seem worth it to gnaw through
the leather straps"
Kim Andrews
Waste" says...
> Any thoughts on my position?
>
> Should I start a dispute or just give up, as it's a Platinum seller and Ebay
> will automatically side with them?
If the seller's messed up, they have a clear choice of suck it up and
sell anyway, or grovel. They don't seem to want to do either. :o) You,
however, can't *force* them sell to you by any practical means, so I'd
say get your cash back by whatever means is fastest, neg them and move
on.
They made a mistake, they have to live with the results. We all do. If I
make a mistake, I try to put it right, and if that doesn't work, I beg.
;o) If the begging doesn't win over the buyer and I get a neg, I'll
respond with calm explanation and try not to do it again.
--
Cheers, Kimbo
Books, by Kimbo!
Used and collectible books at sensible prices.
Buy direct at www.booksbykimbo.com
Find me on Ebid http://uk.ebid.net/stores/Books-by-Kimbo
Nick
> About 4 weeks ago I purchased 25 items on a BIN from a Platinum seller
> which I considered cheap.
>
> I then received the customary "good news, you are the successful bidder
> email".
>
> This was followed by the "Thank you for your payment" email.
>
> Then, the following day, I receive an email stating there had been a
> "huge" pricing error and would I cancel the purchase.
>
> items had been dispatched.
>
> This was followed by an email asking why I had not responded to their
> request to cancel the order. I reminded them, they had sent an email
> stating the items had been dispatched.
>
> I receive another email saying the dispatch notification was yet another
> mistake.
>
> I've offered the compromise, of them sending me 40% other original order,
> which they have refused to do.
>
> Emails have been flying back and forth in an effort to settle this
> amicably, however, they refuse to budge.
>
>
>
> Should I start a dispute or just give up, as it's a Platinum seller and
> Ebay will automatically side with them?
>
>
> tox
>
>
It's your call whether to start a dispute or not.
Platinum seller is V roughly defined as balls as it is, after all, ebay
terminology.
How much do you value the purchase and how much time are you willing to
spend in pursuing it?
Unless it is really very important or good, I would fear that you may be
onto a loser.
Shame, but that's ebay.
Nick.
Humbug
wrote:
>In article <UNZOm.8415$Ym4....@text.news.virginmedia.com>, "Toxic
>Waste" says...
>
>> Any thoughts on my position?
>>
>> Should I start a dispute or just give up, as it's a Platinum seller and Ebay
>> will automatically side with them?
>
>If the seller's messed up, they have a clear choice of suck it up and
>sell anyway, or grovel. They don't seem to want to do either. :o) You,
>however, can't *force* them sell to you by any practical means, so I'd
>say get your cash back by whatever means is fastest, neg them and move
>on.
>
>They made a mistake, they have to live with the results. We all do. If I
>make a mistake, I try to put it right, and if that doesn't work, I beg.
>;o) If the begging doesn't win over the buyer and I get a neg, I'll
>respond with calm explanation and try not to do it again.
Kim, I'm very pleased to see your good sense posts again.
The NG lives.
--
Humbug
petrolcan
petrolcan
>
> petrolcan wrote:
> > In article <7n4979F...@mid.individual.net>, Willy Eckerslyke
> > says...
> >> petrolcan wrote:
> >>
> >>> Personally, I would start a dispute.
> >> And how's that going to get him anything more than a refund?
> >
> > Its highly likely that that is all he will get.
>
> Exactly. So he may as well just accept the seller's offer to cancel the
> sale. Why bother starting a dispute?
I'm a firm believer in people learning lessons.
Rob Morley
> If the seller's messed up, they have a clear choice of suck it up and
> sell anyway, or grovel. They don't seem to want to do either. :o)
> You, however, can't *force* them sell to you by any practical means,
> so I'd say get your cash back by whatever means is fastest, neg them
> and move on.
>
Neg them even if they give a quick refund?
petrolcan
The OP said that the transaction happened four weeks ago.
Rob Morley
He's also been arsing around trying to get them to sell when they
obviously don't want to - I wonder how much more quickly and easily
everything would have gone if he'd just agreed to cancel when they
asked.
Niel J Humphreys
news:20091127084742.65009968@bluemoon...
Quite, the OPs greed is not helping this be bought to a conclusion. No doubt
he will blame the seller for this instead of accepting that human beings
make mistakes from time to time and conceding that he can't freeload on this
one.
From what I can see the seller held their hands up pretty early on and
admitted their mistake but the OP decided to be arsey about it. This put the
seller on the defensive as it was probably evident that the OP was being a
unreasomable person. So they (wrightly or wrongly) took steps to protect
their chances of getting an EBay fee refund by asking the OP to agree to a
mutual cancellation before processing the refund. Had the OP said 'fair
enough' accepted the seller made a human error in pricing from the start and
walked away like any reasonable person would do I imagine this would all
have been over and done with in a matter of minutes.
Ebay has many buyers like this who don't want to accept that sellers can
make mistakes in listings when they see they have a possibility of getting
something for nothing (or on the cheap), sadly an example of the society we
live in these days.
petrolcan
Personally, I think the seller should honour the price that they were
listed at. If nothing else it will make sure that they don't make the
same mistake again.
> Ebay has many buyers like this who don't want to accept that sellers can
> make mistakes in listings when they see they have a possibility of getting
> something for nothing (or on the cheap), sadly an example of the society we
> live in these days.
Without wanting to start a row, you yourself are part of that society:
http://groups.google.com/group/uk.people.consumers.ebay/msg/104db5d600c8
151d
Fran
I think you need to go back and reread the original post. The seller did not
make a simple mistake, they made a series of screw ups, INCLUDING
confirmation of dispatch. I don't see that as making an occasional mistake,
they sound grossly incompetent to me. The conclusion that the buyer is
trying to freeload simply cannot be drawn from any of their posts.
I'm with Kim on this one. A sensible customer focussed approach. And yes, I
have made mistakes in selling, but not one has rebounded on me, which I
ascribe to the way it was handled.
Willy Eckerslyke
> I'm a firm believer in people learning lessons.
Well it's one way to earn a living. There'll never be a shortage of tory
MPs queuing up to be disciplined, even if they can no longer claim it on
expenses.
Niel J Humphreys
news:MPG.2579aa1ae...@text.news.virginmedia.com...
>> Ebay has many buyers like this who don't want to accept that sellers can
>> make mistakes in listings when they see they have a possibility of
>> getting
>> something for nothing (or on the cheap), sadly an example of the society
>> we
>> live in these days.
>
> Without wanting to start a row, you yourself are part of that society:
>
> http://groups.google.com/group/uk.people.consumers.ebay/msg/104db5d600c8
> 151d
Don't be a Spacker :)
With respect, there is quite a difference in having a punt at something like
that and kicking off & crying about it when orders get cancelled. There is
no comparison to be made and that post is quite surprising & not something I
would expect to be coming from you.
--
Niel J Humphreys
news:heo71h$63l$1...@news.eternal-september.org...
..which was probably automated.
> I don't see that as making an occasional mistake, they sound grossly
> incompetent to me.
What? It is incompetant to use seller aids such as Seller Manager which
sends out automated emails now? Please.
> The conclusion that the buyer is trying to freeload simply cannot be drawn
> from any of their posts.
I disagree
> I'm with Kim on this one. A sensible customer focussed approach. And yes,
> I have made mistakes in selling, but not one has rebounded on me, which I
> ascribe to the way it was handled.
It could have been handled better by both parties, this I agree and if you
read my post properly you'll see that I allude to.
petrolcan
Like shooting fish in a barrel :-)
Fran
> What? It is incompetant to use seller aids such as Seller Manager which
> sends out automated emails now? Please.
The seller had already emailed the buyer to say they could not fulfil BEFORE
the despatch notice went out. A competent seller would have put a block on
further emails once they discovered the "mistake" and had emailed the buyer.
A competent seller would not send DESPATCH emails without a proper
fulfillment trigger. A fulfillment trigger includes stock picking and
automated postage requisition. Anyone who allows automated despatch emails
in that matter is either daft or trying to get funds released without
fulfilling the order.
Kim Andrews
petrol...@gmail.com says...
>
> It never died, it was having a seista ;-)
Don't knock the nap, at my age they're the only way I can make it to the
evening sometimes. ;o)
Kim Andrews
says...
If that's what the buyer feels they deserve, and that was the impression
I got, they should do so and get on with their lives. I went onto
explain my view on receiving negs when you've cocked up, but you trimmed
that.
Kim Andrews
ad...@sznzozwdzoznzczozmzpzuztzezrzs.co.uk says...
> > I think you need to go back and reread the original post. The seller did
> > not make a simple mistake, they made a series of screw ups, INCLUDING
> > confirmation of dispatch.
>
> ..which was probably automated.
>
>
How can you have an automatic dispatch note that's not prompted by some
previous action of the seller? Just X hours after payment or something?
I can't see that working. The seller would have to do *something* to
show the item as picked or posted, and that would then send an email.
Since the seller didn't have the item, there was no cause for them to
say they'd shipped it, so no notice should be sent. It was a cock-up,
pure and simple. We all make them, it's not a hanging offence, but it's
a tough old world and if you screw up when somebody's paying you they
have the right to be miffed.
Fran
"Kim Andrews" <byk...@hotmail.com> wrote in message
news:MPG.257a5440c...@news.individual.net...
> In article <heobri$vk5$1...@energise.enta.net>,
> ad...@sznzozwdzoznzczozmzpzuztzezrzs.co.uk says...
>> > I think you need to go back and reread the original post. The seller
>> > did
>> > not make a simple mistake, they made a series of screw ups, INCLUDING
>> > confirmation of dispatch.
>>
>> ..which was probably automated.
>>
>>
>
> How can you have an automatic dispatch note that's not prompted by some
> previous action of the seller? Just X hours after payment or something?
> I can't see that working. The seller would have to do *something* to
> show the item as picked or posted, and that would then send an email.
My point exactly.
> Since the seller didn't have the item, there was no cause for them to
> say they'd shipped it, so no notice should be sent. It was a cock-up,
> pure and simple. We all make them, it's not a hanging offence, but it's
> a tough old world and if you screw up when somebody's paying you they
> have the right to be miffed.
>
Precisely so. You have every right to kick yourself, but not to blame the
buyer. And if the seller had subscribed to proper principles of customer
service this might not have been irredeemable.
Peter Parry
<ad...@sznzozwdzoznzczozmzpzuztzezrzs.co.uk> wrote:
>Quite, the OPs greed is not helping this be bought to a conclusion. No doubt
>he will blame the seller for this instead of accepting that human beings
>make mistakes from time to time and conceding that he can't freeload on this
>one.
>
>From what I can see the seller held their hands up pretty early on and
>admitted their mistake but the OP decided to be arsey about it. This put the
>seller on the defensive as it was probably evident that the OP was being a
>unreasomable person.
I'm not sure you can really describe the buyer as "unreasonable". The
seller offered goods at a certain price. That price was low but not
sufficiently so as to indicate the seller had made a clear mistake.
The buyer made an offer at that price and the seller accepted that
offer. That the acceptance was an automatic response is immaterial as
it was set up by the seller.
A contract now exists between the seller and buyer to provide the
goods to the buyer at the price agreed. If the seller refuses to
honour the contract the buyer could purchase the same items elsewhere
and recover the difference between his purchase price of the
replacements and his original offer from the seller.
If you are the seller in that position it isn't a terribly strong
bargaining position. You either honour the contract and learn a
lesson for later or you ask _very nicely_ if the buyer would do you a
great favour and please help you out. If the seller chooses not to,
you take the loss.
There really are no other sensible choices.
petrolcan
> news:MPG.2579cf54e...@text.news.virginmedia.com...
> >>
> >> With respect, there is quite a difference in having a punt at something
> >> like
> >> that and kicking off & crying about it when orders get cancelled. There
> >> is
> >> no comparison to be made and that post is quite surprising & not
> >> something I
> >> would expect to be coming from you.
> >
> > Like shooting fish in a barrel :-)
>
Wrong.
> I find it somewhat interesting, that when he bids on something that is
> clearly miss priced, it's classed as a "punt", however, when I bid on
> something that's no more than marginal I'm told the following...
Clearly and marginal are miles from one another.
> "This does tend to give the impression that you were well
> aware that it could be a genuine pricing error and were out to gouge the
> seller for making an honest mistake and are now complaining because you have
> been called on it".
I suggest that you go back and read the entire thread. It wasn't about
bidding.
Owners Club@nicksplace.co.com Toxic Waste
> In article <6xYPm.9425$Ym4...@text.news.virginmedia.com>, "Toxic Waste"
<big snip>
> I suggest that you go back and read the entire thread. It wasn't about
> bidding.
I really can't be arsed...
Humbug
wrote:
>In article <heobri$vk5$1...@energise.enta.net>,
>ad...@sznzozwdzoznzczozmzpzuztzezrzs.co.uk says...
>> > I think you need to go back and reread the original post. The seller did
>> > not make a simple mistake, they made a series of screw ups, INCLUDING
>> > confirmation of dispatch.
>>
>> ..which was probably automated.
>>
>>
>
>How can you have an automatic dispatch note that's not prompted by some
>previous action of the seller? Just X hours after payment or something?
>I can't see that working. The seller would have to do *something* to
>show the item as picked or posted, and that would then send an email.
>Since the seller didn't have the item, there was no cause for them to
>say they'd shipped it, so no notice should be sent. It was a cock-up,
>pure and simple. We all make them, it's not a hanging offence, but it's
>a tough old world and if you screw up when somebody's paying you they
>have the right to be miffed.
I've had this with a couple of other online merchants who were not
eBay sellers.
They've sent confirmation emails when the stuff hasn't actually been
sent, and tracking information which doesn't work.
The difference on eBay is that the buyer can make a complaint visible
using feedback.
However ...
eBay make such a point of saying that a bid on eBay is a binding
contract, so if a seller makes a mistake in their pricing, they should
not be allowed to wriggle out of it.
BTDT - I've discovered that the FV of a couple of listings has left me
out of pocket. That's my fault, not the buyer's, so they've got their
bargain, and I've made a loss.
If the OP were to agree to a mutual cancellation, then presumably they
would not be able to leave feedback with a poor DSR rating, which the
seller deserves.
--
Humbug
Humbug
wrote:
How easy is it to sue an eBay seller for loss of bargain?
--
Humbug
MC
No different, I suppose, as long as the Ebay seller is a registered
trader. The laws of the land would be the same as any retailer selling
at distance. You really should be asking "How easy is it to sue any
retailer for loss of bargain?"
MC
Grimly Curmudgeon
drugs began to take hold. I remember "Usenet Nutter"
<spamme...@lololololololololololololol.uk> saying something like:
>> Indeed. They won't honour the sale because they will go at a loss.
>>
>>
>
>Sounds a lot like spackie talking, dosn't it?!
I wondered that a week ago.
Spackie couldn't keep away if he tried - just another nym.
petrolcan
Fran
"Grimly Curmudgeon" <grimly...@REMOVEgmail.com> wrote in message
news:eg11h5lljitarbqqk...@4ax.com...
There's a certain irony concerning the IDs of those who seem to be taking a
pretty similar position to the one I suspect he'd have taken.
The Older Gentleman
> seem
> I suspect
Yadda yadda yadda.
--
BMW K1100LT Ducati 750SS Honda CB400F Triumph Street Triple
Suzuki TS250ER GN250 Damn, back to six bikes!
Try Googling before asking a damn silly question.
chateau dot murray at idnet dot com
Peter Parry
>How easy is it to sue an eBay seller for loss of bargain?
As easy as it is to sue any other trader. The process isn't at all
complex. How successful it may be in actually recovering money may be
another matter. If the seller is someone obviously trading as a
fairly major activity it shouldn't be a problem. If they are
operating on the limits of survivability and are quite happy to lose
their trading name it is likely to be impractical.
My point was not so much that that avenue was open to the buyer but
rather that the starting point should be what the buyer and seller
have already agreed.
That was that the seller would sell certain goods at a certain price.
The seller had apparently made a mistake in their pricing (but not an
obvious one). After accepting the buyers payment the seller has, in
the absence of specific terms to the contrary, agreed to a contract to
supply goods to the buyer at that price. They are going to make a
loss on the transaction but that does not negate the agreement. Both
legally and morally they are bound to complete the contract.
Grimly Curmudgeon
saying something like:
>That was that the seller would sell certain goods at a certain price.
>The seller had apparently made a mistake in their pricing (but not an
>obvious one). After accepting the buyers payment the seller has, in
>the absence of specific terms to the contrary, agreed to a contract to
>supply goods to the buyer at that price. They are going to make a
>loss on the transaction but that does not negate the agreement. Both
>legally and morally they are bound to complete the contract.
Bugger that. If the seller by mistake put in the cost price instead of
the selling price he's entitled to tell the buyer to fro, imo. E&OE,
etc.
And don't go quoting the 'loss of bargain' case brought up in the court
of some hick judge in Wales.
Peter Parry
<grimly...@REMOVEgmail.com> wrote:
>We were somewhere around Barstow, on the edge of the desert, when the
>drugs began to take hold. I remember Peter Parry <pe...@wpp.ltd.uk>
>saying something like:
>
>>That was that the seller would sell certain goods at a certain price.
>>The seller had apparently made a mistake in their pricing (but not an
>>obvious one). After accepting the buyers payment the seller has, in
>>the absence of specific terms to the contrary, agreed to a contract to
>>supply goods to the buyer at that price. They are going to make a
>>loss on the transaction but that does not negate the agreement. Both
>>legally and morally they are bound to complete the contract.
>
>Bugger that. If the seller by mistake put in the cost price instead of
>the selling price he's entitled to tell the buyer to fro, imo. E&OE,
>etc.
Usually he isn't, or at least not once he has accepted the buyers
offer. There are a few exceptions, one being where the price
difference is so great that it should have been obvious (the TV Argos
advertised for 10p by mistake was one such).
Most web sellers avoid the problem by specifically making acceptance
of the offer and establishment of the contract only at the point of
despatch of the goods, thus allowing themselves time to correct
mistakes.
The eBay contract does not as far as I can see allow for this so if
you send an acceptance e-mail (manually or automatically) when an
offer is made the contract is binding and cannot lawfully be broken
unilaterally. If you have got the pricing wrong then as the seller you
have to live with your mistake or break the contract and accept any
consequences for doing that.
Fran
"Peter Parry" <pe...@wpp.ltd.uk> wrote in message
news:e9t7h5t341vha40uj...@4ax.com...
> Most web sellers avoid the problem by specifically making acceptance
> of the offer and establishment of the contract only at the point of
> despatch of the goods, thus allowing themselves time to correct
> mistakes.
>
This seller sent a despatch confirmed email.
The Older Gentleman
> Usually he isn't, or at least not once he has accepted the buyers
> offer. There are a few exceptions, one being where the price
> difference is so great that it should have been obvious (the TV Argos
> advertised for 10p by mistake was one such).
>
> Most web sellers avoid the problem by specifically making acceptance
> of the offer and establishment of the contract only at the point of
> despatch of the goods, thus allowing themselves time to correct
> mistakes.
>
> The eBay contract does not as far as I can see allow for this so if
> you send an acceptance e-mail (manually or automatically) when an
> offer is made the contract is binding and cannot lawfully be broken
> unilaterally. If you have got the pricing wrong then as the seller you
> have to live with your mistake or break the contract and accept any
> consequences for doing that.
Deliberately left unsnipped.
You're quite useful, you know :-)