Where's this Global Warming, Doug?
Dave Muir
Perhaps they have removed too much CO2?
;(
--
Dave
"Democracy is not Liberty. Democracy is two wolves and a lamb voting on
what to have for supper. Liberty is an armed lamb contesting the vote."
Jonathan Bryce
> It's 'effing freezing up here in Norfolk.
> Perhaps they have removed too much CO2?
It quite often snows in December. This is something that happens most
years.
Theodore
And hopefully it won't so much when global warming really kicks in.
Cynic
<jona...@localhost.localdomain> wrote:
Yes - the reaction to UK seasonal weather always makes me shake my
head and smile. It appears that few people can remember as long ago
as a year, and so are always surprised to find that it gets cold and
icy in Winter, windy around the equinox, hot in Summer and that trees
start dropping leaves all over the place in Autumn.
Rain is OK though - nobody is surprised by rain. Probably because it
is pretty much continuous in the UK so nobody forgets that it happens.
It's been a number of years since Brighton had any significant snow as
early as December, but it is not *that* unusual to people who have a
memory a bit better than that of a goldfish! Unfortunately it doesn't
happen often enough in the South to justify having the infrastructure
to cope with it adequately, so it tends to cause chaos. In places
where it is pretty common, it would be unthinkable to use a little
shower like this as an excuse to take the day off work. People would
simply put on their snow chains and drive their normal route without
incident.
The Winter weather is certainly milder than I recall as a young child,
when I also lived "darn sarf".
--
Cynic
John Turner
"Dave Muir" wrote
> It's 'effing freezing up here in Norfolk.
> Perhaps they have removed too much CO2?
>
> ;(
Just imagine how much CO2 they must have removed to cause all those ice ages
in the past.
Must be a bit of yo-yo effect too, because in the past you could grown grape
vines in the UK. Maybe there was too much CO2 around in those days.
Confusing eh? Shame the dinosaurs & other prehistoric beings didn't
understand MMGW.
John.
Dave Muir
When I lived in London in the 50s/60s you could almost guarantee that it
would snow between Boxing day and the New Year.
The snow would last for weeks and Norfolk was considered to be
equivalent to the arctic during the first few weeks of the year. I used
to come up fishing in January and have to break the ice on the lakes.
When I moved up here around 1980, I looked forward to being 'snowed in'
for a few days extra holiday each winter, (my job required a lot of
driving), but damned if it didn't happen even once in 25 years!!!
Now though, the bones complain bitterly when the thermometer drops below
zero so I was looking forward to a little of Dougs promise of a warmer
climate.
Bloody disappointing so far.
AlanG
wrote:
>It's 'effing freezing up here in Norfolk.
>Perhaps they have removed too much CO2?
>
Wimp southerner.
We had a foot of snow outside this morning
Dave Muir
Probably about six inches around here. I think I'll fly further south.
AlanG
wrote:
>
>The Winter weather is certainly milder than I recall as a young child,
>when I also lived "darn sarf".
Winters are a lot milder now i think and people don't have the
experience of coping.
Last year I had a colleague complaining about getting stuck in snow.
Only a few inches had fallen. I suggested he carry a shovel and a
couple of bits of old carpet or sacking in his car for when he got
stuck. He asked "why?".
The idea of digging oneself out or laying something under the wheel
to gain traction was a compeltely novel idea yet something everyone
did when I was younger.
...
I was looking forward to a little of Dougs promise of a warmer
> climate. Bloody disappointing so far.
>
> --
> Dave
______________________________________________
Lol. Me, too. Every year I hope this will be year this much promised,
never delivered 'Global Warming' finally arrives and the Southern
Counties get to bask in Mediterranean temperatures all year-round.
Alas, I'm still waiting. Doug and his mates have now decided it might
take as long as another 30 years for such changes to occur. Whilst
that mind of margin or error might be very convenient for them and
their annual science budgets, I'm still left freezing my nuts off
while my central heating bill gets higher every year.
F*cking Climate Scientists = all mouth and no trousers.
AlanG
wrote:
>On 18/12/09 14:29, AlanG wrote:
>> On Fri, 18 Dec 2009 09:16:28 +0000, Dave Muir<dm...@hotmail2.com>
>> wrote:
>>
>>> It's 'effing freezing up here in Norfolk.
>>> Perhaps they have removed too much CO2?
>>>
>> Wimp southerner.
>> We had a foot of snow outside this morning
>
>Probably about six inches around here. I think I'll fly further south.
It must be nice to be a duck at times
Nightjar
> It's 'effing freezing up here in Norfolk.
> Perhaps they have removed too much CO2?
>
> ;(
>
He will be along shortly, to claim it is a purely local effect in a
wider overall warming. However, the Russians claim that the Hadley
Centre has been omitting data from Russian weather stations that show no
warming in the late 20th and early 21st centuries.
There are, of course correction factors that can be applied to weather
stations, to allow for the urban warming effect. However, it would
appear, at best, that the Hadley Centre missed an opportunity to check
how accurate they are against stations not affected by it.
Colin Bignell
Dave Muir
Al D
>On Fri, 18 Dec 2009 13:31:01 +0000, Cynic <cyni...@yahoo.co.uk>
>wrote:
>
>
>
>>
>>The Winter weather is certainly milder than I recall as a young child,
>>when I also lived "darn sarf".
>
Temperatures are currently below average for the time of year.
Jonathan Bryce
>>>The Winter weather is certainly milder than I recall as a young child,
>>>when I also lived "darn sarf".
>>
>
> Temperatures are currently below average for the time of year.
And there is around a 50% chance of that happening.
Doug
>
>
>
> > On Fri, 18 Dec 2009 09:20:00 +0000, Jonathan Bryce
up local climates can still get colder or more chaotic. In the UK we
could end up in the shit if GW causes adverse changes to the Gulf and
Jet streams and the prevailing wind. Indeed the present cold snap is
entirely due to winds from the North.
Of course, all the people desperate to travel at the behest of the
Christians merely contributes to the problem.
--
UK Radical Campaigns
www.zing.icom43.net
Travel broadens the damage.
Cynic
>>>The Winter weather is certainly milder than I recall as a young child,
>>>when I also lived "darn sarf".
>Temperatures are currently below average for the time of year.
Over what time period is the average that you are using?
--
Cynic
Nightjar
...
> You still don't get it do you. While the planet as a whole is warming
> up local climates can still get colder or more chaotic.
So, we can add chaos theory to the list of things you don't understand.
> In the UK we
> could end up in the shit if GW causes adverse changes to the Gulf and
> Jet streams and the prevailing wind.
None of which are actually probable.
> Indeed the present cold snap is
> entirely due to winds from the North.
It is due to a low pressure area, moving from the west, as they usually
do, meeting higher pressure that is sitting over Europe and being forced
North, which quite often happens in winter. The result is that the winds
that rotate around the Low suck cold air down from the North. The final
effect is a wind from the Arctic, but it is all entirely normal weather
behaviour.
> Of course, all the people desperate to travel at the behest of the
> Christians merely contributes to the problem.
I doubt that, for most people, Christmas has much to do with Christians
any more. It is more akin to the Winter Solstice celebration it started
out as.
Colin Bignell
Doug
> Doug wrote:
>
> ...
>
> > You still don't get it do you. While the planet as a whole is warming
> > up local climates can still get colder or more chaotic.
>
> So, we can add chaos theory to the list of things you don't understand.
>
>
> > In the UK we
> > could end up in the shit if GW causes adverse changes to the Gulf and
> > Jet streams and the prevailing wind.
>
> None of which are actually probable.
>
>
> > Indeed the present cold snap is
> > entirely due to winds from the North.
>
> It is due to a low pressure area, moving from the west, as they usually
> do, meeting higher pressure that is sitting over Europe and being forced
> North, which quite often happens in winter. The result is that the winds
> that rotate around the Low suck cold air down from the North. The final
> effect is a wind from the Arctic, but it is all entirely normal weather
> behaviour.
>
>
> > Of course, all the people desperate to travel at the behest of the
> > Christians merely contributes to the problem.
>
> I doubt that, for most people, Christmas has much to do with Christians
> any more. It is more akin to the Winter Solstice celebration it started
> out as.
>
shut-down the infrastructure as the Christians have tried to do.
Indeed the Solstice is not dominated by any particular sect, as Christ-
Mass is.
I agree that many of those conforming to Christ_Mass are not
practising Christians but they are made to go along with it one way or
another and also put up with the ensuring inconvenience and
deprivation of essential services, such as public transport and
businesses which have shut down prematurely, or stores which are bound
by law to close and/or only offer shorter hours of opening.
--
UK Radical Campaigns
www.zing.icom43.net
One man's democracy is another man's regime.
Nightjar
> On 22 Dec, 01:40, "Nightjar <\"cpb\"@" <"insertmysurnamehere> wrote:
>> Doug wrote:
>>
>> ...
>>
>>> You still don't get it do you. While the planet as a whole is warming
>>> up local climates can still get colder or more chaotic.
>> So, we can add chaos theory to the list of things you don't understand.
>>
> You obviously misunderstood the context.
I think you misunderstand what chaos means. Systems are either chaotic,
or they are non-chaotic. They cannot be more chaotic or less chaotic.
There can be differing degrees of responsiveness within a chaotic
system, but it is still just chaotic.
>>> In the UK we
>>> could end up in the shit if GW causes adverse changes to the Gulf and
>>> Jet streams and the prevailing wind.
>> None of which are actually probable.
>>
> Depends on your viewpoint.
It depends upon the science. As was explained to you in detail before,
the Gulf Stream is likely to slow as the northern oceans warm, which is
likely to be a fairly slow process, but nobody has suggested a mechanism
by which it will change course. Jet streams may also slow if temperature
differences between air masses reduce, but that ought to bring less
changable weather. The prevailing wind will only change if the earth
starts to rotate in the other direction, which, so far, nobody has
suggested will be a result of global warming, although that may only be
a matter of time.
>>> Indeed the present cold snap is
>>> entirely due to winds from the North.
>> It is due to a low pressure area, moving from the west, as they usually
>> do, meeting higher pressure that is sitting over Europe and being forced
>> North, which quite often happens in winter. The result is that the winds
>> that rotate around the Low suck cold air down from the North. The final
>> effect is a wind from the Arctic, but it is all entirely normal weather
>> behaviour.
>>
> Which if it becomes more common will lead to lower temperatures.
It happens regularly as it is. Whether we notice the effects or not
depends on the differntial between adjacent low and high pressure areas,
the exact route of the low and how quickly it passes.
>>> Of course, all the people desperate to travel at the behest of the
>>> Christians merely contributes to the problem.
>> I doubt that, for most people, Christmas has much to do with Christians
>> any more. It is more akin to the Winter Solstice celebration it started
>> out as.
>>
> As far as I am aware, Winter Solstice celebrations have never tried to
> shut-down the infrastructure as the Christians have tried to do.
There was not much infrastructure when most peoples celebrated the
winter solstice, but most seem to have stopped their normal activites
and had a big party.
> Indeed the Solstice is not dominated by any particular sect, as Christ-
> Mass is.
>
> I agree that many of those conforming to Christ_Mass are not
> practising Christians but they are made to go along with it one way or
> another and also put up with the ensuring inconvenience and
> deprivation of essential services, such as public transport and
> businesses which have shut down prematurely, or stores which are bound
> by law to close and/or only offer shorter hours of opening.
Except for the weather, the past weekend would have seen the largest
movement of people travelling for Christmas, which suggests most people
are only too willing to take part in the festivities, even if they are
not religious, and to extend them into a two week holiday.
Colin Bignell
Norman Wells
> As far as I am aware, Winter Solstice celebrations have never tried to
> shut-down the infrastructure as the Christians have tried to do.
> Indeed the Solstice is not dominated by any particular sect, as
> Christ- Mass is.
Any national holiday means that fewer people go to work. If fewer people go
to work, services are bound to be reduced.
A well-observed Winter Solstice celebration would close down services just
as effectively as any Bank Holiday. It just so happens that there are three
of those in a week at present over the turn of the year, so there is general
disruption. However, only one of those can be laid squarely at the feet of
the Christians. The inconvenience was never anything like as great when
Christianity actually ruled, as anyone who has ever read A Christmas Carol
knows.
>
> I agree that many of those conforming to Christ_Mass are not
> practising Christians but they are made to go along with it one way or
> another and also put up with the ensuring inconvenience and
> deprivation of essential services, such as public transport and
> businesses which have shut down prematurely, or stores which are bound
> by law to close and/or only offer shorter hours of opening.
If people want a national holiday lasting a week, which is essentially what
we have at the end of December, and is ever so popular, who are you to
gainsay that?
Francis Burton
Nightjar <\"cpb\"@" <"insertmysurnamehere> wrote:
>I think you misunderstand what chaos means. Systems are either chaotic,
>or they are non-chaotic. They cannot be more chaotic or less chaotic.
>There can be differing degrees of responsiveness within a chaotic
>system, but it is still just chaotic.
Presumably one can have a system that has a small chaotic component.
(By "small" I mean that the component has a minor influence over the
system's total behaviour.) Would it be unreasonable to consider such
a system "less chaotic" than one whose behaviour is more manifestly
chaotic? If it *is* unreasonable, then should we not consider *all*
systems in the real world (i.e. not just theoretical) to be chaotic?
Francis
Dave Muir
> You still don't get it do you. While the planet as a whole is warming
> up local climates can still get colder or more chaotic. In the UK we
> could end up in the shit if GW causes adverse changes to the Gulf and
> Jet streams and the prevailing wind. Indeed the present cold snap is
> entirely due to winds from the North.
>
I get it all right and what's more, lots of other people are 'getting
it' too.
This particular gravy train is fast approaching the buffers and lots of
opportunistic travelers are bailing out and soon only the zealots will
be left on board.
Time for the politicians to find another doomsday scenario to tax us
over and for the research funds to be diverted to the next 'big thing'.
Nightjar
> In article <EpidnYSIeNt9Fa3W...@giganews.com>,
> Nightjar <\"cpb\"@" <"insertmysurnamehere> wrote:
>> I think you misunderstand what chaos means. Systems are either chaotic,
>> or they are non-chaotic. They cannot be more chaotic or less chaotic.
>> There can be differing degrees of responsiveness within a chaotic
>> system, but it is still just chaotic.
>
> Presumably one can have a system that has a small chaotic component.
> (By "small" I mean that the component has a minor influence over the
In that case, the system would not be chaotic. It is one of the
properties of chaotic systems that minor changes in intial conditions
result in widely divergent results.
Colin Bignell
Nightjar
...
> If people want a national holiday lasting a week, which is essentially
> what we have at the end of December, and is ever so popular, who are you
> to gainsay that?
Doug wants us all to stay at home, with no heat and certainly no enjoyment.
Colin Bignell
Big Les Wade
>Francis Burton wrote:
>> (By "small" I mean that the component has a minor influence over the
>> system's total behaviour.)...
>
>In that case, the system would not be chaotic. It is one of the
>properties of chaotic systems that minor changes in intial conditions
>result in widely divergent results.
Nonsense Colin. A dynamic system is chaotic if any of its components are
chaotic. Many such systems are governed to a large part by
deterministic, even linear, laws, while also exhibiting small
perturbations that are non-linear and chaotic in nature.
The simplest example is the Guckenheimer-Holmes system described by a
periodically forced Van der Pol equation with small alpha, covered in
any undergraduate maths course.
--
Les
Doug
I would much prefer the great mass of people not to take their leisure
breaks all at the same time, especially in bad weather and accompanied
by a partial shutdown of an essential infrastructure at the behest of
a minority bunch of religious nuts. That doesn't seem too much to ask.
Norman Wells
> On 22 Dec, 18:15, "Nightjar <\"cpb\"@" <"insertmysurnamehere> wrote:
>> Norman Wells wrote:
>>
>> ...
>>
>>> If people want a national holiday lasting a week, which is
>>> essentially what we have at the end of December, and is ever so
>>> popular, who are you to gainsay that?
>>
>> Doug wants us all to stay at home, with no heat and certainly no
>> enjoyment.
>>
> Wrong and as misrepresentative as usual.
>
> I would much prefer the great mass of people not to take their leisure
> breaks all at the same time, especially in bad weather and accompanied
> by a partial shutdown of an essential infrastructure at the behest of
> a minority bunch of religious nuts. That doesn't seem too much to ask.
For the same reasons you put forward, ie general disruption, I'm sure the
police and the majority of the population would prefer the great mass of
protestors not to make their protests all at the same time. That doesn't
seem too much to ask, does it?
Francis Burton
Nightjar <\"cpb\"@" <"insertmysurnamehere> wrote:
>> Presumably one can have a system that has a small chaotic component.
>> (By "small" I mean that the component has a minor influence over the
>> system's total behaviour.)...
>
>In that case, the system would not be chaotic. It is one of the
>properties of chaotic systems that minor changes in intial conditions
>result in widely divergent results.
Consider a variable that is the sum of a large sinusoidal element and
a small chaotic element. Is the system comprising these two elements
chaotic or not? What if the chaotic component were to predominate over
the deterministic component?
If one is chaotic and the other deterministic, at what proportion of
the two does the label flip?
It doesn't seem sensible to me to describe a system with a 49% chaotic
element as deterministic.
Francis
Adrian
saying:
> I would much prefer the great mass of people not to take their leisure
> breaks all at the same time, especially in bad weather and accompanied
> by a partial shutdown of an essential infrastructure at the behest of a
> minority bunch of religious nuts. That doesn't seem too much to ask.
So do you propose some centralised authority being created in order to
distribute and enforce permitted holiday periods?
Dave Muir
--
Nightjar
...
> The simplest example is the Guckenheimer-Holmes system described by a
> periodically forced Van der Pol equation with small alpha, covered in
> any undergraduate maths course.
When I went to university, Lorenz had not yet presented his butterfly in
Brazil paper.
Colin Bignell
johannes
Yeah ryt, it gets colder cuz of Global Warning, see. Im Told u so.
Bob Ferguson
"Doug" <jag...@riseup.net> wrote in message
news:2621f739-adde-4047...@26g2000yqo.googlegroups.com...
-----------
The planet has been cooling for the last 4 years (not much admittedly, but
it has).
Bob Ferguson
But then Christmas has only been a day off work since the end of the 19th
century.
Doug
imposes mass breaks like Christ-Mass on citizens at the behest of a
bunch of religious nuts, should be stopped from doing so. Instead it
should be left to employers and employees to make their own
arrangements at any time of the year, including public transport.
Also, Sunday trading laws should be junked immediately.
If Christians want to conduct their rituals then let them do so
without legally imposing them on others.
Norman Wells
> On 23 Dec, 13:27, Adrian <toomany2...@gmail.com> wrote:
>> Doug <jag...@riseup.net> gurgled happily, sounding much like they
>> were saying:
>>
>>> I would much prefer the great mass of people not to take their
>>> leisure breaks all at the same time, especially in bad weather and
>>> accompanied by a partial shutdown of an essential infrastructure at
>>> the behest of a minority bunch of religious nuts. That doesn't seem
>>> too much to ask.
>>
>> So do you propose some centralised authority being created in order
>> to distribute and enforce permitted holiday periods?
>>
> No quite the reverse, the existing centralised authority, which
> imposes mass breaks like Christ-Mass on citizens at the behest of a
> bunch of religious nuts, should be stopped from doing so. Instead it
> should be left to employers and employees to make their own
> arrangements at any time of the year, including public transport.
But people _like_ national holidays, when they know the people they want to
see will all be free too. That's why all nations have national holidays.
Are they all out of step except you?
> Also, Sunday trading laws should be junked immediately.
People also _like_ a unified day off each week for the same reasons. And
when most people have a day off, services will reduce. It's axiomatic.
> If Christians want to conduct their rituals then let them do so
> without legally imposing them on others.
Sunday trading laws had their origin in religion, but only as regards
setting which day of the week the day off would be. Now, it's not the laws
that cause restrictions in shopping opportunities but the desire of people
to have a unified day off whatever it's called and whatever its origin.
It's actually much more convenient for shoppers to know that most shops will
be closed on a certain day than to have to keep a list of which are not open
on Tuesdays or any other day of the week.
As regards Christians conducting their rituals, I doubt if they impose on
you in the slightest actually.
Doug
> Doug wrote:
> > On 23 Dec, 13:27, Adrian <toomany2...@gmail.com> wrote:
> >> Doug <jag...@riseup.net> gurgled happily, sounding much like they
> >> were saying:
>
> >>> I would much prefer the great mass of people not to take their
> >>> leisure breaks all at the same time, especially in bad weather and
> >>> accompanied by a partial shutdown of an essential infrastructure at
> >>> the behest of a minority bunch of religious nuts. That doesn't seem
> >>> too much to ask.
>
> >> So do you propose some centralised authority being created in order
> >> to distribute and enforce permitted holiday periods?
>
> > No quite the reverse, the existing centralised authority, which
> > imposes mass breaks like Christ-Mass on citizens at the behest of a
> > bunch of religious nuts, should be stopped from doing so. Instead it
> > should be left to employers and employees to make their own
> > arrangements at any time of the year, including public transport.
>
> But people _like_ national holidays, when they know the people they want to
> see will all be free too. That's why all nations have national holidays.
> Are they all out of step except you?
>
transport and restricted shopping.
>
> > Also, Sunday trading laws should be junked immediately.
>
> People also _like_ a unified day off each week for the same reasons. And
> when most people have a day off, services will reduce. It's axiomatic.
>
Sundays even when their hours are restricted by law?
>
> > If Christians want to conduct their rituals then let them do so
> > without legally imposing them on others.
>
> Sunday trading laws had their origin in religion, but only as regards
> setting which day of the week the day off would be. Now, it's not the laws
> that cause restrictions in shopping opportunities but the desire of people
> to have a unified day off whatever it's called and whatever its origin.
> It's actually much more convenient for shoppers to know that most shops will
> be closed on a certain day than to have to keep a list of which are not open
> on Tuesdays or any other day of the week.
>
history so obviously people want to shop when they want to and not
when they are allowed to. So why don't we finally go all the way and
end this religious minority domination of our lives and settle down to
having a proper, secular State.
>
> As regards Christians conducting their rituals, I doubt if they impose on
> you in the slightest actually.
>
when I woke up? Some woman had knocked the Pope over who was
uninjured. What a breathtaking event! And this being the culmination
of weeks of lead-up to the ritual. Of course, the news shuts down too,
in the absence of suitable staff.
So, thanks to the Christians I can't use public transport today, it is
difficult shopping today, I can't get away from their all pervasive
religious dogma on the media and a welter of associated sickly
Victorian sentimentality.
And if you want confirmation that I am not alone in such thinking, try
this for size...
http://www.bbc.co.uk/iplayer/episode/b00pk61h/b00pk5yv/The_Grumpy_Guide_To_Christmas/
Norman Wells
> On 24 Dec, 09:52, "Norman Wells" <cm...@dibblers-pies.co.am> wrote:
>> Doug wrote:
>>> On 23 Dec, 13:27, Adrian <toomany2...@gmail.com> wrote:
>>>> Doug <jag...@riseup.net> gurgled happily, sounding much like they
>>>> were saying:
>>> No quite the reverse, the existing centralised authority, which
>>> imposes mass breaks like Christ-Mass on citizens at the behest of a
>>> bunch of religious nuts, should be stopped from doing so. Instead it
>>> should be left to employers and employees to make their own
>>> arrangements at any time of the year, including public transport.
>>
>> But people _like_ national holidays, when they know the people they
>> want to see will all be free too. That's why all nations have
>> national holidays. Are they all out of step except you?
>>
> Not all national so-called holidays involve an absence of public
> transport and restricted shopping.
If fewer people are at work, services are bound to reduce. And I think
you'll find it's the case on _all_ 'national so-called holidays' that public
transport and shopping opportunities are more limited than at other times.
>>> Also, Sunday trading laws should be junked immediately.
>>
>> People also _like_ a unified day off each week for the same reasons.
>> And when most people have a day off, services will reduce. It's
>> axiomatic.
>>
> I suppose that is why more and more shops have chosen to open on
> Sundays even when their hours are restricted by law?
It's capitalism you have to thank for that, Doug. Where there's an
opportunity to make money, someone will take it.
So, can we expect your fulsome praise of the capitalist system sometime
soon?
>>> If Christians want to conduct their rituals then let them do so
>>> without legally imposing them on others.
>>
>> Sunday trading laws had their origin in religion, but only as regards
>> setting which day of the week the day off would be. Now, it's not
>> the laws that cause restrictions in shopping opportunities but the
>> desire of people to have a unified day off whatever it's called and
>> whatever its origin. It's actually much more convenient for shoppers
>> to know that most shops will be closed on a certain day than to have
>> to keep a list of which are not open on Tuesdays or any other day of
>> the week.
>>
> As I have pointed out, more shops are open now than in previous
> history so obviously people want to shop when they want to
As a statement of the stunningly obvious, that takes some beating.
> and not when they are allowed to.
But they are allowed to, that's the point. Are you saying the laws are not
being complied with?
> So why don't we finally go all the way and
> end this religious minority domination of our lives and settle down to
> having a proper, secular State.
We're not dominated in any way as far as I can see. As regards national
holidays, they're 'Bank' Holidays, not religious ones. Sundays are not
religious either, not for the vast majority anyway. They're just _a_ day
off when people know they can actually get together as families or to play
sports or do whatever they choose in groups. If you'd prefer it to be
Tuesdays, that would be fine by me. I don't think the actual day matters in
the slightest, but I do think it's important that people share a common day
a week off work.
>>
>> As regards Christians conducting their rituals, I doubt if they
>> impose on you in the slightest actually.
>>
> So what was the leading major news item today in most of the media
> when I woke up? Some woman had knocked the Pope over who was
> uninjured. What a breathtaking event! And this being the culmination
> of weeks of lead-up to the ritual.
It would be a leading news item whatever the time of the year. You may not
like the Pope's profile and influence in the world, but you can't deny he
has it.
> Of course, the news shuts down too,
> in the absence of suitable staff.
It may be too because of the absence of news. You see, the world does tend
to get on very well by itself if everyone who has any power is on holiday.
>
> So, thanks to the Christians I can't use public transport today, it is
> difficult shopping today, I can't get away from their all pervasive
> religious dogma on the media and a welter of associated sickly
> Victorian sentimentality.
Hold on for just this one day, though, and your shopping experience will be
massively enhanced by The Sales. If we didn't have Christmas first, we
wouldn't get them. So, thank Christ for that!
I hope you are truly blessed by the Holy Spirit on this most miraculous day.
Nightjar
...
> As I have pointed out, more shops are open now than in previous
> history so obviously people want to shop when they want to and not
> when they are allowed to. So why don't we finally go all the way and
> end this religious minority domination of our lives and settle down to
The current restrictions on Sunday Trading are the result of Trade
Union, not religious, pressure.
Colin Bignell
Doug
must have been preserved thus far for religious reasons. The Trades
Unions are merely taking advantage of the situation.
Norman Wells
> On 2 Jan, 17:44, "Nightjar <\"cpb\"@" <"insertmysurnamehere> wrote:
>> Doug wrote:
>>
>> ...
>>
>>> As I have pointed out, more shops are open now than in previous
>>> history so obviously people want to shop when they want to and not
>>> when they are allowed to. So why don't we finally go all the way and
>>> end this religious minority domination of our lives and settle down
>>> to having a proper, secular State....
>>
>> The current restrictions on Sunday Trading are the result of Trade
>> Union, not religious, pressure.
>>
> I disagree. The laws are obviously religious in origin and therefore
> must have been preserved thus far for religious reasons. The Trades
> Unions are merely taking advantage of the situation.
What Wikipedia says on the matter is:
"USDAW finally agreed to support 6 hour Sunday trading in return for a
promise that Sunday working would be strictly voluntary and premium pay
would be offered. This decision played an important role in encouraging many
Labour MPs to back the bill in a free vote-without this it would almost
certainly have failed."
That shows that labour considerations were far more important than religious
ones, which would have allowed for no Sunday opening at all. The government
was all in favour of unlimited opening hours and was perfectly prepared to
override any religious concerns. As Nightjar says, the reason we have the
current restrictions is because of union pressure alone.
Nightjar
> On 2 Jan, 17:44, "Nightjar <\"cpb\"@" <"insertmysurnamehere> wrote:
>> Doug wrote:
>>
>> ...
>>
>>> As I have pointed out, more shops are open now than in previous
>>> history so obviously people want to shop when they want to and not
>>> when they are allowed to. So why don't we finally go all the way and
>>> end this religious minority domination of our lives and settle down to
>>> having a proper, secular State....
>> The current restrictions on Sunday Trading are the result of Trade
>> Union, not religious, pressure.
>>
> I disagree.
Then you are, as usual, wrong. Those who proposed the lifting of Sunday
trading restrictions, for the most part, would have liked to see all
restrictions removed. The religious groups wanted no change to the law.
The Trade Unions were concerned about workers being exploited, so the
final outcome was the lifting of restrictions for small shops and
restricted opening for larger shops.
Colin Bignell
Phister
--
DNA signature encryption key........
ATTGGTGCATTACTTCAGGCTCT
Doug
than big shops.
Also:
" * There are a number of large shops exempt from Easter Sunday and
Christmas Day trading laws, such as shops in airports and railway
stations, and shops at service stations.
* Other types of businesses are not affected by the limits on
trading hours.
What we are witnessing is the final flourish of a repressive British
law which was originally initiated by Christians long ago and which
was no doubt eroded with a little help from Unions but its demise is
mainly due to MPs.
Doug
> http://www.sciencedaily.com/releases/2009/12/091230184221.htm
>
Be interesting to know where he gets his funding from and who has peer
reviewed his work? Still, it is only one out of how many scientists
who disagree? And it is much more pleasant to be able to exonerate
humans instead of blaming them, especially if you yourself are a
significant CO2 emitter. Of course, that is not to say that our
masters will not use every opportunity to exploit a situation for
their own ends and use it as a method of contro and exploitation.
--
UK Radical Campaigns
www.zing.icom43.net
The problem is in not recognising there is a problem.
Nightjar
> On 3 Jan, 14:18, "Nightjar <\"cpb\"@" <"insertmysurnamehere> wrote:
>> Doug wrote:
>>> On 2 Jan, 17:44, "Nightjar <\"cpb\"@" <"insertmysurnamehere> wrote:
>>>> Doug wrote:
>>>> ...
>>>>> As I have pointed out, more shops are open now than in previous
>>>>> history so obviously people want to shop when they want to and not
>>>>> when they are allowed to. So why don't we finally go all the way and
>>>>> end this religious minority domination of our lives and settle down to
>>>>> having a proper, secular State....
>>>> The current restrictions on Sunday Trading are the result of Trade
>>>> Union, not religious, pressure.
>>> I disagree.
>> Then you are, as usual, wrong. Those who proposed the lifting of Sunday
>> trading restrictions, for the most part, would have liked to see all
>> restrictions removed. The religious groups wanted no change to the law.
>> The Trade Unions were concerned about workers being exploited, so the
>> final outcome was the lifting of restrictions for small shops and
>> restricted opening for larger shops.
>>
> That doesn't make sense. Small shops tend to exploit employees more
> than big shops.
But they are often family members and, in any case, they won't be
members of a Trade Union, so why should the Union worry?
> Also:
>
> " * There are a number of large shops exempt from Easter Sunday and
> Christmas Day trading laws, such as shops in airports and railway
> stations, and shops at service stations.
> * Other types of businesses are not affected by the limits on
> trading hours.
I take you don't know that is exactly the same as before the Sunday
trading laws were changed. There were other exemptions then, including
the selling of newspapers and bibles on a Sunday.
> What we are witnessing is the final flourish of a repressive British
> law which was originally initiated by Christians long ago and which
> was no doubt eroded with a little help from Unions but its demise is
> mainly due to MPs.
The Unions were the ones responsible for restricting opening hours.
Without their pressure, there would be no difference between Sunday and
any other day of the week, apart from the two concessions to the
official religion of this country - Christmas Day and Easter Sunday.
Colin Bignell
Nightjar
Or, according to the Russians, has not warmed much over the latter part
of the 20th century or during the 21st century.
Or, according to other Russians is headed for an Ice Age
Or, according to an Australian paeleoclimatologist, ignoring short term
(on a geological scale) effects, show little or no signs of warming
since 1979
http://www.canada.com/vancouversun/news/editorial/story.html?id=001245c5-d48f-4d88-857a-f02e136a100a
Colin Bignell
Nightjar
> On 3 Jan, 14:38, "Phister" <phis...@inbox.com> wrote:
>> http://www.sciencedaily.com/releases/2009/12/091230184221.htm
>>
> Be interesting to know where he gets his funding from and who has peer
> reviewed his work? Still, it is only one out of how many scientists
> who disagree?
At least 31,000
http://www.wnd.com/index.php?pageId=64734
Colin Bignell
Doug
http://www.cofe.anglican.org/info/socialpublic/marriagefamily/family/sundaytrading/
"The following motion was carried unanimously by the General Synod at
the February 1993 Group of Sessions:
'That this Synod affirms the importance of Sunday as a day for
spiritual renewal, rest and recreation and for the nurturing of family
life. It deplores the deliberate flouting of the law governing Sunday
trade by powerful commercial interests. Believing that any reform of
the law governing trading on Sunday ought to preserve in a distinct
and public way the special character of this day, it considers that
this can be achieved by:
* substantially limiting the overall level of commercial activity
on Sundays through clear and enforceable legislation which controls
retailing first according to type of shop and secondly according to
hours of opening;
* protecting by statute the existing and future rights of
employees in retailing who, in conscience, choose not to work on
Sundays;
* ensuring that those who do choose to work on Sundays in the
retail sector are properly remunerated.'
"...The Church of England has rejected proposals to further extend
trading hours for large retail outlets on Sundays..."
Of course, you seem to ignore completely the extraordinary coincidence
that Sundays, Christmas and Easter just happen to be days of special
religious significance to which these trading laws are being applied.
--
UK Radical Campaigns
www.zing.icom43.net
One man's democracy is another man's religious regime.
Norman Wells
> On 3 Jan, 14:18, "Nightjar <\"cpb\"@" <"insertmysurnamehere> wrote:
>> Doug wrote:
>>> On 2 Jan, 17:44, "Nightjar <\"cpb\"@" <"insertmysurnamehere> wrote:
>> Then you are, as usual, wrong. Those who proposed the lifting of
>> Sunday trading restrictions, for the most part, would have liked to
>> see all restrictions removed. The religious groups wanted no change
>> to the law. The Trade Unions were concerned about workers being
>> exploited, so the final outcome was the lifting of restrictions for
>> small shops and restricted opening for larger shops.
>>
> That doesn't make sense. Small shops tend to exploit employees more
> than big shops.
>
> What we are witnessing is the final flourish of a repressive British
> law which was originally initiated by Christians long ago and which
> was no doubt eroded with a little help from Unions but its demise is
> mainly due to MPs.
Then you are once again wrong.
From Wikipedia:
"USDAW finally agreed to support 6 hour Sunday trading in return for a
promise that Sunday working would be strictly voluntary and premium pay
would be offered. This decision played an important role in encouraging many
Labour MPs to back the bill in a free vote-without this it would almost
certainly have failed."
The religious lobby wanted no relaxation of the Sunday Trading laws. The
government wanted unrestricted Sunday opening hours. It was _the unions_
that only reluctantly agreed to, and were the reason for, the current
restrictions.
Sorry if that inconvenient truth spoils your story, but it is the fact.
Norman Wells
Of course the Church of England is against Sunday trading. No-one's ever
said anything different. But it doesn't make the laws. Parliament does.
The CofE is just one lobby group amongst many. And it had no influence at
all on the government of the day which decided that Sunday trading laws
should be abolished.
Once the government had made that policy decision, the Cof E was sidelined
as totally irrelevant, and it became a battle between the government and
USDAW. It was USDAW that would only agree to any change in the Sunday
trading laws on the basis of the restrictions now enacted.
You cannot blame the CofE for any of the restrictions currently in place.
They lie firmly at the door of the unions who were not a help but a
hindrance to total repeal.
Why do you find this so difficult to understand?
Nightjar
So, what you are saying is that the Synod accepted the provisions of the
Sunday Trading Bill that was before Parliament. It was, however, still
the view of the Trade Unions that held most sway with Parliament.
> "...The Church of England has rejected proposals to further extend
> trading hours for large retail outlets on Sundays..."
As, indeed, they had rejected proposals to extend any Sunday trading
before it became obvious that the measure would be passed, whatever they
said.
> Of course, you seem to ignore completely the extraordinary coincidence
> that Sundays, Christmas and Easter just happen to be days of special
> religious significance to which these trading laws are being applied.
According to Lord Robert Grosvenor, when presenting the case for the
Sunday Trading Bill in 1855:
'this is not a Bill for the better observance of the Sabbath, and that
it interferes with no man's recreations or religious convictions, but
that it was brought in for the purpose of procuring as large an amount
of holiday as possible during one day of the week for the overtaxed
thousands of the metropolis'
Colin Bignell
Francis Burton
Nightjar <\"cpb\"@" <"insertmysurnamehere> wrote:
>> who disagree?
>
>At least 31,000
And how many climate scientists does it take to change a CFL lightbulb?
Francis
Doug
Why does it have to be one particular day that happens to coincides
with a religious day when we already have...?.
"Workers aged 18 or over cannot be forced to work for more than 48
hours a week on average." So ANY one day off would be OK, instead of a
general shutdown all on one day just to please the Christians.
So what are the Unions bleating about? It is obvious that no one is
prepared to alienate the Christians in what is fundamentally a
Christian State that tries to pretend otherwise.
--
UK Radical Campaigns
www.zing.icom43.net
One man's democracy is another man's regime.
Norman Wells
> Why does it have to be one particular day that happens to coincides
> with a religious day when we already have...?.
It doesn't _have to be_, it just happens that it is. What's the problem?
> "Workers aged 18 or over cannot be forced to work for more than 48
> hours a week on average." So ANY one day off would be OK, instead of a
> general shutdown all on one day just to please the Christians.
People _like_ to have holidays when they know everyone else will be on
holiday too. It means they can interact with them, and do things together.
And it's not just Christians who are pleased with that. It's everyone with
a life.
> So what are the Unions bleating about? It is obvious that no one is
> prepared to alienate the Christians in what is fundamentally a
> Christian State that tries to pretend otherwise.
You just don't get it, do you.
From Wikipedia:
"USDAW finally agreed to support 6 hour Sunday trading in return for a
promise that Sunday working would be strictly voluntary and premium pay
would be offered. This decision played an important role in encouraging many
Labour MPs to back the bill in a free vote-without this it would almost
certainly have failed."
Religion, or appeasement of the Church, had nothing to do with it. The
government was perfectly happy to sideline the Church and repeal all the
Sunday Trading laws. It was the unions, acting on behalf of their members
and trying to protect them from exploitation, who were against such repeal,
and who insisted on the restrictions on trading that we currently have.
Your comment would therefore be better phrased as:
"It is obvious that no one is prepared to alienate the Unions in what is
fundamentally a
Socialist State that tries to pretend otherwise".
Nightjar
> On 4 Jan, 18:02, "Nightjar <\"cpb\"@" <"insertmysurnamehere> wrote:
>> According to Lord Robert Grosvenor, when presenting the case for the
>> Sunday Trading Bill in 1855:
>>
>> 'this is not a Bill for the better observance of the Sabbath, and that
>> it interferes with no man's recreations or religious convictions, but
>> that it was brought in for the purpose of procuring as large an amount
>> of holiday as possible during one day of the week for the overtaxed
>> thousands of the metropolis'
>>
>
> Why does it have to be one particular day that happens to coincides
> with a religious day when we already have...?.
Because, historically, that was the day that most businesses already
shut down, so the disruption would be least if that daay was chosen.
Colin Bignell
AlanG
<"insertmysurnamehere> wrote:
He seems to have forgotten Wednesday half day closing too
Nightjar
Thursday in some areas. I'm not sure whether that was ever a statutory
provision, simply a tradition, or was linked to market days.
Colin Bignell