This looks very bad - photographer beaten by London police?
DVH
policeman leads to arrest. Then possibly kneed in the groin, held in a
headlock, resulting in numerous bruises. Corroborated by witnesses in the
video.
http://www.boingboing.net/2009/12/15/photographer-beaten.html
Uploaded to YouTube on 1 December.
Whatever the case, the stupid ignorance of the puffed-up plastic policeman
deserves the sack.
Special Care
[caption on that video]
A bit late for that kind of talk, isn't it... since we've all been
surrendering to their intimidations for forty years, standing idly by
while the slow-motion coup d'etat proceeded right under our noses.
It's much too late now.
http://groups.google.com/group/uk.legal/msg/be3ba7329cb1df84?hl=en
thedarkman
themselves? What is the point of reven questioning anyone who is
filming in London or anywhere? It's all on the web now, all of it. Al
fucking Qaeda don't need to use reconnaisance on the streets; they can
use Google. Total fucking arseholes.
November 5
Do you think the problem will stop with the sack of a moron trying to
display his penile size by abusing his powers? Or even voting in a new
political party?
Frankly we are in this situation because we have given the government
too much power and too much taxes.
And guess what? If the government says "Stuff you, we aren't giving up
our powers" there is absolutely nothing citizens can do about it.
Political power comes out of the barrel of a gun, and as we all know
Brits have been utterly disarmed.
N5
Special Care
wrote:
>
> And guess what? If the government says "Stuff you, we aren't giving up
> our powers" there is absolutely nothing citizens can do about it.
> Political power comes out of the barrel of a gun, and as we all know
> Brits have been utterly disarmed.
>
> N5
=============================================
Aw no, not again.
This is the Baader-Meinhof Complex / John Stephenson Complex.
http://www.youtube.com/watch?v=LXi8e9IIvdA&feature=fvw
It didn't work in the 1970s and it will never work.
Look, this is a case of Collective Mental Illness.
The politicians you generate are a symptom of your collective mental
illness.
The first step is to admit you are mentally ill and to start the
recovery process.
----------------------------------------------------------------------
Reducing to Essentials
http://docs.google.com/View?id=dddp6bt4_189g5n68ghs
Steve Terry
news:0a56e3f0-331b-4607...@x20g2000vbn.googlegroups.com...
<snip>
> And guess what? If the government says "Stuff you, we aren't giving up
> our powers" there is absolutely nothing citizens can do about it.
> Political power comes out of the barrel of a gun, and as we all know
> Brits have been utterly disarmed.
> N5
>
>
it needed to take away our handguns, a local Scottish newspaper after
censored
revealed that the gunman was a personal friend of a gov cabinet minister
that
countered the local police chief constable who wanted to take the gunmans
firearms licence away from him, and with suggestion that the reason two
such unlikely persons were friends, was because they were both connected
with a paedophile ring.
All lies I'm sure, such things couldn't happen in civilised country as ours
Steve Terry
Steve Terry
news:cc033937-02ce-4f87...@g25g2000vbl.googlegroups.com...
On Dec 16, 12:21 am, November 5 <november.fifth...@googlemail.com>
wrote:
>>
>> And guess what? If the government says "Stuff you, we aren't giving up
>> our powers" there is absolutely nothing citizens can do about it.
>> Political power comes out of the barrel of a gun, and as we all know
>> Brits have been utterly disarmed.
>>
>> N5
>
>=============================================
>
>Aw no, not again.
>
>This is the Baader-Meinhof Complex / John Stephenson Complex.
>http://www.youtube.com/watch?v=LXi8e9IIvdA&feature=fvw
>It didn't work in the 1970s and it will never work.
>
>
B M and the RAF put the fear of god into corrupt German industrialists
(many ex Nazis) and Politicians
If German industrialists and politicians had nothing to fear, they would
probably be still as corrupt
Steve Terry
--
Get a free Three 3pay Sim with �2 bonus after �10 top up
http://freeagent.three.co.uk/stand/view/id/5276
Special Care
wrote:
> On Dec 16, 12:21 am, November 5 <november.fifth...@googlemail.com>
> wrote:
>
>
>
> > And guess what? If the government says "Stuff you, we aren't giving up
> > our powers" there is absolutely nothing citizens can do about it.
> > Political power comes out of the barrel of a gun, and as we all know
> > Brits have been utterly disarmed.
>
> > N5
>
> =============================================
>
> Aw no, not again.
>
> It didn't work in the 1970s and it will never work.
>
> Look, this is a case of Collective Mental Illness.
>
> The politicians you generate are a symptom of your collective mental
> illness.
>
> The first step is to admit you are mentally ill and to start the
> recovery process.
> ----------------------------------------------------------------------
> Reducing to Essentialshttp://docs.google.com/View?id=dddp6bt4_189g5n68ghs
========
"Rating" this post with one star on the Google Groups system is not an
answer.
I'll ask a pertinent question:
You say 'political power grows out of the barrel of a gun,' but would
you really want the likes of Gudrun Ensslin or Seamus Twomey to have
total political power over you?
History shows that the manner in which you travel to political power
is the same as the manner in which political power will be exercised.
Put it this way:
Would you feel safer with Gudrun Ensslin as prime minister or with
Margaret Thatcher as prime minister?
Who was MORE mentally ill - Gudrun Ensslin or Margaret Thatcher?
james
<19269a58-b49d-4e4e...@f6g2000vbp.googlegroups.com>,
thedarkman <A_B...@ABaron.Demon.Co.UK> writes
>Why are these fucking muppet police continuing to make arseholes of
>themselves? What is the point of reven questioning anyone who is
>filming in London or anywhere?
Hostile reconnaisance which the survelliance commission have identified
as a major homeland security threat. Purchasers of Max TV's breast
pocket discreet CCTV breast pocket cameras:
http://www.max.tv/Spy-Security/High_Res_Mini_Digital_Spy_Camcorder.aspx
are being targetted and understandable so. They raise the reasonable
question of why any law-abiding citizen would want such a device.
There's nothing sinister in the checks. When the question arose as to
why my wife and I would want Max TV's nifty snake camera, our
explanation that we're both disabled and that such a device is ideal for
searching around and under furniture was accepted.
--
James Follett
Doug
> In message
> <19269a58-b49d-4e4e-ad77-e0e29152c...@f6g2000vbp.googlegroups.com>,
> thedarkman <A_Ba...@ABaron.Demon.Co.UK> writes
>
> >Why are these fucking muppet police continuing to make arseholes of
> >themselves? What is the point of reven questioning anyone who is
> >filming in London or anywhere?
>
> Hostile reconnaisance which the survelliance commission have identified
> as a major homeland security threat. Purchasers of Max TV's breast
> pocket discreet CCTV breast pocket cameras:
>
> http://www.max.tv/Spy-Security/High_Res_Mini_Digital_Spy_Camcorder.aspx
>
> are being targetted and understandable so. They raise the reasonable
> question of why any law-abiding citizen would want such a device.
> There's nothing sinister in the checks. When the question arose as to
> why my wife and I would want Max TV's nifty snake camera, our
> explanation that we're both disabled and that such a device is ideal for
> searching around and under furniture was accepted.
>
small shoulder bag. This is common practice in many TV investigations
on private property and they are not arrested.
No what we have here are individual cops just shoving their
considerable legislative weight around to bully easy victims and their
bosses and the government letting them do it..
One possible reason is that since the G20 video evidence has proved
invaluable for highlighting police violence and misbehaviour against
demonstrators and consequently police have been more hands-off against
demonstrators since but they obviously have a very good reason to
dislike cameras.
--
UK Radical Campaigns
www.zing.icom43.net
One man's democracy is another man's Police State.
Turk182
>
> - Show quoted text
Notice how the arrogance and ignorance of this New Labour excuse for a
policeman is exemplified in his cow like chewing of gum throughout!
This is not an exception. This is how photographers are being
challenged in numerous settings other than 'sensitive' areas. The
woman should have taken out her mobile phone, called the police and
said she was being harrassed by a possible fake policeman.
"Call 999 if you suspect an offence is being committed" is the advice
from the police. That should settle the matter, as generally,
terrorists don't call 999 and ask for assistance.
Turk182
William Black
You mean someone actually came around and asked awkward questions about
some techno toy you bought?
Why didn't you tell them to go away and mind their own business?
--
William Black
"Any number under six"
The answer given by Englishman Richard Peeke when asked by the Duke of
Medina Sidonia how many Spanish sword and buckler men he could beat
single handed with a quarterstaff.
DVH
"james" <ja...@marage.demon.co.uk> wrote in message
news:gr2vtHD3...@marage.demon.co.uk...
> When the question arose as to why my wife and I would want Max TV's nifty
> snake camera, our explanation that we're both disabled and that such a
> device is ideal for searching around and under furniture was accepted.
Geddaway. You wanted it because it's a fun gadget.
http://www.max.tv/electronics/video-snake-cam-borescope.aspx
William Black
If they didn't like you buying a camera I wonder how many armed cops
will break your door down if you buy one of these:
http://www.max.tv/Spy-Security/GSM-Audio-Bug-Listening-Device.aspx
I can't think of a legitimate reason to buy one...
Culex (The Infamous Culex)
wrote:
> DVH wrote:
> > "james" <ja...@marage.demon.co.uk> wrote in message
> >news:gr2vtHD3...@marage.demon.co.uk...
> >> When the question arose as to why my wife and I would want Max TV's nifty
> >> snake camera, our explanation that we're both disabled and that such a
> >> device is ideal for searching around and under furniture was accepted.
>
> > Geddaway. You wanted it because it's a fun gadget.
>
> >http://www.max.tv/electronics/video-snake-cam-borescope.aspx
>
> If they didn't like you buying a camera I wonder how many armed cops
> will break your door down if you buy one of these:
>
> http://www.max.tv/Spy-Security/GSM-Audio-Bug-Listening-Device.aspx
>
> I can't think of a legitimate reason to buy one...
You seem remarkably unimaginative as I can think of several legitimate
uses of the device, from learning with whom one's wife is spending her
afternoons to discovering how one's nanny spends her day.
As the device acts like a mobile phone, there should be no question of
it contravening the Wireless Telegraphy Act as more conventional bugs
would do; moreover, it should also be much more secure in use.
-- -
Culex -- the Infamous Culex
Catweazel
Perhaps it's about what they are taught at police college.
Perhaps it's too much of a challenge to retain knowledge of 'the law'
to determine if an offence is being committed,
whereas the challenge of second-guessing a situation requires much
less effort?
Culex (The Infamous Culex)
Or to use for "human astronomy", to see what's beyond Uranus.
Cynic
wrote:
>Hostile reconnaisance which the survelliance commission have identified
>as a major homeland security threat. Purchasers of Max TV's breast
>pocket discreet CCTV breast pocket cameras:
>
>http://www.max.tv/Spy-Security/High_Res_Mini_Digital_Spy_Camcorder.aspx
>
>are being targetted and understandable so. They raise the reasonable
>question of why any law-abiding citizen would want such a device.
>There's nothing sinister in the checks. When the question arose as to
>why my wife and I would want Max TV's nifty snake camera, our
>explanation that we're both disabled and that such a device is ideal for
>searching around and under furniture was accepted.
You appear to have the mistaken idea that people have to have a good
and valid reason in order to possess or use perfectly legal items.
There are any number of things that I have done and any number of
items I have bought for the simple reason that I just *felt like it*
at the time.
Incidentally, do you have a good reason to look at sites such as the
one you cited? And what is your excuse for posting to political and
legal newsgroups? Posting to a newsgroup doesn't help you find things
under the sofa, so we must assume that you are a terrorist.
--
Cynic
vomica@nowhere.con nux vomica
"Cynic" <cyni...@yahoo.co.uk> wrote in message
news:hlvhi5hsutgki0gpn...@4ax.com...
> On Wed, 16 Dec 2009 06:30:15 +0000, james <ja...@marage.demon.co.uk>
> wrote:
>
>>Hostile reconnaisance which the survelliance commission have identified
>>as a major homeland security threat. Purchasers of Max TV's breast
>>pocket discreet CCTV breast pocket cameras:
>>
>>http://www.max.tv/Spy-Security/High_Res_Mini_Digital_Spy_Camcorder.aspx
>>
>>are being targetted and understandable so. They raise the reasonable
>>question of why any law-abiding citizen would want such a device.
>>There's nothing sinister in the checks. When the question arose as to
>>why my wife and I would want Max TV's nifty snake camera, our
>>explanation that we're both disabled and that such a device is ideal for
>>searching around and under furniture was accepted.
>
> You appear to have the mistaken idea that people have to have a good
> and valid reason in order to possess or use perfectly legal items.
People generally - at least 99% of the time, *do have* at least some purpose
in their actions, such as purchasing this or that item for this or that
purpose - don't they?
> There are any number of things that I have done and any number of
> items I have bought for the simple reason that I just *felt like it*
> at the time.
'On a whim', ...'On the spur of the moment' ...'For no particular purpose or
reason' -your mind was a complete blank at the time you parted with your
money was it? YE GODS... YOU Sir, may have fallen victim to a very clever
'mugging' where your conscious mind has been been psychologically attacked
rendering you powerless against an opponent who's sole intent was to deprive
you of your money and leave you permanently mentally impaired and unable to
recall these events - brain-damaged!
> Incidentally, do you have a good reason to look at sites such as the
> one you cited? And what is your excuse for posting to political and
> legal newsgroups? Posting to a newsgroup doesn't help you find things
> under the sofa, so we must assume that you are a terrorist.
>
> --
> Cynic
<nux vomica>
Cynic
vom...@nowhere.con> wrote:
>> You appear to have the mistaken idea that people have to have a good
>> and valid reason in order to possess or use perfectly legal items.
>
>People generally - at least 99% of the time, *do have* at least some purpose
>in their actions, such as purchasing this or that item for this or that
>purpose - don't they?
Yes. Which does not mean that it is a particularly *good* reason.
>> There are any number of things that I have done and any number of
>> items I have bought for the simple reason that I just *felt like it*
>> at the time.
>'On a whim', ...'On the spur of the moment' ...'For no particular purpose or
>reason' -your mind was a complete blank at the time you parted with your
>money was it? YE GODS... YOU Sir, may have fallen victim to a very clever
>'mugging' where your conscious mind has been been psychologically attacked
>rendering you powerless against an opponent who's sole intent was to deprive
>you of your money and leave you permanently mentally impaired and unable to
>recall these events - brain-damaged!
Nonsense. Just about everyone sometimes does things and/or buys
things on a whim for no *good* reason.
I was stuck in a traffic jam yesterday and I started counting the
number of lamp-posts between myself and the next junction. I had no
reason to do so - it was simply something to keep my mind occupied in
a boring situation. No doubt if a policeman had somehow discovered
what I was doing he would assume that I must be needing the
information for some darstardly plot or other.
--
Cynic
William Black
> On Wed, 16 Dec 2009 11:35:53 +0000, William Black
> <willia...@hotmail.co.uk> wrote:
>
>> I can't think of a legitimate reason to buy one...
>
>
Try popping down to Porton Down and asking to buy a bucket of nerve gas
and see what sort of an answer you get...
vomica@nowhere.con nux vomica
"Cynic" <cyni...@yahoo.co.uk> wrote in message
news:4hgii55uhupii6q3v...@4ax.com...
Can you detail these items that you have apparently bought for no *good*
reason? Perhaps some of the readers may be able to assist in determining
your possible *real* purpose or motives for these purchases?
Did you see any them advertised on TV etc?
<nux vomica>
Culex (The Infamous Culex)
> On Wed, 16 Dec 2009 20:49:27 +0000, William Black
> <william.bl...@hotmail.co.uk> wrote:
> >Jaf wrote:
> >> On Wed, 16 Dec 2009 11:35:53 +0000, William Black
> >> <william.bl...@hotmail.co.uk> wrote:
>
> >>> I can't think of a legitimate reason to buy one...
>
> >> For *any* item, 'I want one.' is all the reason needed.
>
> >Try popping down to Porton Down and asking to buy a bucket of nerve gas
> >and see what sort of an answer you get...
You'd probably need to be more specific. Ask them for a litre of
isopropyl methylphosphonofluoridate.
> Is it legally on sale in a shop anywhere?
The American government sold it to Saddam Hussein.
William Black
There you go, it is on sale, off you go to try and buy some...
Culex (The Infamous Culex)
> Nonsense. Just about everyone sometimes does things and/or buys
> things on a whim for no *good* reason.
Would you say that applied to looking up someone's home address just
to send them a Christmas card?
Steve Terry
news:hgbnc0$b0e$1...@news.eternal-september.org...
> Culex (The Infamous Culex) wrote:
>> On Dec 16, 9:12 pm, Jaf <ana...@NOSPAMntlworld.com> wrote:
>>> On Wed, 16 Dec 2009 20:49:27 +0000, William Black
>>> <william.bl...@hotmail.co.uk> wrote:
>>>> Jaf wrote:
>>>>> On Wed, 16 Dec 2009 11:35:53 +0000, William Black
>>>>> <william.bl...@hotmail.co.uk> wrote:
>>>>>> I can't think of a legitimate reason to buy one...
>>>>> For *any* item, 'I want one.' is all the reason needed.
>>>> Try popping down to Porton Down and asking to buy a bucket of nerve gas
>>>> and see what sort of an answer you get...
>>
>> You'd probably need to be more specific. Ask them for a litre of
>> isopropyl methylphosphonofluoridate.
>>
>>> Is it legally on sale in a shop anywhere?
>>
>> The American government sold it to Saddam Hussein.
>
> There you go, it is on sale, off you go to try and buy some...
>
>
You first have to be a CIA approved despot like Saddam.
Cynic
No, mostly when browsing in a shop.
Let's see ...
A set of USB adapters that will connect to all the many types of USB
socket. Bought about a month ago as they "looked handy". The box
still hasn't been opened. An electric hand-held fan that has some
LEDs on the blades that you can enter short words that the LEDs spell
out as the blades rotate. Bought because it looked intriguing.
Played with once and never switched on since. A solar-powered battery
charger that was on sale that I vaguely thought might be useful
somehow someday. Looked at, put back in box, never used.
--
Cynic
Cynic
<the....@googlemail.com> wrote:
>On Dec 16, 8:33�pm, Cynic <cynic_...@yahoo.co.uk> wrote:
>> Nonsense. �Just about everyone sometimes does things and/or buys
>> things on a whim for no *good* reason.
>
>Would you say that applied to looking up someone's home address just
>to send them a Christmas card?
I would say it applies to buying and sending any Christmas cards at
all.
--
Cynic
james
<willia...@hotmail.co.uk> writes
>james wrote:
>>There's nothing sinister in the checks. When the question arose as to
>>why my wife and I would want Max TV's nifty snake camera, our
>>explanation that we're both disabled and that such a device is ideal
>>for searching around and under furniture was accepted.
>>
>
>You mean someone actually came around and asked awkward questions about
>some techno toy you bought?
Like I said. Nothing sinister about it. Just an informal, friendly call
from the local collator.
>
>Why didn't you tell them to go away and mind their own business?
Because the procuring of gizmos that could be used for hostile
reconnaissance is their business. It wouldn't surprise me if all
purchases from Max TV are routinely checked.
--
James Follett
Ian Jackson
<ja...@marage.demon.co.uk> writes
>In message <hgaega$uku$4...@news.eternal-september.org>, William Black
><willia...@hotmail.co.uk> writes
>>james wrote:
>
>>>There's nothing sinister in the checks. When the question arose as to
>>>why my wife and I would want Max TV's nifty snake camera, our
>>>explanation that we're both disabled and that such a device is ideal
>>>
>>
>>You mean someone actually came around and asked awkward questions
>>about some techno toy you bought?
>
>Like I said. Nothing sinister about it. Just an informal, friendly call
>from the local collator.
>>
>>Why didn't you tell them to go away and mind their own business?
>
>Because the procuring of gizmos that could be used for hostile
>reconnaissance is their business. It wouldn't surprise me if all
>purchases from Max TV are routinely checked.
>
details of all who purchase their equipment? Is that part of the
Conditions of Sale, or do you get a surprise when you find out for the
first time? I have to ask myself, if mission creep takes its inevitable
course, how long will it be before someone like Jessops have to pass on
the details of those who purchase ordinary cameras?
--
Ian
William Black
If that's the case I must buy something and tell them to piss off when
they ring up.
The idea that someone who might actually be doing some useful task is
actually paid to do this sort of thing is actually quite worrying.
Richard Tobin
William Black <willia...@hotmail.co.uk> wrote:
>If that's the case I must buy something and tell them to piss off when
>they ring up.
>
>The idea that someone who might actually be doing some useful task is
>actually paid to do this sort of thing is actually quite worrying.
You don't want to believe everything you read on Usenet.
-- Richard
--
Please remember to mention me / in tapes you leave behind.
martin
> In article <hgeckr$oj3$5...@news.eternal-september.org>,
> William Black <willia...@hotmail.co.uk> wrote:
>> If that's the case I must buy something and tell them to piss off when
>> they ring up.
>>
>> The idea that someone who might actually be doing some useful task is
>> actually paid to do this sort of thing is actually quite worrying.
>
> You don't want to believe everything you read on Usenet.
Quite :) My thoughts exactly
>
> -- Richard
William Black
> In article <hgeckr$oj3$5...@news.eternal-september.org>,
> William Black <willia...@hotmail.co.uk> wrote:
>> If that's the case I must buy something and tell them to piss off when
>> they ring up.
>>
>> The idea that someone who might actually be doing some useful task is
>> actually paid to do this sort of thing is actually quite worrying.
>
> You don't want to believe everything you read on Usenet.
>
Tell me about it.
"Hello, I'm constable McNasty, intelligence collator from High Street
Police Station. I wonder if you could confirm your purchase of a piece
of equipment suitable for use in a terrorist attack?"
Somehow it doesn't sound too likely...
AlanG
wrote:
>In message <hgaega$uku$4...@news.eternal-september.org>, William Black
><willia...@hotmail.co.uk> writes
>>james wrote:
>
>>>There's nothing sinister in the checks. When the question arose as to
>>>why my wife and I would want Max TV's nifty snake camera, our
>>>explanation that we're both disabled and that such a device is ideal
>>>for searching around and under furniture was accepted.
>>>
>>
>>You mean someone actually came around and asked awkward questions about
>>some techno toy you bought?
>
>Like I said. Nothing sinister about it. Just an informal, friendly call
>from the local collator.
what is a local collator and what are his powers?
>>
>>Why didn't you tell them to go away and mind their own business?
>
>Because the procuring of gizmos that could be used for hostile
>reconnaissance is their business. It wouldn't surprise me if all
>purchases from Max TV are routinely checked.
The purchase of anything that is freely and legally available is
surely only the business of the seller and buyer.
james
<ianREMOVET...@g3ohx.demon.co.uk> writes
>>Like I said. Nothing sinister about it. Just an informal, friendly
>>call from the local collator.
>So, just to make it clear, Max TV routinely pass on to the police the
>details of all who purchase their equipment? Is that part of the
>Conditions of Sale, or do you get a surprise when you find out for the
>first time?
Now that the English government's Intercept Modernisation Program is
supposed to be up and running and home's Office of the Surveillance
Commission have provided guidelines on its use, the interception of all
mail orders into selected companies ought to be automatic without the
targetted company actually being aware of official interest. The pending
abolition of cheques makes automated tracking of monies that much easier
and the day of total policing with databases takes a step nearer.
I think that what seems to be the use of collators is sensible. With
their knowledge of many local people, they can deal with what may seem
to be questionable activities on an informal basis.
--
James Follett
William Black
> what is a local collator and what are his powers?
He's a police officer who acts as a sort of local intelligence analyst
at 'divisional' level.
Information gathered is passed to him and he works out patterns that may
indicate areas where crime occurs, or even predict some crime.
He's your friendly local secret policeman.
They've existed for decades, usually a senior constable who knows the
area well with a couple of clerical staff to help.
The idea that he'd ring up a suspect and ask "Why do you want this toy?
Are you planning a terrorist outrage?" is a more than little absurd.
james
<inv...@invalid.net> writes
What is 'freely and legally available' in database policed England
today? The answer is nothing. Whatever the police decide is legal or
illegal now applies. Edited copies of the BBFC approved movie 'Leon' can
fall foul of the new and bizarre dangerous pictures act if the police so
decide. That the movie has been licensed is no defence. The old and
sensible workable law of material likely to deprave or corrupt has been
chucked out by a new criminal justice bill.
The main propeller of the current blizzard of weird laws is treasury's
determination to make law enforcement dirt cheap which is why England
now has an offence of using a cellphone on the move. The dirty cheapness
that the original law of driving w/o due c lack.
Even stuff formerly thought of as illegal to supply, such as baccy to
kiddiwinks, can be legal now if plod so decides. Following a stabbing
incident in which a shopkeeper was attacked for refusing to serve a
youngster, the police have warned shopkeepers not to be
'confrontational' in their dealings with kids. If a shopkeeper is
threatened or feels threatened then baccy can be supplied. Stabbing
incidents are a damned nuisance for the police because they unleash a
flood of treasury unfriendly expensive paperwork.
At this moment a parliamentary committee is pondering an issue in which
plods descended mob-handed on the palace of westminster and seized
whatever took their fancy. Why should the police worry about the
consequences? They can always say 'sorry' afterwards. If they decide
that a swathy Will Of God possible wannabe ought to be dead, then they
can arrange it quick as boiled asparagus. Why should they worry about
the consequences? They can always say sorry afterward. That'll keep
various civil liberties off their backs until the next time. Worked a
treat last Christmas outside Guildford cathedral when armed police gave
some poor sod a nice little present of an express delivery of neat
little rounds of lead.
I've had to take special measures to avoid the perils of the new traffic
management act and its amazing assumptions of guilt unless defendants
can prove innocence.
--
James Follett
AlanG
wrote:
Would you please tell us why any legal activity should be questionable
AlanG
<willia...@hotmail.co.uk> wrote:
>AlanG wrote:
>
>> what is a local collator and what are his powers?
>
>He's a police officer who acts as a sort of local intelligence analyst
>at 'divisional' level.
You mean the local special branch officer who notes down the bnames
and addresses of everyone writing to the local paper and files them
under 'political activist'?
>
>Information gathered is passed to him and he works out patterns that may
>indicate areas where crime occurs, or even predict some crime.
>
>He's your friendly local secret policeman.
>
>They've existed for decades, usually a senior constable who knows the
>area well with a couple of clerical staff to help.
>
>The idea that he'd ring up a suspect and ask "Why do you want this toy?
> Are you planning a terrorist outrage?" is a more than little absurd.
Indeed
vomica@nowhere.con nux vomica
"Cynic" <cyni...@yahoo.co.uk> wrote in message
news:johki5tp8ackiu7hk...@4ax.com...
These sounds like reasoned and logical purchases - not for 'no good reason',
you bought these items with an intended use, possibly the fact that your Mrs
may not understand this does not make your actions illogical!
<nux vomica>
AlanG
wrote:
I take it you believe buying a loaf of bread should be reportable to
the police?
>Whatever the police decide is legal or
>illegal now applies.
The police may wish that were so but as yet it isn't
>Edited copies of the BBFC approved movie 'Leon' can
>fall foul of the new and bizarre dangerous pictures act if the police so
>decide.
No they cannot.
>That the movie has been licensed is no defence. The old and
>sensible workable law of material likely to deprave or corrupt has been
>chucked out by a new criminal justice bill.
It may have been old but like many laws it wasn't sensible
>The main propeller of the current blizzard of weird laws is treasury's
>determination to make law enforcement dirt cheap which is why England
>now has an offence of using a cellphone on the move. The dirty cheapness
>that the original law of driving w/o due c lack.
Err no.
It's because the more absolute offences there are the easier it is to
prove someone is breaking one of them. Owes more to the desire of the
police for more powers than the treasury
>
>Even stuff formerly thought of as illegal to supply, such as baccy to
>kiddiwinks, can be legal now if plod so decides.
The police have a long tradition of 'police discretion' as to which
offences they will enforce the law against. Said discretion usually
used when one of their collleagues or someone important is involved
>Following a stabbing
>incident in which a shopkeeper was attacked for refusing to serve a
>youngster, the police have warned shopkeepers not to be
>'confrontational' in their dealings with kids. If a shopkeeper is
>threatened or feels threatened then baccy can be supplied. Stabbing
>incidents are a damned nuisance for the police because they unleash a
>flood of treasury unfriendly expensive paperwork.
>
>At this moment a parliamentary committee is pondering an issue in which
>plods descended mob-handed on the palace of westminster and seized
>whatever took their fancy. Why should the police worry about the
>consequences? They can always say 'sorry' afterwards. If they decide
>that a swathy Will Of God possible wannabe ought to be dead, then they
>can arrange it quick as boiled asparagus. Why should they worry about
>the consequences? They can always say sorry afterward. That'll keep
>various civil liberties off their backs until the next time. Worked a
>treat last Christmas outside Guildford cathedral when armed police gave
>some poor sod a nice little present of an express delivery of neat
>little rounds of lead.
>
>I've had to take special measures to avoid the perils of the new traffic
>management act and its amazing assumptions of guilt unless defendants
>can prove innocence.
None of which empowers any police officer to demand to know why you
bought anything that is legally on sale and not restricted in any way.
William Black
> On Fri, 18 Dec 2009 11:42:53 +0000, William Black
> <willia...@hotmail.co.uk> wrote:
>
>> AlanG wrote:
>>
>>> what is a local collator and what are his powers?
>> He's a police officer who acts as a sort of local intelligence analyst
>> at 'divisional' level.
>
> You mean the local special branch officer who notes down the bnames
> and addresses of everyone writing to the local paper and files them
> under 'political activist'?
Except in very rare cases there is no divisional level Special Branch
(now 'Anti-terrorist Branch) representation.
They're not supposed to collect political information. The police are
horribly afraid of getting into the bad books of a major political party.
Harass someone wandering about at random and trying front doors and
you're a conciencious police officer.
Be a cop who gets into a row with your local Tory/Labour/LibDem Party
candidate for your local parish council who is knocking on doors and
collecting signatures to move a bus stop and you're in the deep deep
shit and you'll probably spend the next half decade directing traffic on
Shetland...
AlanG
<willia...@hotmail.co.uk> wrote:
>AlanG wrote:
>> On Fri, 18 Dec 2009 11:42:53 +0000, William Black
>> <willia...@hotmail.co.uk> wrote:
>>
>>> AlanG wrote:
>>>
>>>> what is a local collator and what are his powers?
>>> He's a police officer who acts as a sort of local intelligence analyst
>>> at 'divisional' level.
>>
>> You mean the local special branch officer who notes down the bnames
>> and addresses of everyone writing to the local paper and files them
>> under 'political activist'?
>
>Except in very rare cases there is no divisional level Special Branch
>(now 'Anti-terrorist Branch) representation.
I'm going on my knowledge of a few years ago when all local police
forces had special branch officers. They did here until 2003 because I
knew 2 of them and had a blazing argument with them. I have no reason
to believe the situation has changed.
>
>They're not supposed to collect political information. The police are
>horribly afraid of getting into the bad books of a major political party.
They weren't then. Someone let slip they were compiling lists of
potential political activists. Apparently this has been going on fro
decades
>
>Harass someone wandering about at random and trying front doors and
>you're a conciencious police officer.
>
>Be a cop who gets into a row with your local Tory/Labour/LibDem Party
>candidate for your local parish council who is knocking on doors and
>collecting signatures to move a bus stop and you're in the deep deep
>shit and you'll probably spend the next half decade directing traffic on
>Shetland...
They don't get into rows. They put the council candidate on the list
for future reference. He never knows he is on it but if he is not
totally stupid he might suspect.
james
<inv...@invalid.net> writes
>>I think that what seems to be the use of collators is sensible. With
>>their knowledge of many local people, they can deal with what may seem
>>to be questionable activities on an informal basis.
>
>Would you please tell us why any legal activity should be questionable
I think I first came to the attention of the local collator following my
draft MS of a novel that referred to Neal-Ferrograph (sp?) recorders
used by a counter-terrorist organisation. The organisation suspected a
leak and I was whisked off for a voluntary chat. How the hell did I know
that that particular make of recorder was used? My reply was that I used
guesswork. The NF machines recorded at very low speed -- about half the
speed of compact audio cassettes I think. They looked very odd in ILR
comms rooms with the tape reels hardly seeming to move. They were used
to comply with IBA regs that required the VHF and MF output of ILR
stations to be recording against a speaking local phone link. I used the
NF machine because it was commercially available and it seemed sensible
to use it. That the same machine was used in London and Bishops Cleeve
was guesswork.
Leak rumours duly laid to rest. The benefit to me was that I greatly
expanded my list of contacts in the police. The collator enjoyed a jolly
jape and could always be sure of a chuckle when my name came up as a
local planner of bank robberies following a revision job I did on a
Sweeney script.
My biggest job was to plan a break-in of the S.W.I.F.T. System.
--
James Follett.
William Black
> On Fri, 18 Dec 2009 16:22:54 +0000, William Black
>> Except in very rare cases there is no divisional level Special Branch
>> (now 'Anti-terrorist Branch) representation.
>
> I'm going on my knowledge of a few years ago when all local police
> forces had special branch officers. They did here until 2003 because I
> knew 2 of them and had a blazing argument with them. I have no reason
> to believe the situation has changed.
All police forces have Special Branch officers, they are NOT a
divisional level asset and not under command of the divisional Chief
Superintendent.
>> They're not supposed to collect political information. The police are
>
>> horribly afraid of getting into the bad books of a major political party.
>
> They weren't then. Someone let slip they were compiling lists of
> potential political activists. Apparently this has been going on fro
> decades
>
>> Harass someone wandering about at random and trying front doors and
>> you're a conciencious police officer.
>>
>> Be a cop who gets into a row with your local Tory/Labour/LibDem Party
>> candidate for your local parish council who is knocking on doors and
>> collecting signatures to move a bus stop and you're in the deep deep
>> shit and you'll probably spend the next half decade directing traffic on
>> Shetland...
>
> They don't get into rows. They put the council candidate on the list
> for future reference. He never knows he is on it but if he is not
> totally stupid he might suspect.
Don't be bloody silly.
There is no 'list', if there was and legitimate politicians were put on
it as a matter of routine there'd have been a huge scandal 'some time
ago' when some retired cop who went into politics sold the knowledge to
get publicity.
'Ex policeman standing for council tells all!'
The cops don't mess with politicians.
You've only got to look at what happened to Andy Hayman to see what
happens when they do.
Got the sack, his book got banned, shit happens...
William Black
> In message <t82ni5lhl0bif4cgu...@4ax.com>, AlanG
> <inv...@invalid.net> writes
>
>>> I think that what seems to be the use of collators is sensible. With
>>> their knowledge of many local people, they can deal with what may seem
>>> to be questionable activities on an informal basis.
>>
>> Would you please tell us why any legal activity should be questionable
>
> I think I first came to the attention of the local collator following my
> draft MS of a novel that referred to Neal-Ferrograph (sp?) recorders
> used by a counter-terrorist organisation.
That has to be some considerable time ago.
Ferrograph went bust in about 1980
The recorders used for intelligence gathering were all sold off to radio
amateurs well over two decades ago, complete with GCHQ accounting and
modification stickers, which caused something of a stir at the time in
the professional press...
AlanG
wrote:
So your seemingly grovelling attitude has an ulterior motive.
You're lucky you didn't write about anything called 'zircon' or they
would have been kicking your door down and taking everything away for
tests.
AlanG
<willia...@hotmail.co.uk> wrote:
>AlanG wrote:
>> On Fri, 18 Dec 2009 16:22:54 +0000, William Black
>
>>> Except in very rare cases there is no divisional level Special Branch
>>> (now 'Anti-terrorist Branch) representation.
>>
>> I'm going on my knowledge of a few years ago when all local police
>> forces had special branch officers. They did here until 2003 because I
>> knew 2 of them and had a blazing argument with them. I have no reason
>> to believe the situation has changed.
>
>All police forces have Special Branch officers, they are NOT a
>divisional level asset and not under command of the divisional Chief
>Superintendent.
Thats correct. You were the one who said it wasn't
>
>>> They're not supposed to collect political information. The police are
>>
>>> horribly afraid of getting into the bad books of a major political party.
>>
>> They weren't then. Someone let slip they were compiling lists of
>> potential political activists. Apparently this has been going on fro
>> decades
>>
>>> Harass someone wandering about at random and trying front doors and
>>> you're a conciencious police officer.
>>>
>>> Be a cop who gets into a row with your local Tory/Labour/LibDem Party
>>> candidate for your local parish council who is knocking on doors and
>>> collecting signatures to move a bus stop and you're in the deep deep
>>> shit and you'll probably spend the next half decade directing traffic on
>>> Shetland...
>>
>> They don't get into rows. They put the council candidate on the list
>> for future reference. He never knows he is on it but if he is not
>> totally stupid he might suspect.
>
>Don't be bloody silly.
The only silly billy round here is you.
>
>There is no 'list', if there was and legitimate politicians were put on
>it as a matter of routine there'd have been a huge scandal 'some time
>ago' when some retired cop who went into politics sold the knowledge to
>get publicity.
And ended up in pokey for breaching the OSA
>
>'Ex policeman standing for council tells all!'
>
>The cops don't mess with politicians.
Don't be silly.
SB has files on almost all labour MPs and cabinet ministers.
Jack Straw went on as a political activist in his student days
>
>You've only got to look at what happened to Andy Hayman to see what
>happens when they do.
>
>Got the sack, his book got banned, shit happens...
and
http://news.bbc.co.uk/1/hi/uk/8289897.stm
Now run away again. You aren't worth arguing with
William Black
> On Fri, 18 Dec 2009 18:59:05 +0000, William Black
>> There is no 'list', if there was and legitimate politicians were put on
>> it as a matter of routine there'd have been a huge scandal 'some time
>> ago' when some retired cop who went into politics sold the knowledge to
>
>> get publicity.
>
> And ended up in pokey for breaching the OSA
The police leak all the time.
Police records are not usually considered state secrets.
>> 'Ex policeman standing for council tells all!'
>>
>> The cops don't mess with politicians.
>
> Don't be silly.
> SB has files on almost all labour MPs and cabinet ministers.
> Jack Straw went on as a political activist in his student days
Nope.
Jack Straw had a file on the Security Service 'Index'.
Rusty Hinge
> AlanG wrote:
>
>> what is a local collator and what are his powers?
>
> He's a police officer who acts as a sort of local intelligence analyst
> at 'divisional' level.
>
> Information gathered is passed to him and he works out patterns that may
> indicate areas where crime occurs, or even predict some crime.
>
> He's your friendly local secret policeman.
>
> They've existed for decades, usually a senior constable who knows the
> area well with a couple of clerical staff to help.
>
> The idea that he'd ring up a suspect and ask "Why do you want this toy?
> Are you planning a terrorist outrage?" is a more than little absurd.
>
"It's a fair cop, guv, you've got me banged to rights. I'll come quietly
innit."
--
Rusty
Rusty Hinge
Harold Wilson was on such a list.
Allegedly
--
Rusty
Phister
of crap from them. He couldn't have done better if he was a Russian spy.
--
DNA signature encryption key........
ATTGGTGCATTACTTCAGGCTCT
William Black
Down at his local police station you mean?
How quaint.
james
<inv...@invalid.net> writes
>So your seemingly grovelling attitude has an ulterior motive.
>
>You're lucky you didn't write about anything called 'zircon' or they
>would have been kicking your door down and taking everything away for
>tests.
GEC/MSDS Broadoak works near Portsmouth. Mark Hosenball
is still considered persona non grata in England for disclosing
that address. Emails to and from him are still being intercepted.
--
James Follett.
AlanG
wrote:
Duncan Campbell is still beavering away
http://duncan.gn.apc.org/
Actually quite difficult for email to be intercepted if the users take
precautions.
Francis Burton
I see no evidence for that on the webpage cited - the latest 'news'
seems to be from Feb 2000.
Francis
AlanG
Francis Burton
AlanG <inv...@invalid.net> wrote:
>>>Duncan Campbell is still beavering away
>>>http://duncan.gn.apc.org/
>>
>>I see no evidence for that on the webpage cited - the latest 'news'
>>seems to be from Feb 2000.
>>
>Try the Guardian
>
>http://www.guardian.co.uk/world/2009/apr/03/g20-protests-police-kettling
Thanks. Not quite ECHELON, but I'm glad he's still gainfully employed.
Francis
james
> if mission creep takes its inevitable course, how long will it be
>before someone like Jessops have to pass on the details of those who
>purchase ordinary cameras?
Why shouldn't that happen? After all Lidl wanted my name and
address for my cash purchase of a cheapo DVD player on the dubious
grounds that it was a piece of television equipment, never mind that it
was incapable of receiving TV transmissions.
I gave the name and address of an acquaintance who steadfastly refuses
to own a TV.
--
James Follett
Delta
maybe they have point addressable boxes now... ?
William Black
When I worker for Curry's for a couple of weeks some forty odd years ago
they had a little blue book and everyone who bought a TV set had their
name and address written down in it.
When it was full (it wasn't a very big book) they sent it off to the GPO
and were sent a new one.
'Mission Creep' doesn't seem to have happened here at all...
--
William Black
These are the gilded popinjays and murderous assassins of Perfidious
Albion and they are about their Queen's business. Any man who impedes
their passage does so at his own peril.
AlanG
<willia...@hotmail.co.uk> wrote:
>On 26/05/10 09:40, james wrote:
>> In message <lqyyrkW9...@g3ohx.demon.co.uk>, Ian Jackson
>> <ianREMOVET...@g3ohx.demon.co.uk> writes
>>
>>> if mission creep takes its inevitable course, how long will it be
>>> before someone like Jessops have to pass on the details of those who
>>> purchase ordinary cameras?
>>
>> Why shouldn't that happen? After all Lidl wanted my name and
>> address for my cash purchase of a cheapo DVD player on the dubious
>> grounds that it was a piece of television equipment, never mind that it
>> was incapable of receiving TV transmissions.
>>
>> I gave the name and address of an acquaintance who steadfastly refuses
>> to own a TV.
>>
>
>When I worker for Curry's for a couple of weeks some forty odd years ago
>they had a little blue book and everyone who bought a TV set had their
>name and address written down in it.
>
>When it was full (it wasn't a very big book) they sent it off to the GPO
>and were sent a new one.
>
>'Mission Creep' doesn't seem to have happened here at all...
Wireless Telegraphy Act of 1967
Prai Jei
> Why shouldn't that happen? After all Lidl wanted my name and
> address for my cash purchase of a cheapo DVD player on the dubious
> grounds that it was a piece of television equipment, never mind that it
> was incapable of receiving TV transmissions.
I had to endure that - and eventually won - in Asda. It took some convincing
that this device was not capable of receiving TV signals.
"But it's got an aerial socket. Look, it says 'Aerial'."
"Yes, that's the analogue output."
"The what?"
--
ξ:) Proud to be curly
Interchange the alphabetic letter groups to reply