Google Groups no longer supports new Usenet posts or subscriptions. Historical content remains viewable.
Dismiss

No Pictures?

21 views
Skip to first unread message

Eric Moyer

unread,
Jan 21, 1994, 4:19:25 PM1/21/94
to

Just an innocent question prompted by the discussion of market:
Why can't IF have pictures?

I admit that I personally get a heck of a lot of enjoyment out of picturing
the scenes in IF games in my head, but why is forcing the user to do this
for everything a necessary characteristic for interactive fiction? A book can
still be worth reading even if it is illustrated. For example, _The Little
Prince_ by De Auxburry (sp?) has pictures that are essential to its message,
but it is not a book written for mental sluggards. Is it possible that in
excluding graphics from IF, we are missing something that could put the
genre into the limelight, add some money to the author's ailing bank
accounts and also possibly raise the cultural standards for computer
entertainment.

---
Emo...@kiwi.cs.wright.edu
I believe what I say, but that doesn't imply that anyone else does.

Steve Dunham

unread,
Jan 21, 1994, 7:20:21 PM1/21/94
to
Eric Moyer (emo...@kiwi.cs.wright.edu) wrote:

: Just an innocent question prompted by the discussion of market:


: Why can't IF have pictures?

: I admit that I personally get a heck of a lot of enjoyment out of picturing
: the scenes in IF games in my head, but why is forcing the user to do this
: for everything a necessary characteristic for interactive fiction? A book can
: still be worth reading even if it is illustrated. For example, _The Little
: Prince_ by De Auxburry (sp?) has pictures that are essential to its message,
: but it is not a book written for mental sluggards. Is it possible that in
: excluding graphics from IF, we are missing something that could put the
: genre into the limelight, add some money to the author's ailing bank
: accounts and also possibly raise the cultural standards for computer
: entertainment.

_Le Petit Prince_ does not have a picture for every scene.

Steve
dun...@gdl.msu.edu

Gerry Kevin Wilson

unread,
Jan 21, 1994, 9:25:27 PM1/21/94
to
Actually, I wouldn't mind adding pictures. However, I am not, nor have I ever
claimed to be, an artist. Not only would I have to find a good artist, I'd
have to find one that would work for a percentage, because I wouldn't dish
out too much cash on art up front. I might not like his/her work. But
apparently there's a TADS graphic version in the works somewhere. I'm not
positive. So maybe next game will have pictures, so long as I don't have to
deal with pictures of people and can still use a text parser. I can draw
asteroids, after all. (Maybe.)

Actually, this is a good time to advertise for authors and artists for
Vertigo Software. You'd be working for percentages, depending on how much
of a game you did. I'll be handling distribution, advertising, packaging,
whatever. My investor group is a fair size now, and I may have a few hundred
dollars to get this popsicle stand going. Now if only I can finish Avalon
and get some registrations in. Later.

--
<~~~~~E~~~G~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|~~~~~~~>
< V R I O Software. We bring words to life! | ~~\ >
< T | /~\ | >
<_WATCH for Avalon in early '94!____wh...@uclink.berkeley.edu_|_\__/__>

John Kawakami

unread,
Jan 22, 1994, 7:51:17 AM1/22/94
to
I was thinking about this kind of thing, even though I've only started
seriously writing this last year, and I've gotten into writing some
interactive fiction last month. (For me, they are related. I grew up
on Infocom adventures, but never wanted to write one until I got some
control of my writing.)

I think one possible way to include graphics and sound and video is
to use a graphical HTML reader as a front end. Granted, this might
seem like overkill, but so what. It's a good theoretical foundation.

The TADS back end would be running the game, and producing short HTML
files to send to the Mosaic-style front end. This would give the
reader control over when the picture shows up, and lets the writer
and reader preserve the sequence of events.
--

:::::
::j::
::::: jo...@crl.com

Ms. Pauline Benzies

unread,
Jan 22, 1994, 7:40:21 PM1/22/94
to
In article <2hprg5$10...@msuinfo.cl.msu.edu> dun...@cl-next4.cl.msu.edu (Steve Dunham) writes:

>Eric Moyer (emo...@kiwi.cs.wright.edu) wrote:
>
>: still be worth reading even if it is illustrated. For example, _The Little
>: Prince_ by De Auxburry (sp?) has pictures that are essential to its message,
>: but it is not a book written for mental sluggards. Is it possible that in
>
>_Le Petit Prince_ does not have a picture for every scene.

I just checked my copy of "The Little Prince" (by Antoine de Saint-Exupe'ry
published 1991 by Mammoth, an imprint of Mandarin Paperbacks ISBN 0 7497 0723 2)
and there are pictures on every pair of pages (some 45) except for 12. That is,
open the book at random and there is a 3 in 4 chance of an illustration on one
or both pages.

I agree, however, that these are largely integral to the story and the book
would not be the same without them.

Tom O Breton

unread,
Jan 23, 1994, 11:12:59 PM1/23/94
to
emo...@kiwi.cs.wright.edu (Eric Moyer) writes:
> For example, _The Little Prince_ by De Auxburry (sp?) has pictures that
> are essential to its message, but it is not a book written for mental
> sluggards.

Antoine De Saint Exupery, the French aviator. Charming little book.

> I admit that I personally get a heck of a lot of enjoyment out of
> picturing the scenes in IF games in my head, but why is forcing the user
> to do this for everything a necessary characteristic for interactive
> fiction?

I strongly agree that it's not a neccessary characteristic. It does have
the good point that anyone (anyone literate) can write a text adventure
without either possessing the tools and skill to make decent pictures,
or working with an artist. I'm not saying the result will be any good,
of course.

I know that David Malmberg talked about giving graphics to AGT, but I
have not heard that this ever came about.

Tom

--
Having finished it's [sic] evil speech, the Tom spreads it's scaly
wings and soars away... (t...@world.std.com, TomB...@delphi.com)

E...@ib.rl.ac.uk

unread,
Jan 24, 1994, 4:21:28 AM1/24/94
to
In article <2hq2qn$j...@agate.berkeley.edu>

whiz...@uclink.berkeley.edu (Gerry Kevin Wilson) writes:

>Actually, I wouldn't mind adding pictures. However, I am not, nor have I ever
>claimed to be, an artist. Not only would I have to find a good artist, I'd
>have to find one that would work for a percentage, because I wouldn't dish
>out too much cash on art up front. I might not like his/her work. But
>apparently there's a TADS graphic version in the works somewhere. I'm not
>positive. So maybe next game will have pictures, so long as I don't have to
>deal with pictures of people and can still use a text parser. I can draw
>asteroids, after all. (Maybe.)
>
><_WATCH for Avalon in early '94!____wh...@uclink.berkeley.edu_|_\__/__>

Has anyone tried one of those digitizing cameras that take pictures to
disk? I haven't, but I imagine that it would be simple to find some
nice scenery and a few friends with delusions of glory, and just start
clicking. I admit it might be a bit more tricky with asteroids tho'...

Inigo Surguy
e...@ib.rl.ac.uk

Phil Goetz

unread,
Jan 24, 1994, 7:42:50 PM1/24/94
to
In article <2hpgst$b...@valhalla.cs.wright.edu> emo...@kiwi.cs.wright.edu (Eric Moyer) writes:
>
>Just an innocent question prompted by the discussion of market:
> Why can't IF have pictures?

Given that for the past 7 years not a single text-only game has been
published by a major software house, I think the appropriate question is:

Why must IF have pictures?

Phil go...@cs.buffalo.edu

Stephen R. Granade

unread,
Jan 24, 1994, 10:50:47 PM1/24/94
to

To a certain degree, I think it is market-driven. Remember when 640k was
so much memory that it would *never* be used up? Programs (and programmers)
will use all available resources. After all, Sierra's King's Quest I was
created when IBM asked Sierra to come up with a game that would showcase
the new PC Jr's graphics.

Besides, many of the pictures are quite impressive, and certainly much
easier to deal with than prose. While you and I might not like that,
it is an unfortunate reality.

Stephen
--
_________________________________________________________________________
| Stephen Granade | "My research proposal involves reconstructing |
| | the Trinity test using tweezers and |
| sgra...@obu.arknet.edu | assistants with very good eyesight." |

Kevin J. Chen

unread,
Jan 25, 1994, 9:59:46 AM1/25/94
to
Phil go...@cs.buffalo.edu sez:

> Why must IF have pictures?

Stephen R. Granade@cleve sez:

>Besides, many of the pictures are quite impressive, and certainly much
>easier to deal with than prose. While you and I might not like that,
>it is an unfortunate reality.

[I'm jumping in the middle here, so apologies if I'm rehashing old
arguments.]

If, by "much easier to deal with", you mean more easily adapted to
the use of a simplified user interface, I'd agree with you. From
an implementation standpoint, prose is more compact than xx MB
of graphics files, is easily more portable between target systypes,
and is probably easier to generate.

The inclusion of graphics in IF games is certainly welcome if it
contributes to the game by making it more playable; however,
I have yet to see that this is so. Games such as some of the later
Infocom adventures with "optional" graphics (Arthur is the only
one which comes to mind) really have no purpose for pictures
aside from a "look, they're there" value. Games in which graphics
are the *sole* operating environment are usually constrained by
the complexity of their user interface, and my own personal
experience has shown these to reduce problem-solving to the
point and click equivalent of "search-find-use".

Text-only interfaces are useful filters -- they eliminate much of
the background noise that can occur with exceptionally pretty
graphics representations of scenes by omitting, perhaps, unusually
distinctive patterns of unimportant objects (doesn't it *always*
look like the tree in the background has a hollow in it that just
*might* contain a useful object?), or narrowing possibilities from
the extraneous (a GUI user might be tempted to push every single
key on the computer console, but a text user could simply be told
that there are two prominent-looking buttons off to the side).
They are also simply more versatile, constrained only by the
complexity of the parser/interpreter -- more complex GUIs are
maddening to use (I'm particularly bothered by recent attempts
by Lord British and his Ultima crew).

The disadvantage that textual IF does suffer is not a fault of
the genre, but rather a fault of public perception -- people think
that reading is geekish, and therefore, Infocom failed to capture
that share of the market that look at Sega or Sierra Online as
quality entertainment.

Kevin.
kc...@andrew.cmu.edu

Matthew Amster

unread,
Jan 25, 1994, 3:56:54 PM1/25/94
to

>Has anyone tried one of those digitizing cameras that take pictures to
>disk? I haven't, but I imagine that it would be simple to find some
>nice scenery and a few friends with delusions of glory, and just start
>clicking. I admit it might be a bit more tricky with asteroids tho'...
>Inigo Surguy

Then, of course, there is the ubiquitous desktop scanner; most are perfectly
suitable for scanning photographs for screen display. Imagine a game like Save
Princeton embellished with photos of actual campus buildings. It would
certainly not detract from the player's conceptualization of the scene, as the
game deals with real places.

The capability to display static graphic scenes to accompany rooms would be a
welcome addition to TADS and a good intermediate step between all-text and the
functionality described in the beta docs for TADS/G. Is mroberts listening?

Matthew Amster

Narciso Jaramillo

unread,
Jan 26, 1994, 2:18:32 AM1/26/94
to
In article <8hFHDWC00...@andrew.cmu.edu> "Kevin J. Chen" <kc...@andrew.cmu.edu> writes:

> I have yet to see that this is so. Games such as some of the later
> Infocom adventures with "optional" graphics (Arthur is the only
> one which comes to mind) really have no purpose for pictures
> aside from a "look, they're there" value.

A small point: I see nothing wrong with the "look, they're there"
value of pictures. We didn't *need* a page-long description of the
volcano in Colossal Cave; it didn't significantly advance the plot or
give any puzzle clues; it was just fun to read. Why can't we have
pictures that are just fun to look at?

I'm not arguing that we *need* pictures (or even that the pictures in
many adventure games are fun to look at); I'm just saying that we
shouldn't immediately snap at anyone who even remotely hints that the
atmosphere of a game can be enhanced by pictures, even if they aren't
integral to the gameplay.


nj

Gerry Kevin Wilson

unread,
Jan 26, 1994, 3:36:58 AM1/26/94
to
Well, I don't believe I've ever said anything against graphics, merely in
the manner they are used. Far too often they REPLACE good writing instead of
enhancing it. I think that a game should be written well whether it has
graphics or not. Good prose is just as beautiful as anything any artist can
come up with. Also, I really can't stand Graphical User Interfaces. They
give away the puzzles. I prefer a well-done text parser that implements lots
of synonyms.

--
<~~~~~E~~~G~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|~~~~~~~>
< V R I O Software. We bring words to life! | ~~\ >
< T | /~\ | >

John P. Mechalas

unread,
Jan 26, 1994, 9:21:58 PM1/26/94
to
(possible minor Return to Zork spoilers below)

With all this discussion on pictures vs. no pictures and text vs. GUI, I
am curious as to what the general consensus has been about Return to Zork.
I've been an IF fan for many many years, and have tackeled (though not
always solved) most of the Infocom adventures. I grew to love the
complex parsers that developed over the years, and I admit that it's
difficult for anything to replace them.

That's why I was so surpsrised by Return to Zork. Not only was the "text"
removed from the IF gendre, but also the sentence parser as well. At
first, I hated it: I kept thinking how all the really weird combinations
of words I like to try are no longer possible. And how the GUI would
give away all the puzzles.

As it turned out, this was not the case in general. Although there were
a few puzzles where looking at the icons gave away what I supposed to do
next (the scenes with Boos, for example), or at least *hinted* at what
I should do, more often than not I found myself working just as hard on
the game as I did any other IF at the same difficulty level (I honestly
thought RTZ was too easy, as I was expecting something more along the
lines of Zork Zero, but that's another story). Also, there were many
times where I actually _missed_ objects or "exits" when looking at the
pictures.

The text world has it's advantages in that you have to visualize the
world, and the objects in it. But, it's easy (usually) to figure out
what is important and what isn't. In a picture, especially when as
complex as those in RTZ's, it's easy to simply overlook an item that
blends in to the background. There's obviously a trade-off here,
but I can't really tell whether there's a net gain or loss. I still
enjoyed the game, and it still challeneged me.

Yes, some of the puzzles were out of place. The Dwarven Mines (sheesh!)
comes to mind. And, there were mazes, too (but at least you could map
them, making them bearable). But all in all, it was well done.

I was also impressed with the NPC interaction, a step in a new direction
for IF. Although not terribly complex (and a little bit brain-dead),
it's very well done for a _pioneering_ effort in character interaction.

So, after investing a few hours into the adventure, I found myself liking
it quite a bit. Yes, it could have been better, but I think that's to
be expected. Overall, I was very satisfied.

Any other thoughts?


Cheers,
John

--
John Mechalas "I'm not an actor, but
mech...@gn.ecn.purdue.edu I play one on TV."
Aero Engineering, Purdue University #include disclaimer.h

Stephen R. Granade

unread,
Jan 28, 1994, 1:27:27 AM1/28/94
to

In a previous article, kc...@andrew.cmu.edu ("Kevin J. Chen") says:

>Phil go...@cs.buffalo.edu sez:
>
>> Why must IF have pictures?
>
>Stephen R. Granade@cleve sez:
>
>>Besides, many of the pictures are quite impressive, and certainly much
>>easier to deal with than prose. While you and I might not like that,
>>it is an unfortunate reality.
>
>[I'm jumping in the middle here, so apologies if I'm rehashing old
>arguments.]
>
>If, by "much easier to deal with", you mean more easily adapted to
>the use of a simplified user interface, I'd agree with you.

I didn't make myself very clear, did I? :) I'll elaborate a bit:

Reading takes effort. We are (in general) visually-oriented people.
Which is easier to deal with, sentences telling you how to get somewhere,
or a map? Making mental pictures from text description takes more
work than simply looking at a picture. That's all I meant. Any
comments, anyone?

John Kawakami

unread,
Jan 29, 1994, 2:19:28 PM1/29/94
to
In article <NJ.94Jan...@birch.cs.berkeley.edu>,

I might be unusual here, but I like text adventures more for the
story and writing than for the difficulty of the puzzles. I think
some well chosen pictures would seriously add to the quality of
the games. These pictures need not be integral to the gameplay.
In fact, they should be peripheral to the play, providing something
which establishes a mood more than a screenful of clues. Trying
to "decode" all the buttons in a picture would mar the experience.


.
--

:::::
::j::
::::: jo...@crl.com

Hans Persson

unread,
Jan 28, 1994, 12:33:07 PM1/28/94
to
> the functionality described in the beta docs for TADS/G.

Whoa! What is this? Where can I get this document? Will the real TADS
survive afterwards?

/ Hans

Jorn Barger

unread,
Jan 29, 1994, 6:03:55 PM1/29/94
to
In article <2iecs0$c...@crl.crl.com>, John Kawakami <jo...@crl.com> wrote:
> [...]

>I might be unusual here, but I like text adventures more for the
>story and writing than for the difficulty of the puzzles. [...]

This is a truth that's really easy to forget! Good writing with *no*
puzzles is a perfectly honorable thing, and there should be a place
for simple, elegant, non-puzzle-oriented hyperfictions. (I expect
there's various *classes* of interactivity that aren't trying to be
puzzles, and we should be careful not to turn up our noses at them!)

I'm curious to explore this level a bit: I'd like to propose a
group experiment we can do: choose a novel or story most of us have
read and enjoyed (Pynchon's Lot 49? Robert Anton Wilson's Illuminati
series?), and see whether it's even *possible* to add interactive
elements, without detracting from its literary qualities, much less
whether we can *add* enjoyment...

This is the opposite of the start-with-the-puzzles school of IF design,
and I think it's important to explore it, *keeping in mind* that having
good puzzles shouldn't really be necessary at all.

I posted a message last fall analysing choose-your-own-path fictions
(it's ftp-able from genesis.mcs.com in mcsnet.users/jorn/ifissues.if
I think). There were two main kinds of branching in the book I was
looking at: major branches where a character makes a life-shaking
decision, requiring an entire new plot to be written, or minor ones
where you simply make the 'right' or 'wrong' choice-- and if the latter,
then you simply correct it and continue as before! (or die...)

We shouldn't try to write new plots for Pynchon, but can't we, in theory,
add the second sort of 'minor' branching, without detracting from the
book-- even enhancing it, hopefully?

Utterly trivial example:

Phone rings. Answer it? (y/n).

no -> It keeps ringing. Answer it? (y/n)

At this level, it's really just glorified page turning-- but can this effect
be used *artistically* to add any useful sense of interactivity?

One possibility: make sure people are paying attention by giving them
questions that test them:

Ask Gabriel for a ride? (y/n)

yes -> He doesn't drive. We told you that!

Or:

Tell Elaine the news? (y/n)

yes -> Not a good idea. As we've seen, she can't keep a secret.

The idea is to 'make a virtue' of this braindead level of interactivity...

Is that possible???

Erik Max Francis

unread,
Jan 30, 1994, 10:40:05 PM1/30/94
to
tul...@cii3112-13.its.rpi.edu (David Michael Tuller) writes:

> In article <2iecs0$c...@crl.crl.com>, John Kawakami <jo...@crl.com> wrote:
>
> I'm curious to explore this level a bit: I'd like to propose a
> group experiment we can do: choose a novel or story most of us have
> read and enjoyed (Pynchon's Lot 49? Robert Anton Wilson's Illuminati
> series?)

Note that _Illuminatus!_ was by both Robert Anton Wilson and Robert
Shea.


Erik Max Francis, &tSftDotIotE ...!uuwest!alcyone!max m...@alcyone.darkside.com
USMail: 1070 Oakmont Dr. #1 San Jose, CA 95117 ICBM: 37 20 N 121 53 W __
AGCTACTGTACGTACGTTTGCACGTATGCTGTGCAXTGCATACTGACATCGTGACTGATCTGCATGACTTGCA / \
"Omnia quia sunt, lumina sunt." (All things that are, are lights.) \__/

David Michael Tuller

unread,
Jan 30, 1994, 12:23:57 PM1/30/94
to
In article <2ieq0r$4...@Mercury.mcs.com>, jo...@MCS.COM (Jorn Barger) writes:
|> In article <2iecs0$c...@crl.crl.com>, John Kawakami <jo...@crl.com> wrote:
|> >I might be unusual here, but I like text adventures more for the
|> >story and writing than for the difficulty of the puzzles. [...]
|>
|> This is a truth that's really easy to forget! Good writing with *no*
|> puzzles is a perfectly honorable thing, and there should be a place
|> for simple, elegant, non-puzzle-oriented hyperfictions. (I expect
|> there's various *classes* of interactivity that aren't trying to be
|> puzzles, and we should be careful not to turn up our noses at them!)

Personally, I enjoy working out the puzzles. If a game had a great plot but no
puzzles, it wouldn't be able to keep my attention. The puzzles are the main
reason I play IF games.


|> I'm curious to explore this level a bit: I'd like to propose a
|> group experiment we can do: choose a novel or story most of us have
|> read and enjoyed (Pynchon's Lot 49? Robert Anton Wilson's Illuminati
|> series?)

BTW, what are these books? I've never heard of them.

David M. Tuller
tul...@rpi.edu

Joanne Omang

unread,
Jan 31, 1994, 8:59:49 PM1/31/94
to
Jorn:
I'm a new Internetter, a middle-aged writer with one published novel and
a second about done. As I've gradually gotten into cybering, I've become
interested in the possibilities of just what you're discussing--interactive
fiction that also has literary merit. I confess myself sobered by the
assumption of your 1/29 posting, that this will be something new. Forgive me
if I've come in extremely late to your discussion, but didn't the New York
Timeew section last year assume that literary value is at
least within shouting distance in the IF already written? Or were those
works something other than what you're describing?
Seems to me the major stumbling block is that in conventional fiction,
the authorial vision or voice is the reason one keeps reading: to taste that
person's reality and learn another human being's understanding of the world
and of the human condition. If the reader is to be given choice, it will
have to be the second type you describe--author's guided choice--even if it
looks to be a monumental choice, if the conventional novel's appeal to the
reader is to be preserved. But that's a big if--and I wonder w what
cyberwriters are creating is an altogether new form of fiction, and
therefore no ct to the kind of Pynchon (or whoever)-patching you
describe. I reader were together to explore chance and choice,
that would indeed be new: a melding of two (or an infinite number of)
consciousning out how to live. But it seems to me that would
involve real-time work together (as in a classroom), not something the
writer can package in advance. I don't think that's what you have in mind.
I'm looking forward to reading your posting of last fall about these
fictions. My own thoughts have involved a fiction that presents a family, in
which the reader can choose to follow the paths/destinies of one or another
family member, and I as writer have managed to make them all interact in
some meaningful way, seven or eight choices down the line in each case. Or
alternatively, a single protagonist faced with significant choices, all of
which lead outward, intermesh and eventually reconnect in such a way as to
leave our hero in much the same situation, if not with the same history, no
matter which path the reader takes. This would then be a kind of meditation
on fate vs choice, nature vs nurture; a reader could read it several times
and get a different book each time.
However, the thought of writing this is daunting to say the least, as
it's hard enough writing a novel with just one effectively written path,
let alone seven or more, and intecg at that. What intrigues me about
it is that I always have to choose myself what my characters are going to do
in vnsiuation; often I can't get them to do what I want them to
do for the purposes of my plot, because they have become independey are real enough constructions, their choices are ineluctable. Yet I
fancy that if I give them free choice at an early literary age (godlike
author that I am), this would be freedom of a sort for them as well as
for me--they could make any of the choices, or all the choices at once, and
construct themselves in the process, as we do as human beings. Yet I fear
that this is abnegation of the authorial responsibility I spoke of. Not to
mention damnably hard to write.
Joanne


Jorn Barger

unread,
Jan 31, 1994, 9:55:46 PM1/31/94
to
[posted to rec.arts.int-fiction and alt.hypertext in August 1993]

Issues in Interactive Fiction
Jorn Barger

I've been collecting my thoughts for a while, with an eye toward re-writing
(with you all, as a group?) the 'theory' part of the raif-faq, filling in
some more detail, and adding some of the threads we've explored this year.

How many different sorts of interactivity can we identify, in fiction, at
this early stage of IF evolution?

One clear and concrete paradigm for IF is the choose-your-own-path style of
book-design, where each short 'chapter' ends with a choice of directions
you might go next (traditionally only two, for convenience). If the book
is written so as to make the reader the main character, these may be
physical directions, like "If you choose to go north, turn to page 61" or
actions like "If you choose to eat the cupcake, go to page 62". (One might
give the reader more godlike control over events, however: "If you want to
know what was going on in Rangoon at this moment, turn to page 63" or "If
you want to know what Bobo was thinking at this moment, turn to page 64" or
"If you want a plague of locusts to descend, turn to page 65" ;^)

So a 'chapter' may represent not just a new place, but a new state of
affairs in the same place, possibly involving the passage of time. ("The
clock on the wall now reads two a.m. The guard is asleep at his desk.")

I think it's accurate to say that every Infocom-style text adventure
*could* be re-published this way, in book form (which I'll call "book-
tech"), but almost all their chapters would then be just a sentence or two,
like "You eat the cupcake. It's very tasty." and after each such short
chapter you'd have to be offered every possible combination of command-
words. Almost-identical chapter-text would have to be repeated countless
times with slightly different menus at the end. (If you could end a chapter
with "Go back to where you just came from" that would help a lot! But
that's pretty advanced, for book-tech...)

A number of important consequences for IF theory follow from this single,
simplest design element, *plot branching*:

1. Loss of authorial control: the author now has to anticipate every
possible reader path, and craft the layout of chapters so that every path
offers *a reading experience the author can be proud of*.

2. The 'finished-it' paradox: The first time you reach 'The End' you will
not have finished reading all the author's text. Are you then expected to
go back and exhaust every alternate path, to 'get your money's worth' or to
express your pleasure in her craft? Can an author keep this interesting?
(With book-tech, you can just reread it cover to cover, although you'll
miss some of the subtler meanings this way.)

3. The multi-book paradox: Should other paths offer greatly differing
stories? There's a limit to how much detail you can put into each
alternate path! With book-tech, for example, *choosing a point-of-view* at
the start will necessarily imply choosing one of two entirely distinct
sub-books. On a computer, text-modification rules might make this more
practical.

4. Dead ends: The usual strategy for dealing with the multi-book paradox
is to have a single happy ending and any number of dead ends, that usually
involve the main character's (in fact) ending up dead. Where book-tech
might require the reader to use a bookmark to backtrack at this point,
adventure games usually offer a save-game feature, or a password to begin
again at an earlier point, or an Undo facility. "Loom" is an exception,
designed with no dead ends.

5. Added value: There needs to be some added value from the interactive
elements. Some possibilities: a) challenge of solving a puzzle b)
increased psychological involvement c) learning rules of alternate world
d) seeing the consequences of alternate lifechoices e) beauty of chance
recombinations

6. Hide-the-happy-ending: A good IF designer will cleverly disguise the
branches so that most players guess wrong at least a few times at each
point. But too many wrong guesses will be frustrating, and too few will be
unchallenging. This might be thought of as 'engineering an optimal
literary path'.

7. Looping, and nonsequential episodes: a path may return you to the exact
same chapter. And a single chapter may have *several* choices that lead
back to it. One can try to predict what order these loops will be tried
in, but the text itself can't make assumptions about this. Some sets of
chapters might be freely experienced in any order-- David Graves calls this
'browse around'. ("If you want to visit the art gallery, go to page 67.")
In a book, such chapters must be optional to the plotting, because you'll
be able to skip them altogether. (In this way they strongly resemble
hypertext.) On a computer, they can supply behind-the-scenes changes that
eventually have a visible payoff.

8. Hidden information: an optional chapter may provide information that
allows one to guess the 'right' path at some later point. (This is a
cliche in computer adventures.) On replays, though, these chapters can be
safely skipped.

9. Linear sequences: Some chapters may have only a single choice at the
end. This makes most sense on a computer that's displaying graphics of
each scene. Graves calls this 'user-paced sequencing'.

10. Merging paths vs shared text: with book-tech, if you can get to a
given chapter by two different paths, nothing on those paths can possibly
make any difference to the future course of events. This is therefore a
much more trivial sort of interactivity. (Semantically, this might often
involve what AI-folk call 'plan repair'. One choice was the right plan,
the other was wrong, but can be quickly corrected.) Computers offer an
improvement where multiple paths may share some text but not all text, so
that only the 'right' path reveals the possibilities hidden for the others.
Graves might class this as 'progressive disclosure'. (?)

11. Menus vs typing: on a computer you can allow the reader to type
anything, or you can offer a menu of options. In a book you're stuck with
menus. Using menus makes solving the puzzle a *lot* easier, which is
usually not what you want. ("If you choose to look in the wastebasket, turn
to page 66...") With typing, though, where the possible inputs are almost
infinite, most of the player's guesses will necessarily lead to boring
dead-ends.

12. Literal menus vs tokenized menus: if the menu offers "If you choose to
tell the creepy guy to bug off, turn to page 67" and page 67 says "You tell
the creepy guy to bug off" ...that's boringly repetitive. One solution is
to offer 'tokens' in the menu, like "warm response" "cool response" "cold
response", which are expanded with more humor or interest in the following
text, instead of simply repeating the menu choice. (The new "Sam and Max"
graphic adventure from LucasFilms does this.)


=----------=- ,!. --=----=----=----=----=----=----=----=----=----=----=
Jorn Barger j't Anon-ftp to genesis.mcs.com in mcsnet.users/jorn for:
<:^)^:< K=-=:: -=-> Finnegans Wake, artificial intelligence, Ascii-TV,
.::.:.::.. "=i.: [-' fractal-thicket indexing, semantic-topology theory,
jo...@mcs.com /;:":.\ DecentWrite, MiniTech, nant/nart, flame theory &c!
=----------= ;}' '(, -=----=----=----=----=----=----=----=----=----=----=

Bob Newell

unread,
Jan 31, 1994, 11:17:02 PM1/31/94
to
>|> This is a truth that's really easy to forget! Good writing with *no*
>|> puzzles is a perfectly honorable thing, and there should be a place
>|> for simple, elegant, non-puzzle-oriented hyperfictions. (I expect
>Personally, I enjoy working out the puzzles. If a game had a great plot but

I enjoy good puzzles in many i-f games, but I have wished often for more
i-f that is not puzzle-centered (virtually all of it is, and that which is
not is not very good). Is there a contradiction here- that i-f *must* have
puzzles to hold one's interest- but then i-f just becomes puzzle solving
and little more?

The closest I've seen to finding a balance is The Horror of Rylvania, which
I recommend everyone try (there's a demo version on ftp.gmd.de; it's worth
registering). I found I was able to enjoy the prose and the story in this
game, although ultimately, solving the puzzles does seem to take control of
the experience.

Although we've come a long way from the
run-around-and-pick-up-the-treasures games, we still have a way to go.

John Kawakami

unread,
Feb 1, 1994, 3:48:17 AM2/1/94
to
I'm working on my first "real" IF. That is, it's the first topographical
hypertext I'm making where I've made some effort at readability. Anyway,
I'm doing it in DOS, using the command line and a ton of batch files.

I'm getting interested in issues of time on the one hand, and the "magic"
or randomness. Sometimes, I want several chunks of text to be displayed
in a way where the user sees the passage of time. Other times, I want
to use randomness to create situations where chunks of text combine to
make "magic". For example, let's say several rooms have random (but
similar) descriptions. Travelling between the rooms will reveal new
info about each room the longer the player lingers.

I'm really going nowhere with this. It's just fun to see how the "world"
works, and what changes to the texts do to make the world work in new
and interesting ways.

One thing I'm sure is that any academic who wants to make pronouncements
about hypertexts or IF had better log some real time trying to write
some hypertext or IF. Writing really takes some getting used to.

--

:::::
::j::
::::: jo...@crl.com

Jacob Solomon Weinstein

unread,
Feb 1, 1994, 5:17:10 PM2/1/94
to
Matthew Amster <mam...@pomona.claremont.edu> wrote:
>Then, of course, there is the ubiquitous desktop scanner; most are perfectly
>suitable for scanning photographs for screen display. Imagine a game like Save
>Princeton embellished with photos of actual campus buildings. It would
>certainly not detract from the player's conceptualization of the scene, as the
>game deals with real places.

If TADS ever has the capability to add static graphic scenes, I think I
would probably add them to Save Princeton. I made the game a text adventure
because I think that text adventures are superior to graphic adventures,
but I don't think that adding snapshots would detract from the quality
of the game, and it would probably make people more likely to play (and
pay for) Save Princeton. We are, as has oftne been noted, a
visually-oriented society, and folks would be more likely to take a look
at a game that has graphics, even ones that are unneccessary to the
game.


Sascha Wildner

unread,
Feb 1, 1994, 6:12:05 PM2/1/94
to
In article <2igqfd$o...@usenet.rpi.edu> tul...@cii3112-13.its.rpi.edu (David Michael Tuller) writes:

Personally, I enjoy working out the puzzles. If a game had a great
plot but no puzzles, it wouldn't be able to keep my attention. The
puzzles are the main reason I play IF games.

As far as I remember, Activision's Portal (played it on my Amiga when
the world was much younger) was a game that actually had no puzzles
(except moving the pointer around and deciding which gadget to click
next) but was quite able to keep the attention of many people.

Alter Ego (also by Activision) was another game that required no
puzzle solving but was very entertaining.

And yes, both games are IF (IMHO).


--
Sascha Wildner, Am Druvendriesch 27, 50354 Huerth, Germany

GC d--- p--- c++ l- m-- s-/- !g w+ t+ r x+

Jorn Barger

unread,
Jan 31, 1994, 9:49:52 PM1/31/94
to
Joanne Omang <oma...@delphi.com> writes [with some accidental deletions?]:
> [...] I confess myself sobered by the

> assumption of your 1/29 posting, that this will be something new. Forgive me
> if I've come in extremely late to your discussion, but didn't the New York
> Time[s Book Revi]ew section last year assume that literary value is at

> least within shouting distance in the IF already written? Or were those
> works something other than what you're describing?

Well, I read the review, but I haven't seen the works. But my recollection
of the review was that the only ones he really admired were the ones that
had a random-combinations section... because of the poetry that emerged
with some sense of being *previously unseen*... Coover seemed to me to
dislike almost all the tightly plotted hyperfictions...?

> [...] I reader were together to explore chance and choice,


> that would indeed be new: a melding of two (or an infinite number of)
> consciousning out how to live. But it seems to me that would
> involve real-time work together (as in a classroom), not something the
> writer can package in advance. I don't think that's what you have in mind.

Sounds like role-playing games? (I need the missing phrases, I fear)

> I'm looking forward to reading your posting of last fall about these
> fictions.

(Since you asked, I guess I get to repost it here... :^)

> My own thoughts have involved a fiction that presents a family, in
> which the reader can choose to follow the paths/destinies of one or another
> family member, and I as writer have managed to make them all interact in
> some meaningful way, seven or eight choices down the line in each case.

This sounds very promising! If I get you right, whether my sister decides
to graduate or drop out doesn't affect my lifepath (much), but my thoughts
and feelings towards her, and our meetings, would vary...?

And you could have a 'generic' financial-crisis scenario that could be
set off by *any* of your relatives needing major aid...

> Or
> alternatively, a single protagonist faced with significant choices, all of
> which lead outward, intermesh and eventually reconnect in such a way as to
> leave our hero in much the same situation, if not with the same history, no
> matter which path the reader takes. This would then be a kind of meditation
> on fate vs choice, nature vs nurture; a reader could read it several times
> and get a different book each time.

Yeah, this *theme* is a natural for IF-- all roads lead equally to the [bullet-
with-your-name-on-it, or whatever]. It will get old pretty quick, though. ;^/

> However, the thought of writing this is daunting to say the least, as
> it's hard enough writing a novel with just one effectively written path,
> let alone seven or more, and intecg at that.

I'm reminded of the bindingbusting generational sagas that still regularly
appear... and sell well!

> What intrigues me about
> it is that I always have to choose myself what my characters are going to do
> in vnsiuation; often I can't get them to do what I want them to
> do for the purposes of my plot, because they have become independey are real
> enough constructions, their choices are ineluctable.

Good paradox! But can you channel them in different directions by changing
their 'environment'?

> Yet I
> fancy that if I give them free choice at an early literary age (godlike
> author that I am), this would be freedom of a sort for them as well as
> for me--they could make any of the choices, or all the choices at once, and
> construct themselves in the process, as we do as human beings. Yet I fear
> that this is abnegation of the authorial responsibility I spoke of. Not to
> mention damnably hard to write.

I think this is a good challenge to keep in mind. John Watson claimed
he could condition an infant to grow up into any arbitrary profession.
Can a novelist form a clear picture of a child's personality, and then
rerun their life several different ways? (The closing deathbed scene
could reunite the threads!) This might be the sort of thing that will
be done once, well, and maybe then never again...?

thanks for the thoughtfuls :^)

jorn

Jorn Barger

unread,
Feb 2, 1994, 2:06:19 AM2/2/94
to
Jacob Solomon Weinstein <jac...@tucson.Princeton.EDU> wrote:
>If TADS ever has the capability to add static graphic scenes, I think I
>would probably add them to Save Princeton. [...]

Well, I'd be remiss if I didn't jump in with a plug for ascii-art.

Plug:
==========================================================================
.
::
:: .. :
. .::::.: ::
- :. :':::::.:::: /-\_/-\_/-\_/-\_/-\_/-\_/-\_/
| :':'::.::::::.: - . , . . .
| \- - :''::':'::: ... _/ | . . <^o^o^^o^> . .
| ] \- -::'::'::.::/ | . <^o^^o^^o^^o^> ,
| : ..\:::':'::/ | . . <^^^^^^^^^^^^^^> .
| ] : .. _ -=_ | , H.:.//... ..:H . .
| ] : ./ \ | . . . I://.//. //::I ,
| ] :/ \ | . H:.://.//...:H ..
] / / \ \ | :. I.:/./ .//..:I .: .
_+m"m+_ / / \ | . , H:../////./::H . ..
Jp qh J888888888888h | ., . I./:/../ //.:I , . ,
______ O O / 88 \\\ \ \ \ 88 |____;__H:.// //:/./:H_________
Yb dY 88 \\\\\\ \\\ \ 88
"Y5m2Y" / 8 \\\\\\\\\\ \\ 8
_________________ / J888888888888888888h __________
______"______ 8OO8XX [YBNNDY] XX8OO8 ==_======_====_===__________
==========================================================================

If you haven't checked out alt.ascii-art, definitely do! There's a very
happening animations scene, using vt100 codes...

jorn

Ms. Pauline Benzies

unread,
Feb 1, 1994, 9:08:11 PM2/1/94
to
In article <SWILDNER.9...@channelz.GUN.de> swil...@channelz.GUN.de (Sascha Wildner) writes:
>As far as I remember, Activision's Portal (played it on my Amiga when
>the world was much younger) was a game that actually had no puzzles
>(except moving the pointer around and deciding which gadget to click
>next) but was quite able to keep the attention of many people.
>
> [ deleted ]

>
>And yes, both games are IF (IMHO).

I found Portal a mind-numbingly boring way to read a fairly uninspiring story.
It seemed to degenerate at times into a "guess the next button to push" before
the game would give you the next chapter.

In fact, in Forbidden Planet (in London) recently, I saw a paper copy of
Portal and half-thought of buying it. Decided against it cos I already had
the electric version ;-)

Phil Goetz

unread,
Feb 6, 1994, 4:44:42 PM2/6/94
to
In article <SWILDNER.9...@channelz.GUN.de> swil...@channelz.GUN.de (Sascha Wildner) writes:
>As far as I remember, Activision's Portal (played it on my Amiga when
>the world was much younger) was a game that actually had no puzzles
>(except moving the pointer around and deciding which gadget to click
>next) but was quite able to keep the attention of many people.

Except that Portal wasn't a game. You just read it. It was
hypertext, but not interactive: Nothing you did could affect
the outcome.

Phil go...@cs.buffalo.edu

0 new messages