Don't fall for the evolutionist misleadings...
Noah
Before you fall for the high percentage _98 percent_ similarity between
human and chimp DNA, remember this. Only one chromosone of the human DNA
has been mapped. There is 22 more chromosone pairs to go.
I would think the mapping for the chimp chromosones is far behind the
human mapping.
http://www.abcnews.go.com/sections/science/DailyNews/chromosome991201.html
Noah
chmc
Noah wrote:
First of all, you don't have to sequence both genomes to compare DNA
homology. Secondly, they just have one chromosome FINISHED, but that doesn't
mean they haven't sequenced any of the other stuff.
Charles Dye
>Before you fall for the high percentage _98 percent_ similarity between
>human and chimp DNA, remember this. Only one chromosone of the human DNA
>has been mapped. There is 22 more chromosone pairs to go.
>I would think the mapping for the chimp chromosones is far behind the
>human mapping.
What does genome mapping have to do with it? Isn't DNA comparison a
fairly straightforward chemical test done in police labs?
Chris Nedin
wrote:
> Before you fall for the high percentage _98 percent_ similarity
> between human and chimp DNA, remember this. Only one chromosone of the
> human DNA has been mapped. There is 22 more chromosone pairs to go.
> I would think the mapping for the chimp chromosones is far behind the
> human mapping.
>
>
> http://www.abcnews.go.com/sections/science/DailyNews/
> chromosome991201.html
>
> Noah
"Normal double-stranded DNA can be "melted", to form single-stranded
DNA, by heating it up. If single-stranded DNA is then put in (cooler)
solutions it will join together again, or "hybridize" (the same method
was discussed in section 10.5, p. 264, for another purpose). The
strength of the bond between the two strands is proportional to the
similarity of their sequences, and the similarity of the whole DNA of
the two species can be mesured by allowing their DNA strands to
hybridize and then measuring how much lower the melting temperature is
for the hybrid DNA than the DNA of each species. The temperature
reduction is proportional to the percentage similarity of the DNA. If
the DNA of the two species is very similar, it must be heated almost to
the same temperature as the DNA of the two species before it melts
apart. If the DNA is different for the species, however, the hybrid DNA
will melt at a much lower temperature than the single-species DNA.
The relation between temperature and percentage similarity of the DNA is
known. The lab measurements therefore result in a set of percentage
similarities (or differences) for the pairs of species that can be used
as distance statistics. The DNA of humans and chimpanzees, for example,
differs on average at about 1.5% of nucleotides. This finding is the
evidence for the famous claim than the DNA of humans and chimps is 98.5%
similar." (Ridley 1996, p. 496).
Thus, it is not necessary to know the whole DNA of both humans and
chimps to calculate the 98.5% similarity figure.
Also the fact that only one chromosome is known in full, does not mean
that the other chromosomes have received no attention. The article
clearly states that the known chromosome (chromosome 22) is the second
smallest chromosome of the 23 pairs, and represents 1.1% of the total
human genome, but that 33% of the human genome is currently known. So
clearly more work has been done on the human genome that that
represented by chromosome 22.
Chris
Ridley, M. (1996) Evolution. 2nd ed. Blackwell Scientific. Cambridge,
Mass. 719pp.
--------------------------------------------------------------------
| ne...@ediacara.org | "How can Nedin be trusted?" |
| http://Cambrian.tripod.com | C. Wieland Director, |
| | Creation Research Foundation, |
| *my views only* | Queensland, Australia. |
--------------------------------------------------------------------
Sent via Deja.com http://www.deja.com/
Before you buy.
Herb Huston
}Before you fall for the high percentage _98 percent_ similarity between
}human and chimp DNA, remember this. Only one chromosone of the human DNA
}has been mapped. There is 22 more chromosone pairs to go.
}I would think the mapping for the chimp chromosones is far behind the
}human mapping.
Translation from Creatiospeak to English: "Despite the fact that I have no
idea what DNA hybridization is and why it has nothing to do with mapping
genes on chromosomes, I'm still going to post drivel to reveal that, like
most creationists, I'm a mental defective."
--
-- Herb Huston
-- hus...@radix.net
-- http://www.radix.net/~huston
Noah
<ras...@highfiber.com> wrote:
> On 1 Dec 1999 19:01:02 -0500, no...@flood.net (Noah) wrote:
>
> >Before you fall for the high percentage _98 percent_ similarity between
> >human and chimp DNA, remember this. Only one chromosone of the human DNA
> >has been mapped. There is 22 more chromosone pairs to go.
> >I would think the mapping for the chimp chromosones is far behind the
> >human mapping.
>
> What does genome mapping have to do with it? Isn't DNA comparison a
> fairly straightforward chemical test done in police labs?
>
> ras...@highfiber.com
There's 23 chromosones. (by the way chimps have 24 which already accounts
for a major differance) Wouldn't you think you would have to compare more
than just one...which hasn't really been accomplished as of yet seeing how
the info was just mapped plus the added fact (now I'm guessing), that the
chimp chromosones have not been mapped to any point near completion. Any
comparism is based upon just a sliver of information.
May be in two or three years you might be able to come back and say, I
told you so, but right now I personally think it's a bunch of wishfull
thinking.
In effect, as an anology it would be like claiming a computer and a TV
are 98 percent similar just by examining the power cord and knowing they
both need 120 volts to run them. As time goes on you'll see some common
aspects while the differances will also become evident.
Noah
Dick C.
>
>Before you fall for the high percentage _98 percent_ similarity between
>human and chimp DNA, remember this. Only one chromosone of the human DNA
>has been mapped. There is 22 more chromosone pairs to go.
>I would think the mapping for the chimp chromosones is far behind the
>human mapping.
As others have pointed out, you do not have to map the chromosomes to get the
similarities. It is a chemical test. On the other hand, the evidence for
creationism lags far behind. Inspite of a couple of thousand of years to
develop it.
Dick #1349
People think that libraries are safe places, but they're not,
they have ideas.
email: dic...@uswest.net
Homepage http://www.users.uswest.net/~dickcr/
Stephen R Gould
news:noah-01129...@192.168.1.254...
> >
> > >Before you fall for the high percentage _98 percent_ similarity between
> > >human and chimp DNA, remember this. Only one chromosone of the human
DNA
> > >has been mapped. There is 22 more chromosone pairs to go.
> > >I would think the mapping for the chimp chromosones is far behind the
> > >human mapping.
> >
> > fairly straightforward chemical test done in police labs?
> >
> > ras...@highfiber.com
>
> There's 23 chromosones. (by the way chimps have 24 which already accounts
> for a major differance)
er, no it doesn't - binding an encyclopedia into 23 volumes rather than 24
has no effect on the content, and the effect here isn't much greater. (Oh,
I think you mean pairs of chromosomes, btw.)
Wouldn't you think you would have to compare more
> than just one...which hasn't really been accomplished as of yet seeing how
> the info was just mapped plus the added fact (now I'm guessing), that the
> chimp chromosones have not been mapped to any point near completion. Any
> comparism is based upon just a sliver of information.
>
> May be in two or three years you might be able to come back and say, I
> told you so, but right now I personally think it's a bunch of wishfull
> thinking.
>
Argument from personal incredulity. But if we are indeed able to say, "told
you so" and show that the DNA comparison is that good, would you change your
mind ?
> In effect, as an anology it would be like claiming a computer and a TV
> are 98 percent similar just by examining the power cord and knowing they
> both need 120 volts to run them. As time goes on you'll see some common
> aspects while the differances will also become evident.
>
> Noah
>
(Gould's rule: any analogy involving computers or computing is wrong.)
Sverker Johansson
> Before you fall for the high percentage _98 percent_ similarity between
> human and chimp DNA, remember this. Only one chromosone of the human DNA
> has been mapped. There is 22 more chromosone pairs to go.
> I would think the mapping for the chimp chromosones is far behind the
> human mapping.
Others have pointed out why this is irrelevant, because whole-DNA comparisons
can be done without sequencing.
But I would like to add also that for the many genes that we _have_ sequenced
in both species, the similarity is upheld. If you want to do this the hard
way,
don't take our word for it - all the mapping and sequencing that's been done
is openly available in various databases, you can check it out for yourself:
Here is one of the major databases:
http://www.ncbi.nlm.nih.gov/Entrez/nucleotide.html
Here are a few other links:
http://www.public.iastate.edu/~pedro/rt_1.html
--
Best regards, HLK, Physics
Sverker Johansson U of Jonkoping
----------------------------------------------
Definitions:
Micro-evolution: evolution for which the evidence is so
overwhelming that even the ICR can't deny it.
Macro-evolution: evolution which is only proven beyond
reasonable doubt, not beyond unreasonable doubt.
hrgr...@my-deja.com
no...@flood.net (Noah) wrote:
>
> Before you fall for the high percentage _98 percent_ similarity
between
> human and chimp DNA, remember this. Only one chromosone of the human
DNA
> has been mapped. There is 22 more chromosone pairs to go.
> I would think the mapping for the chimp chromosones is far behind the
> human mapping.
>
I am not a geneticist, but I know nevertheless that DNA similarities
are *not* measured by mapping the chromosomes of both species.
HRG.
>
http://www.abcnews.go.com/sections/science/DailyNews/chromosome991201.ht
ml
>
> Noah
maff91
>In article <3845d223...@ediacara.org>, "Charles Dye"
><ras...@highfiber.com> wrote:
>
>> On 1 Dec 1999 19:01:02 -0500, no...@flood.net (Noah) wrote:
>>
>> >Before you fall for the high percentage _98 percent_ similarity between
>> >human and chimp DNA, remember this. Only one chromosone of the human DNA
>> >has been mapped. There is 22 more chromosone pairs to go.
>> >I would think the mapping for the chimp chromosones is far behind the
>> >human mapping.
>>
>> What does genome mapping have to do with it? Isn't DNA comparison a
>> fairly straightforward chemical test done in police labs?
>>
>> ras...@highfiber.com
>
>There's 23 chromosones. (by the way chimps have 24 which already accounts
>for a major differance) Wouldn't you think you would have to compare more
>than just one...which hasn't really been accomplished as of yet seeing how
>the info was just mapped plus the added fact (now I'm guessing), that the
>chimp chromosones have not been mapped to any point near completion. Any
>comparism is based upon just a sliver of information.
>
>May be in two or three years you might be able to come back and say, I
>told you so, but right now I personally think it's a bunch of wishfull
>thinking.
>
>In effect, as an anology it would be like claiming a computer and a TV
>are 98 percent similar just by examining the power cord and knowing they
>both need 120 volts to run them. As time goes on you'll see some common
>aspects while the differances will also become evident.
Is that what you're going claim about the DNA test when you're hauled
before the court for murder?
>
>Noah
--
L.P.#0000000001
Noah
<srg...@worldnet.att.net> wrote:
>
> er, no it doesn't - binding an encyclopedia into 23 volumes rather than 24
> has no effect on the content, and the effect here isn't much greater. (Oh,
> I think you mean pairs of chromosomes, btw.)
>
What??? What if we had a 27th letter? This would change encyclopedias
drastically. I chromosome can be huge.
Noah
Sverker Johansson
Stephen's point is that 22 of the chromosomes look the same between
human and chimp, and the 23rd human one looks like chimp
chromosome 23 and 24 glued together end-to-end. Essentially the same
content, in one big package in humans and in two smaller
packages in chimps.
Louann Miller
>
>Before you fall for the high percentage _98 percent_ similarity between
>human and chimp DNA, remember this. Only one chromosone of the human DNA
>has been mapped. There is 22 more chromosone pairs to go.
>I would think the mapping for the chimp chromosones is far behind the
>human mapping.
>
>
>http://www.abcnews.go.com/sections/science/DailyNews/chromosome991201.html
Bad timing. A guy tried that argument in here earlier this week. The
human-chimp comparisons are not whole genomes to whole genomes but
one-to-one comparisons of individual proteins. Lots and lots of them.
Louann Miller
<l...@no.hlk.spam.hj.se> wrote:
>Stephen's point is that 22 of the chromosomes look the same between
>human and chimp, and the 23rd human one looks like chimp
>chromosome 23 and 24 glued together end-to-end. Essentially the same
>content, in one big package in humans and in two smaller
>packages in chimps.
BTW, there was a good article on this very subject available online in
the last year or so. But I couldn't find it again, when I went looking
earlier this week when Jack King trotted out this same identical
argument. Anybody got the link?
Stephen F. Schaffner
>In article <824uu5$oro$1...@bgtnsc03.worldnet.att.net>, "Stephen R Gould"
><srg...@worldnet.att.net> wrote:
>
>>
>> er, no it doesn't - binding an encyclopedia into 23 volumes rather than 24
>> has no effect on the content, and the effect here isn't much greater. (Oh,
>> I think you mean pairs of chromosomes, btw.)
>>
>
>What??? What if we had a 27th letter? This would change encyclopedias
>drastically. I chromosome can be huge.
Yes, if there were a difference of an entire chromosome's set of
genes between chimps and humans, the difference would be large. But
that's not what we see. Instead, we see the same genetic contents
(to a very good approximation), but packaged in different chromosomes.
I.e. the pages of the encyclopedia are (almost) the same -- they're
just bound differently.
-------
Steve Schaffner s...@genome.wi.mit.edu
SLAC and I have a deal: they don't || Immediate assurance is an excellent sign
pay me, and I don't speak for them. || of probable lack of insight into the
|| topic. Josiah Royce
Piltdown_Mann
In article <r5fc4sgrl99d8kfve...@4ax.com>, maff91
<maf...@nospam.my-deja.com> wrote:
> On 1 Dec 1999 23:16:06 -0500, no...@flood.net (Noah) wrote:
> >In article <3845d223...@ediacara.org>, "Charles Dye"
> ><ras...@highfiber.com> wrote:
> >
> >>
> >> >Before you fall for the high percentage _98 percent_
> similarity between
> >> >human and chimp DNA, remember this. Only one chromosone of the
> human DNA
> >> >has been mapped. There is 22 more chromosone pairs to go.
> >> >I would think the mapping for the chimp chromosones is far
> behind the
> >> >human mapping.
> >>
I sure know what it's like to be hauled inna court!
No fun attoll.
P.Mann
* Sent from RemarQ http://www.remarq.com The Internet's Discussion Network *
The fastest and easiest way to search and participate in Usenet - Free!
Charles Dye
>In article <3845d223...@ediacara.org>, "Charles Dye"
><ras...@highfiber.com> wrote:
>
>> On 1 Dec 1999 19:01:02 -0500, no...@flood.net (Noah) wrote:
>>
>> >Before you fall for the high percentage _98 percent_ similarity between
>> >human and chimp DNA, remember this. Only one chromosone of the human DNA
>> >has been mapped. There is 22 more chromosone pairs to go.
>> >I would think the mapping for the chimp chromosones is far behind the
>> >human mapping.
>>
>> What does genome mapping have to do with it? Isn't DNA comparison a
>> fairly straightforward chemical test done in police labs?
>
>There's 23 chromosones. (by the way chimps have 24 which already accounts
>for a major differance) Wouldn't you think you would have to compare more
>than just one...which hasn't really been accomplished as of yet seeing how
>the info was just mapped plus the added fact (now I'm guessing), that the
>chimp chromosones have not been mapped to any point near completion. Any
>comparism is based upon just a sliver of information.
Address the question, please. Why do you assume that the comparison
requires that the genomes be mapped first? Isn't DNA comparison a
fairly straightforward chemical test?
>May be in two or three years you might be able to come back and say, I
>told you so, but right now I personally think it's a bunch of wishfull
>thinking.
Do you "personally" have any experience in DNA testing? Or is your
"personal" opinion just a bunch of wishful thinking?
Thomas Scharle
: On 1 Dec 1999 19:01:02 -0500, no...@flood.net (Noah) wrote:
:
: >
: >Before you fall for the high percentage _98 percent_ similarity between
: >human and chimp DNA, remember this. Only one chromosone of the human DNA
: >has been mapped. There is 22 more chromosone pairs to go.
: >I would think the mapping for the chimp chromosones is far behind the
: >human mapping.
: >
: >http://www.abcnews.go.com/sections/science/DailyNews/chromosome991201.html
:
: Bad timing. A guy tried that argument in here earlier this week. The
: human-chimp comparisons are not whole genomes to whole genomes but
: one-to-one comparisons of individual proteins. Lots and lots of them.
There were a couple of articles in the October 15 issue
of Science magazine. Including a neat fold-out chart of
comparison of the chromosomes of about 20 different mammals,
and their evolutionary relationships. Humans and chimps
were there, and they are very, very close.
By the way, are we to take this comment of Noah's as a
*prediction* for evolutionary biology? "Evolution predicts
that the human and chimp DNA will turn out to be similar,
in the high-ninety-percent-range?" What does "creationism"
predict that the result of the comparison will be?
--
Tom Scharle scha...@nd.edu "standard disclaimer"
Louann Miller
wrote:
One Michael (kalandros) has since answered my question.
http://www.gate.net/~rwms/hum_ape_chrom.html
Rich Daniel
>>Stephen's point is that 22 of the chromosomes look the same between
>>human and chimp, and the 23rd human one looks like chimp
>>chromosome 23 and 24 glued together end-to-end....
> BTW, there was a good article on this very subject available online in
> the last year or so. But I couldn't find it again, when I went looking
> earlier this week when Jack King trotted out this same identical
> argument. Anybody got the link?
http://www.gate.net/~rwms/hum_ape_chrom.html
--
Rich Daniel http://www.wright.edu/~daniel.16
Derek Stevenson
> There's 23 chromosones. (by the way chimps have 24 which already
accounts
> for a major differance) Wouldn't you think you would have to compare
more
> than just one...which hasn't really been accomplished as of yet seeing
how
> the info was just mapped plus the added fact (now I'm guessing), that
the
> chimp chromosones have not been mapped to any point near completion.
Any
> comparism is based upon just a sliver of information.
Call me crazy, but I tend to be suspicious of any information about
"comparisms" between "chromosones" imparted by someone who can't even
spell the words.
Adam Noel Harris
:On 1 Dec 1999 19:01:02 -0500, no...@flood.net (Noah) wrote:
:
:>
:>Before you fall for the high percentage _98 percent_ similarity between
:>human and chimp DNA, remember this. Only one chromosone of the human DNA
:>has been mapped. There is 22 more chromosone pairs to go.
:>I would think the mapping for the chimp chromosones is far behind the
:>human mapping.
:>
:>
:>http://www.abcnews.go.com/sections/science/DailyNews/chromosome991201.html
:
:Bad timing. A guy tried that argument in here earlier this week. The
:human-chimp comparisons are not whole genomes to whole genomes but
:one-to-one comparisons of individual proteins. Lots and lots of them.
Actually, it's both. Noah is arguing from ignorance. He can't see how
you can compare them without assembling genetic maps of both humans and
chimps (how would that determine sequence similarity anyway?), so I guess
it can't be done.
I'm still wondering how Mendel figured out that peas can inherit round or
wrinkled seed coats without doing ANY protein sequencing!
-Adam
--
Opinions expressed are not necessarily those of Stanford University.
PGP Fingerprint = C0 65 A2 BD 8A 67 B3 19 F9 8B C1 4C 8E F2 EA 0E
Clark Dorman
loua...@yahoo.net (Louann Miller) writes:
> On 2 Dec 1999 08:55:53 -0500, Sverker Johansson
> <l...@no.hlk.spam.hj.se> wrote:
>
> >Stephen's point is that 22 of the chromosomes look the same between
> >human and chimp, and the 23rd human one looks like chimp
> >content, in one big package in humans and in two smaller
> >packages in chimps.
>
> the last year or so. But I couldn't find it again, when I went looking
> earlier this week when Jack King trotted out this same identical
> argument. Anybody got the link?
Try:
http://www.gate.net/~rwms/hum_ape_chrom.html
Or, from various earlier posts.
----------------------------------------------------------------------
Differing numbers of
chromosomes is not necessarily a barrier to reproduction. A good
example is that E. caballus (domestic horse), with 64 chromosomes
can interbreed with E. przewalski (Przewalski's horse) with 66
(see below).
A well documented example are the shrews, which are discussed at:
<http://meiosis.bionet.nsc.ru/Chrgeo.htm>. An interesting point
is that I got from this page was that shrew chromosomal
polymorphism was known in 1956. So, this is not exactly a new
discovery. Lemurs are also a common area of study:
<http://www.selu.com/~bio/cyto/diploid/Lemuridae2n.html>.
Finally, the mouse is known to have a diversity of chromosome
numbers; the following is an abstract for a paper on shrews in
Tennessee but mentions Mus musculus:
<http://www.karger.ch/journals/CCG/CCG763-4/CCG0153.htm> but also
see the reference to Mus domesticus below.
You can also use the change in chromosome numbers to get the
evolutionary history of related species. See the discussion of
dogs and their relatives at:
<http://www.kc.net/~wolf2dog/wayne2.htm>. And, of course, the
chromosomal relationships between humans and other great apes has
studied. See one of my favorite papers referenced below (Yunis
and Prakash).
Below, several posts discuss Robersian translocations. You can
also see a specific example at:
<http://www.pathology.washington.edu/Cytogallery/cytogallery.html>.
The Cytogallery has lots of neat stuff in general.
Of course, the above are all mammals (the example that you gave).
However, plants are well known for their wild and wooly
chromosome number changes that I won't even try to explain (since
I don't understand them) and examples are known for insects.
----------------------------------------------------------------------
From: Clark Dorman <cl...@s3i.com>
In-reply-to: ri...@southern.co.nz's message of Mon, 01 Jan 1996 02:30:05 GMT
Newsgroups: talk.origins
Subject: Re: Help answer a creationist's question about chromosome number changes
References: <4c579u$g...@orm.southern.co.nz>
Distribution:
--text follows this line--
In article <4c579u$g...@orm.southern.co.nz> ri...@southern.co.nz (Rick Harris)
writes:
> A creationist asked how it is that the number of chromosomes can
> change as new species evolves, because individuals with the new number
> would not be able to breed with any of the others and would run into
> problems due to inbreeding. I'm sure there's a simple explanation of
> this, but I'm damned if I can think of it right now.
The problem here is the statement: "individuals with the new
number would not be able to breed with any of the others". As it
turns out, this is not the case. During the reproduction, the
important point is not the actual number of chromosomes, but how
they line up and whether they can combine. I am not a biologist
and am particularly not a molecular biologist, but the answer
lies in a good molecular biology book. The one that I use is
"The Molecular Biology of the Cell" by Alberts et al. 1983.
There is now a 3rd edition.
In many normal humans (that can and do reproduce), there have
been an altered number of chromosomes because chromosomes have
their ends fused together. The chromosomes have an end cap
(can't find the official name right now) that does not contain
information, but can stick together. Since the chromosomes still
have all the information and can line up properly, everything is
ok. Usually, this is between the chromosomes with single-arms.
Also, normal humans can have whole segments switched between
between two chromosomes, as long as no material is lost (this is
called a chromosome translocation). See Alberts et al. for a
discussion.
The point though is that the situation is much more complicated
than simply that animals with different numbers of chromosomes
cannot reproduce. There is a species of deer that in particular
has a very wide number of chromosomes and they can continue to
reproduce.
A fascinating look at hominid chromosomes is in the paper:
Jorge J. Yunis and Om Prakash. "The Origin of Man: A
Chromosomal Pictorial Legacy", in Science, Vol. 215, 19
Mar 1982, p.1525-1530.
This paper answers the question: "How can man and chimpanzee be
related if they don't have the same number of chromosomes?" (23
pairs in man, 24 in great apes). No doubt, that is the _real_
question since your creationist is almost assuredly most
interested in how _he_ (or she) could have arisen from another
animal. What this paper has is a picture of all the chromosomes
of man, chimpanzee, gorilla, and orangutan lined up next to each
other and showing the 1000 band stage with the sections are all
labeled. Just by examining the picture for a couple of minutes
_clearly_ indicates that the chromosomes are remarkably similar.
The differences are equally interesting as the vast majority are
simple inversions of sections of chromosome. Chromosome 2 of
humans is shown next to two chimpanzee (and gorilla and
urangutan) chromosomes and the human one is twice as long as the
chimpanzee (and the other two as well) and all the bands match up
showing that the human chromosome is just a connection of the two
chimp chromosomes.
So thats your answer. Humans chromosome 2 is the combination of
2 chromosomes from the common ancestor with the chimpanzee and it
was able to reproduce fine, just as other animals are able to
reproduce with different numbers of chromosomes within their
species.
----------------------------------------------------------------------
From: howard hershey <hers...@indiana.edu>
Newsgroups: talk.origins
Subject: Re: Help answer a creationist's question about chromosome number changes Date:
2 Jan 1996 14:34:41 GMT
Organization: indiana university
Content-Type: text/plain; charset=us-ascii
X-URL: news:DORMAN.95D...@maverick.bu.edu
>In article <4c579u$g...@orm.southern.co.nz> ri...@southern.co.nz (Rick Harris)
>writes:
>> A creationist asked how it is that the number of chromosomes can
>> change as new species evolves, because individuals with the new number
>> would not be able to breed with any of the others and would run into
>> problems due to inbreeding. I'm sure there's a simple explanation of
>> this, but I'm damned if I can think of it right now.
Robertsian rearrangements are rather common in nature (found both
in differences between species and also *within* species as part
of the normal variation and chromosomal abnormalities. In fusion
(forming one chromosome from two), this involves two telocentric
(centromere at the end) chromosomes fusing to form one
metacentric chromosome with loss of the other centromere.
____. + ._____ --> ____._____
It can also involve fusion of two acrocentric (or acrocentric and
a telocentric chromosome). Sometimes the tiny chromosome formed
is lost; in other cases you have a metadicentric chromosome
formed. In the latter case one of the centromeres becomes
inactive for it to be stable.
a) ____._ + _.____ --> ____.____ + _._ (lost)
b) ____._ + _.____ --> ____._.____
All these processes are reversible, so that metacentric
chromosomes can become two telocentrics.
In addition, you can have simple chromosome trisomies (less
common in animals, more common in plants because plants tolerate
them better). In humans, the only aneuploidies that are viable
involve chromosome 21 (Down's) and the sex chromosomes.
Add to that polyploidies, where whole chromosome sets are
duplicated. These are usually tolerated even better than
aneuploidies and, in fact, are a well-documented mechanism for
the generation of new species in a single generation
(hybridization + polyploidy in plants). Even animals have
polyploid species (a sister species of *Xenopus laevis*, the
clawed African toad, is a polyploid of *laevis*).
Plenty of ways to change chromosome numbers. There are even more
ways to change chromosome arrangement (translocations and
inversions and small duplications). And chromosomal abberations
are (by far) even more common than mutation at the DNA level.
----------------------------------------------------------------------
From: howard hershey <hers...@indiana.edu>
Newsgroups: talk.origins
Subject: Re: Chromosomal numbers
Date: Wed, 02 Apr 1997 08:51:54 +0000
Organization: Indiana University, Bloomington
Lines: 45
Message-ID: <33421E...@indiana.edu>
References: <19970401204...@ladder01.news.aol.com>
NNTP-Posting-Host: shrew.bio.indiana.edu
Mime-Version: 1.0
Content-Type: text/plain; charset=iso-8859-1
Content-Transfer-Encoding: 8bit
X-Mailer: Mozilla 3.01 (Macintosh; I; PPC)
YXZ54 wrote:
>
> Can anyone explain to me how we currently answer how species have changed
> their chromosomal number.
>
> In other words, how can a an individual with a different number of
> chromosomes from its parent find a compatible mate.
>
> Scott <--------(3.8 billion years in the making) < : -
> )-----<------<
> yx...@aol.com
Primarily via Robertsonian fusions and fissions (breakage or fusion of
centromeres). Imagine an individual which has had a Robertsonian
fission on one chromosome (A) transforming one of his two copies of that
metacentric chromosome to two telocentric cromosomes (A', A'').
! ! >>> ! ! where the dot represents the centromere and the left
| | | ■ hand chromosome is a single unit.
At meiosis, this individual can produce 1) gametes with the normal
chromosome, 2) gametes with the two Robertsonian chromosomes, 3) a group
of abnormal gametes with missing or massively duplicated information.
The latter group, surprizingly, often has a *smaller* detrimental effect
in practice than one might expect (the abnormal chromosomes don't get
included in the final egg, dicentric sperm tend to have two heads and
poor motility, the fertilized zygote dies so early there is little
effect on number of offspring produced) in theory.
But in small inbreeding populations (and this is where speciation is
most likely), one has the substantial opportunity of producing
individuals with
!!
■■
which is the desired individual with a different number of chromosomes.
Whether said individual becomes the norm depends on conditions, but the
loss of fitness of the heterozygote (small though it might be) can
certainly help in the the generation of reproductive isolation of the
larger group and the smaller subset by providing pressure for
isolation. [Just as heterozygote advantage results in maintenance of
alleles that would otherwise be lost, heterozygote disgenesis results in
selection for any change - behavioral, genetic, etc. - that results in
further isolation of the two formerly united species.]
Simply reverse the process to see the effect of fusion.
----------------------------------------------------------------------
From: mtu...@snipthis.acpub.duke.edu (mel turner)
Newsgroups: talk.origins
Subject: Re: Changing Number of Chromosomes
Date: 1 Jun 1998 21:28:25 -0400
Organization: botany dept., duke univ.
Approved: rob...@ediacara.org
Content-Type: Text/Plain; charset=US-ASCII
X-Newsreader: WinVN 0.99.9 (Released Version) (x86 32bit)
Xref: pubxfer.news.psi.net talk.origins:434717
In article <6kvhme$kl8$1...@nnrp1.dejanews.com>, rich...@asi-consulting.com
wrote..
>
>Hello! I've got a serious question about evolution. How is it possible for
>the number of chromosmes to evolve? Can a single species have an
>indeterminant number of chromosomes? If not, how can the number change? For
>example, if one mutant human had say 47 chromosomes, could he/she successfuly
>breed with a normal human? Has this question ever come up in this ng?
>Thanks!
Yes, the question has come up before. As it happens, there are
indeed many species known in which individuals vary in chromosome
numbers, [sometimes with a whole range of numbers in one
polymorphic species]. Chromosomal polymorphisms are actually
pretty common.
Sometimes there is a strongly interpopulational, geographic
component to the variation, suggesting speciation-in-progress.
Basically, chromosome number changes by a "fusion" or a
"splitting" of chromosomes doesn't necessarily prevent
interfertility of organisms with different numbers [or their
hybrids]; the homologous chromosome arms of the different sets
may still pair up at meiosis.
I posted a few refs on this issue a while back, here's the
headers [from dejanews (I searched for "robertsonian fusion",
which also found a few other relevant posts)]:
Subject: Re: Proposal...
From: mtu...@snipthis.acpub.duke.edu (mel turner)
Date: 1997/11/23
Message-ID: <658aoo$2ij$1...@news.duke.edu>
Newsgroups: talk.origins
A couple of excerpts from it [abstracts from Biological Abstracts]:
TI Mitochondrial DNA variation and the evolution of Robertsonian
chromosomal races of house mice, Mus domesticus.
AU Nachman-M-W; Boyer-S-N; Searle-J-B; Aquadro-C-F
SO Genetics 136(3): 1105-1120
PY 1994
AB The house mouse, Mus domesticus, includes many distinct
Robertsonian (Rb) chromosomal races with diploid numbers from 2n
= 22 to 2n = 38. Although these races are highly differentiated
karyotypically, they are otherwise indistinguishable from
standard karyotype (i.e., 2 n = 40) mice, [snip]
TI Cytogenetic analysis of autosomal polymorphism in Graomys
griseoflavus (Rodentia, Cricetidae).
AU Zambelli-A; Vidal-Rioja-L; Wainberg-R
SO Zeitschrift fuer Saeugetierkunde 59(1): 14-20
PY 1994
AB South American phyllotine Graomys griseoflavus specimens were
collected in eight localities of central Argentina and
cytogenetically analysed. These populations comprised the
following karyomorphs: 2n = 42, 41, 38, 37, 36, 35 and 34. These
chromosome polymorphisms resulted from Robertsonian fusions
(RFs). A pericentric inversion (PI) in two different autosomal
[snip]
----------------------------------------------------------------------
From: afor...@ouray.cudenver.edu (Queen of Potatoes)
Newsgroups: sci.bio.evolution
Subject: Re: Chimp/Human Compatibility
Date: 22 Jan 1996 23:52:49 GMT
Organization: University of Colorado at Denver
Approved: jo...@pogo.cqs.washington.edu
Originator: evolution@pogo
In article
<Pine.A32.3.91j.96012...@homer26.u.washington.edu>
Ronald Bates <ronb...@u.washington.edu> writes:
>The question was can they hybridize not can they produce fertile young.
>If I remember correctly there is an even greater difference between
>horses and donkeys and yet they don't need any "editing" to produce mules.
>
>On 18 Jan 1996, Onar Aam wrote:
>>
>> It's possible, but then some "editing" of the chimp DNA is needed. Part of
>> the problem is that chimps and humans don't have the same number of chromosomes.
For general information purposes, two species do not need to have
the same number of chomosomes to produce an offspring (sometimes
even a fertile offspring). Since equines have been used to
illustrate hybridity in this thread, I offer the following
information:
E. caballus (domestic horse) has a diploid chromosome count of 64.
E. asinus (common donkey) has a diploid count of 62.
E. hartemannae (Hartman's Zebra) has a diploid count of 32
E. przewalski (Przewalski's horse) has a diploid count of 66
E. hemionus (Onager or Asiatic Ass) has a diploid count of 56
E. grevyi (Grevy's Zebra) has a diploid count of 46
E. burchelli (Grant's zebra) has a diploid count of 44
To my knowledge the only crosses that do not result in living offspring are:
Przewalki x Grevy's zebra
Przewalski x Hartman's zebra
Grevy's zebra x onager
Grevy's zebra x Grant's zebra
The number of diploid number of chromosomes a hybrid has will be
half the diploid count of each parent added together. Hence,
Przewalski x Equus will have 65 while a donkey x a horse will
have 63.
----------------------------------------------------------------------
From: p...@panix.com (Paul Gallagher)
Usually, all the individuals in the same species have the same number of
chromosomes, and any different species will have significantly different
chromosomes, and often different numbers of chromosomes. However, this
isn't always the case. Sometimes individuals with different numbers of
chromosomes will be able to reproduce, but often they will be less viable
than their parents. Often they will be sterile.
Horses are a good example.
Here are the chromosome numbers of different species.
Equus przewalskii (Przewalski's horse) 66
Equus caballus (domestic horse) 64
Equus asinus (donkey, domestic ass) 62
Equus onager (onager) 56
Equus grevyi (Grevy's zebra) 46
Equus burchelli (plains zebra) 44
Equus zebra hartmannae 32
It's interesting to look at what happens when these breed. Donkeys and horses
can breed with each other. A male horse and a female donkey produce a hinny.
A female horse and a male donkey produce a mule. However, mules and
hinnies are sterile. They cannot themselves reproduce (are there exceptions?).
Donkeys and domestic horses have many differences in the banding patterns of
their chromosomes in addition to the differences in chromosome number.
In contrast, Przewalski's horse and the domestic horse, despite their
different chromosome numbers, breed to produce fully fertile offspring.
Some people think that in-breeding is fairly common among horses, and this
might help explain why chromosomal differences have tended to become fixed
among different species.
Generally speaking, significant chromosomal changes usually occur during the
transition between species, and large chromosomal differences are a barrier to
reproduction. There are many exceptions, however. For example, some gerbils
in Egypt and Israel (the Gerbillus pyramidum group) can form hybrids, though
largely sterile, despite having varieties with 38, 50, 52, 64, and 66
chromosomes.
In contrast, humans and their closest relatives (Pan troglodytes, Gorilla
gorilla, and Pongo pygmaeus) have very similar chromosomes. Humans have 46
chromosomes, and the rest have 48. The appearance of many of the chromosomes
are very similar, but the species can't reproduce with each other.
Paul
----------------------------------------------------------------------
And here are some references to the primary scientific
literature:
IJdo, J.W. Baldini, A. Ward, D.C. TITLE(s): Origin of
human chromosome 2: An ancestral telomere-telomere
fusion. In: Proceedings of the national academy of
sciences OCT 15 1991 v 88 n 20 Page: 9051
Schubert, Ingo Rieger, Rigomar Fuchs, Jorg TITLE(s):
Alteration of basic chromosome number by
fusion-fission cycles. In: Genome. DEC 01 1995 v 38
n 6 Page: 1289
Traut, W. Clarke, C.A. TITLE(s): Karyotype evolution by
chromosome fusion in the moth genus Orgyia. In:
Hereditas. 1997 v 126 n 1 Page: 77
Jumas-Bilak, E. Michaux-Charachon, S. Ramuz, M.
Differences in chromosome number and genome
rearrangements in the genus Brucella. In: Molecular
microbiology. JAN 01 1998 v 27 n 1 Page: 99 [FYI:
Brucella is a bacteria]
Yuh, Yeong-Seng Liu, Yah-Yao Shaio, Men-Fang TITLE(s):
Chromosome Number of Trichomonas vaginalis. In: The
journal of parasitology. JUN 01 1997 v 83 n 3 Page:
551. [Trichomonas is a parasitic protozoan]
Houck, M.L. Ryder, O.A. Vahala, J. TITLE(s): Diploid
Chromosome Number and Chromosomal Variation in the
White Rhinoceros (Ceratotherium simum)> In: The
journal of heredity. JAN 01 1994 v 85 n 1 Page: 30
Jazdowska-Zagrodzinska, B. Dallai, R. Redi, C.A.
TITLE(s): Changes in DNA Content and Chromosome Number
during Spermatogenesis in the Gall Midge
Monarthropalpus buxi (Cecidomyiidae, Diptera). In:
Genome = Genome. APR 01 1992 v 35 n 2 Page: 244
de J. Silva, M.J. Yonenaga-Yassuda, Y. Karyotype and
chromosomal polymorphism of an undescribed Akodon from
Central Brazil, a species with the lowest known
diploid chromosome number in rodents. In:
Cytogenetics and cell genetics. 1998 v 81 n 1 Page:
46
Michael
> On 2 Dec 1999 10:03:05 -0500, loua...@yahoo.net (Louann Miller)
> wrote:
>
> >On 2 Dec 1999 08:55:53 -0500, Sverker Johansson
> ><l...@no.hlk.spam.hj.se> wrote:
> >
> >>Stephen's point is that 22 of the chromosomes look the same between
> >>human and chimp, and the 23rd human one looks like chimp
> >>chromosome 23 and 24 glued together end-to-end. Essentially the same
> >>content, in one big package in humans and in two smaller
> >>packages in chimps.
> >
> >BTW, there was a good article on this very subject available online in
> >the last year or so. But I couldn't find it again, when I went looking
> >earlier this week when Jack King trotted out this same identical
> >argument. Anybody got the link?
>
> One Michael (kalandros) has since answered my question.
>
> http://www.gate.net/~rwms/hum_ape_chrom.html
As much as I'd like to take the credit here, I think it was Rich Daniel who
provided that reference.
Mike
Sverker Johansson
> On 2 Dec 1999 10:03:05 -0500, loua...@yahoo.net (Louann Miller)
> wrote:
>
> >On 2 Dec 1999 08:55:53 -0500, Sverker Johansson
> ><l...@no.hlk.spam.hj.se> wrote:
> >
> >>Stephen's point is that 22 of the chromosomes look the same between
> >>human and chimp, and the 23rd human one looks like chimp
> >>chromosome 23 and 24 glued together end-to-end. Essentially the same
> >>content, in one big package in humans and in two smaller
> >>packages in chimps.
> >
> >BTW, there was a good article on this very subject available online in
> >the last year or so. But I couldn't find it again, when I went looking
> >earlier this week when Jack King trotted out this same identical
> >argument. Anybody got the link?
>
> One Michael (kalandros) has since answered my question.
>
> http://www.gate.net/~rwms/hum_ape_chrom.html
Thank you, both Michael and Louann and Rich.
I remembered that page too, and wanted to add it to my post,
but couldn't find it. The figure in the middle is an excellent
illustration of that one-big-or-two-small argument.
R Bishop
no...@flood.net (Noah) wrote:
>In article <824uu5$oro$1...@bgtnsc03.worldnet.att.net>, "Stephen R Gould"
><srg...@worldnet.att.net> wrote:
>
>>
>> er, no it doesn't - binding an encyclopedia into 23 volumes rather than 24
>> has no effect on the content, and the effect here isn't much greater. (Oh,
>> I think you mean pairs of chromosomes, btw.)
>>
>
>What??? What if we had a 27th letter? This would change encyclopedias
>drastically. I chromosome can be huge.
Sigh. You can put an encyclopedia into as many volumes as you wish.
The CONTENTS can be divided at any point you wish. Same contents, just a different
number of books.
Think about it. Try real hard.
>
>Noah
>
Sue
The Real Millenium starts January 1, 2001
Or 10/4/1997
Mr. M.J. Lush
I once got a book called 'Learn to Love' from the library and was
very disappointed to find it was just part of a 50 volume dictionary :-(
--
Michael Ban DHMO Now!! <http://www.dhmo.org/>
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
NPC rights activist | Nameless Abominations are people too.
David Raikow
> Before you fall for the high percentage _98 percent_ similarity between
> human and chimp DNA, remember this. Only one chromosone of the human DNA
> has been mapped. There is 22 more chromosone pairs to go.
> I would think the mapping for the chimp chromosones is far behind the
> human mapping.
>
> http://www.abcnews.go.com/sections/science/DailyNews/chromosome991201.html
>
> Noah
You are confusing the simple sequencing of the genetic code (AATTACCCGTAGCGCGTTGGCGCA, etc...) with
identifying the locations of genes with known effects.
Ken Cox
> "Charles Dye" <ras...@highfiber.com> wrote:
> > >Before you fall for the high percentage _98 percent_ similarity between
> > >human and chimp DNA, remember this. Only one chromosone of the human DNA
> > >has been mapped. There is 22 more chromosone pairs to go.
> > What does genome mapping have to do with it? Isn't DNA comparison a
> > fairly straightforward chemical test done in police labs?
> There's 23 chromosones. (by the way chimps have 24 which already accounts
> for a major differance)
Not really. See, in the middle of one of the human chromosomes
there's a couple of (somewhat-degraded but still recognizable)
telomeres joined together, and at two other places in that same
chromosome are a couple of (SDBSR) centromeres. This is what
is expected when two chromosomes are joined together, e.g. if
you pulled two of the ape chromosomes and spliced the ends.
By the way, I am willing to make a prediction based on evolution
about those chromosomes. If and when we get around to mapping
them, and mapping the corresponding chimpanzee chromosomes, we
will find that the maps strongly correspond. If for example a
gene for some enzyme manufactured by the liver is on that human
chromosome, we will find that it is also on one of those two
chimp chromosomes, and vice versa.
> Wouldn't you think you would have to compare more
> than just one...which hasn't really been accomplished as of yet seeing how
> the info was just mapped plus the added fact (now I'm guessing),
Yes, obviously. What Charles is pointing out above is that you
guessed wrong. You do not have to map a chromosome, or even
sequence any part of it, to perform the %sequence similarity
measure that is cited above.
As he also noted, measuring the similarity is a straightforward
chemical test. However, it's not the DNA testing done in police
cases; IIRC that uses PCR to make many copies of the DNA, then
chops up the DNA and does gel electrophoresis to produce those
banded patterns, which differ from person to person.
The test used for sequence similarity -- which, by the way, has of
course been calibrated with pairs of known sequences -- denatures
the DNA strands from two species, mixes them, allows them to rejoin,
and measures the melting point of the mix. The difference between
that melting point and that of the pure strands allows determination
of the %similarity, using the previously-mentioned calibrations.
One final note; though *mapping* of the full *genome* has not been
completed, plenty of *sequencing* of many *genes* has been done for
lots of different species. There are even on-line databases where
you can get lists of these. These sequences can be directly
compared, e.g. chimp hemoglobin versus human hemoglobin, and give
the same or better similarity as the raw chemical test. The reason
these sequence often have better similarity is that they (unlike
the entire genome, which contains many junk regions) are subject to
selection pressure, which tends to conserve the sequences.
--
Ken Cox k...@research.bell-labs.com
kybern...@my-deja.com
> <srg...@worldnet.att.net> wrote:
>
> >
> > er, no it doesn't - binding an encyclopedia into 23 volumes rather
than 24
> > has no effect on the content, and the effect here isn't much
greater. (Oh,
> > I think you mean pairs of chromosomes, btw.)
> >
>
> drastically. I chromosome can be huge.
False analogy.
The bases are the "letters".
What's "spelled" with these will be slightly different 2% overall, but
the bases in all life are IDENTICAL.
What you are proposing is a whole new alien lifeform.
> Noah
Q
Noah wrote:
> Before you fall for the high percentage _98 percent_ similarity between
> human and chimp DNA, remember this. Only one chromosone of the human DNA
> has been mapped. There is 22 more chromosone pairs to go.
> I would think the mapping for the chimp chromosones is far behind the
> human mapping.
>
> http://www.abcnews.go.com/sections/science/DailyNews/chromosome991201.html
>
> Noah
Well, then I guess all those paternity tests are false. Alotta guys are gonna
be breathing a sigh of relief. Of course, this will throw forensic science
for a loop.
Hugs
--
Naturally you're out of book space. Everyone is always out of book space. If
you're not out of book space, you're
probably not worth knowing
Wade Hines
>Noah wrote:
>> Before you fall for the high percentage _98 percent_ similarity between
>> human and chimp DNA, remember this. Only one chromosone of the human DNA
>> has been mapped. There is 22 more chromosone pairs to go.
>> I would think the mapping for the chimp chromosones is far behind the
>> human mapping.
>>
>> http://www.abcnews.go.com/sections/science/DailyNews/chromosome991201.html
>>
I think the problem may go deeper.
Given 3 billion base pairs how would 100 random samplings of 1000 bp matched stretches
do in estimating the similarity between chimps and humans.
People who suggest we need to get close to 3 billion base pairs to make the
comparision don't understand.
Pat James
(in message <noah-02129...@192.168.1.254>):
> In article <824uu5$oro$1...@bgtnsc03.worldnet.att.net>, "Stephen R Gould"
> <srg...@worldnet.att.net> wrote:
>
>>
>> er, no it doesn't - binding an encyclopedia into 23 volumes rather than 24
>> has no effect on the content, and the effect here isn't much greater. (Oh,
>> I think you mean pairs of chromosomes, btw.)
>>
>
> What??? What if we had a 27th letter? This would change encyclopedias
> drastically. I chromosome can be huge.
Exposing your ignornance again, eh? Most humans have 46 chromosomes, in 23
pairs. Downs Syndrome suffers have 47. Tell me, are Downs Syndrome suffers
human or not? They don't have the magic number of chromosomes.
>
> Noah
>
--
Scientific creationism: a religious dogma combining massive ignorance with
incredible arrogance.
Creationist: (1) One who follows creationism. (2) A moron. (3) A person
incapable of doing math. (4) A liar. (5) A very gullible true believer.
Charles Dye
>Noah wrote:
>> "Charles Dye" <ras...@highfiber.com> wrote:
>
>> > What does genome mapping have to do with it? Isn't DNA comparison a
>> > fairly straightforward chemical test done in police labs?
>
> [snip irrelevant reaction]
>
>As he also noted, measuring the similarity is a straightforward
>chemical test. However, it's not the DNA testing done in police
>cases; IIRC that uses PCR to make many copies of the DNA, then
>chops up the DNA and does gel electrophoresis to produce those
>banded patterns, which differ from person to person.
My confusion; thanks for the correction.
kybern...@my-deja.com
baily...@worldnet.att.net wrote:
>
>
> Noah wrote:
>
> > Before you fall for the high percentage _98 percent_ similarity
between
> > human and chimp DNA, remember this. Only one chromosone of the human
DNA
> > has been mapped. There is 22 more chromosone pairs to go.
> > I would think the mapping for the chimp chromosones is far behind
the
> > human mapping.
> >
> >
http://www.abcnews.go.com/sections/science/DailyNews/chromosome991201.ht
ml
> >
>
> Well, then I guess all those paternity tests are false. Alotta guys
are gonna
> be breathing a sigh of relief. Of course, this will throw forensic
science
> for a loop.
>
> Hugs
Does this fool really think that DNA similarity was tested by
mapping every single base in both chimp and human DNA?
What an idiot!
We (last I heard) have not even begun a systematic mapping of the chimp
genome.
You're right, I wonder how he thinks DNA testing works.
Bob Casanova
talk.origins, posted by kybern...@my-deja.com:
The evidence says he doesn't think. He emotes, pontificates
and witnesses.
(Note followups, if any)
Bob C.
Reply to Bob-Casanova @ worldnet.att.net
(without the spaces, of course)
"Men become civilized, not in proportion to their willingness
to believe, but in proportion to their readiness to doubt."
--H. L. Mencken