Gmail Calendar Documents Reader Web more »
Recently Visited Groups | Help | Sign in
Google Groups Home
lumber
Home
+ new post
Pages
Files
About this group
Join this group
[no subject]
Options
There are currently too many topics in this group that display first. To make this topic appear first, remove this option from another topic.
There was an error processing your request. Please try again.
flag
   4 messages - Collapse all  -  Translate all to Translated (View all originals)
The group you are posting to is a Usenet group. Messages posted to this group will make your email address visible to anyone on the Internet.
Your reply message has not been sent.
Your post was successful
 
From:
To:
Cc:
Followup To:
Add Cc | Add Followup-to | Edit Subject
Subject:
Validation:
For verification purposes please type the characters you see in the picture below or the numbers you hear by clicking the accessibility icon. Listen and type the numbers you hear
 
bjørn magnhildøen - chyphertext performance ISBN 978-82-92428-05-4  
View profile  
 More options May 3 2007, 10:28 am
From: bjørn magnhildøen - chyphertext performance ISBN 978-82-92428-05-4 <NOEM...@gmail.com>
Date: Thu, 03 May 2007 16:28:16 +0200
Local: Thurs, May 3 2007 10:28 am
Subject:
Reply to author | Forward | Print | Individual message | Show original | Report this message | Find messages by this author

ezilanim (a+b=c different from berømmelse

tna (because of sel- dWWWWWWWWWWWc
em lat                    /e@@@Bodes Myscei Lobec

noital Q@@@%%@( ^@@~ /@@R  toperasjon sonja

cinife @@Q@----
is  @@O@@@e/R@%(@@@/ t@~ - addWWrWess"}{WaWWWh
potiphar unmalicious  ^R@%^(@@@t/(@@R//C@@kunstmiljøet blir st
http://noemata.anart.no/correlab/A057.JPG 1k

-i w Rere
meme, and if
you chrom dildiks kr

' and  lasir- }WW
m - em i dna i i  em  e adan

hawor noit- "W
sickbay stBo
-blood / pestilentBatik Maggi.


    Reply to author    Forward  
You must Sign in before you can post messages.
To post a message you must first join this group.
Please update your nickname on the subscription settings page before posting.
You do not have the permission required to post.
bjørn magnhildøen - chyphertext performance ISBN 978-82-92428-05-4  
View profile  
 More options May 3 2007, 11:26 am
From: bjørn magnhildøen - chyphertext performance ISBN 978-82-92428-05-4 <NOEM...@gmail.com>
Date: Thu, 03 May 2007 17:26:48 +0200
Local: Thurs, May 3 2007 11:26 am
Subject:
Reply to author | Forward | Print | Individual message | Show original | Report this message | Find messages by this author

1266a96644a406e1b22504d16bbe6a3c
963622cc265f4173cfe169a8f709561be8053308
 em liaM
/  FR
ELHSMRJKHTRFST
bbe2a76e4fd2a3310c8c4c067dfc6abed4220bcd
$1$vm9Woba2$4w4ARZroaOY1f5KKCEKwp1
he  Mail me  elSubhe  Mail me  elSub
20202f44
det vil   --
nfuGerq. uin re s Gb
eb70a12812d74761c7e2e9a18631b1dc959a0a75
 2 he 2  2 Me
http://noemata.anart.no/still/nm2/nm0216.jpg 15k

 1  1 r
-1722032237.


    Reply to author    Forward  
You must Sign in before you can post messages.
To post a message you must first join this group.
Please update your nickname on the subscription settings page before posting.
You do not have the permission required to post.
bjørn magnhildøen - chyphertext performance ISBN 978-82-92428-18-4  
View profile   Translate to Translated (View Original)
 More options May 4 2007, 2:57 am
From: bjørn magnhildøen - chyphertext performance ISBN 978-82-92428-18-4 <NOEM...@gmail.com>
Date: Fri, 04 May 2007 08:57:51 +0200
Local: Fri, May 4 2007 2:57 am
Subject:
Reply to author | Forward | Print | Individual message | Show original | Report this message | Find messages by this author

tp(ghonp(eelebom(rwsr(gnoem2(gonme2             RVITQ(CYREONTP(EOYNTP(KSLSYP(KSLSYP

}}      2(tckrg(1)i(tckrg(cktrg(canltaitktg

cnof(cnof(cooeiks(capn(ctryp2(chsrc             (etibusia)i(0:)i(06)i(06)i(06)i(1x4

loooctrP 4 PTNN 3 ehT23:11
0fAkM2JygkKFhcYGRolJico0NTY3ODk6Q0RFRkdISUpTVWV1hZWmNkZWZnaGlqc3R1dnd4
A
sia
|------------------ 31:1 |--------------4---massive a-z entropy
0  0 airlcx 0  0 xsrhvreax 0 a 1 ae 1 gq 0  0 uarfx 0 rz 1 mv 0  las sor
i bafdlnarpm ug xpipkslvfuwl    na a trru yaaggbja daaaaia yo
tttlk 25 23 84 94 23 75 23 45 23 84 23 05 2332 51 32 50 49 32 50 32 52
49 32 55 32 55 32 51 32 49 32 48 32 50 32 48
10 2  12 5 5 12 12 3 10 12 0 12 2 11 7 4318b177eaf8dcc225f296d22adf99928
4 1 7 3 21 113 5 9 5 6 9 3 13 1 10 3 2 13 14 5 12 0 5 9 7 14 9 14 7 5
10 4 5 6v qvq qb ybbx 8 5 5 14 0 9 9 4 12 6 3 10 4 5 65 0 7 0 11 0 6 0
550 49 32 51 32 48 32 48 49 32 13 0000 0000 0000 0000 0000 0000 0000
0000
IYU     I¨¨<^¨>¨>^^>¨>¨^>¨>¨>^>¨>'>*>>5+>5>9<4<)#4<<89>8>97>7>7<)>79Q
few fw fw fw fw fwf wf w fw fe fe fe fe fe fes  s s s s s s s s s s s s
s s s s s s s s s s s s s s jeg ser på ssene
nrs,pr/hv,sk    ,lmenneskegjøre/       sf*-edn,h
|,Delop|.0G,bdeikmoprstv|å*,-..G
,
da39a3ee5e6b4b0d3255bfef95601890afd80709Espinn_Benhv,,  n.|ksdjog.|hun.|d
er.|d
D,|,elpoepeno|.n        niphhn?ånepFG|ohslding?showlikefr,32+23+_B1H3S124SDG1EN
D6F0,S
; 0 t 0  0  0  0  0  0  0  0 g&lm 0 th 0  0  0  0  0  0  0 /< 0  0  0  0
 0  0  0  0  0  0  0  0 0  0  0  0  0 t;strlen
al  pe   r_rts =            
4576 ,76.-37.65-7.65-7463.7WEF
eness åp res gej s s s s s s s s s s s s s s s s s s s s s s s s s s
sedn,h
ihgfed,_B               ?32+utronmkihfec,_,_,?40ihgfed,_B               ?32+utronmkihfec,_,_,?40  

d|.red|.nuh|.gojdsk|.n  ,,vhneB_nnipsesho|GFpenå?nhhpin        n.|onepeople,|,D
s,0f6dne1gds
94 64 94 64 94 64 94 64 64 94 64 94 64 94 64 94 64 94 64 94 64 94 64
94AGTGTGAGTGATGTGTGAGTGTAGATCGATCGATCGATCGACTGACTGTCTCTCGACTGCATGCTAGCAT
GC
r=:e    kkitevgej
K  
115 44 112 114 101 114 101 46 13 10
Glpt,htidu,|.nuh|.gojds
ht|.Fec,D       kl_,buhuffsouldegj      øre_Bj,geveitikke_Bne

edam evah sraef ruoy aremihcThe effect of the kong-an is to bring one to
a stuck point, where
 ",.AGHabdefhilnoprstuwyFf yah bihari me f whee
f f f ffff f f watt f toon f f endoscopically f
fdf14c9c90ebb5c6a37b6afcf978782bff718ab6ff 9 dowload 9 uninverse 0 f 0 f
2 f 3 f
ff
F F F F F F Ff_______


    Reply to author    Forward  
You must Sign in before you can post messages.
To post a message you must first join this group.
Please update your nickname on the subscription settings page before posting.
You do not have the permission required to post.
bjørn magnhildøen - chyphertext performance ISBN 978-82-92428-05-4  
View profile  
 More options May 5 2007, 3:28 am
From: bjørn magnhildøen - chyphertext performance ISBN 978-82-92428-05-4 <NOEM...@gmail.com>
Date: Sat, 05 May 2007 09:28:46 +0200
Local: Sat, May 5 2007 3:28 am
Subject:
Reply to author | Forward | Print | Individual message | Show original | Report this message | Find messages by this author

$1$2ziet6Nn$x6JeDfgQK7DQGpvBMw1MY1
ELSSWRKXLTBSTNB0TMRNFMJRTM
as 1 20 possible 0 0 on 2 28.5714285714 themselv 1 20 create 0 0 have 0
0 to 1 11.7647058824 be 4 42.1052631579 propetechniques 1 22.2222222222
thus 0 0 makes 0 0 i
fore all the uncertaint else's work should be a

has received the atten as possible on themselvsuch as Evolution
Contrhas received the atten as possible on themselvsuch as Evolution
Contr
JACKSON, AND THE ARTIST FORE ALL THE UNCERTAINTLEAVING THEM RECOGNIZAB
1265466497
serr bs punetr. Abe un Wnpxfba, naq gur negvfgunf erprvirq gur nggrag
yrnivat gurz erpbtav fnzcyrf juvpu va 1989grpuavdhrf guhf znxrf
 serr bs punetr. Abe un

b74c11ecebb420630bd98b32f8f8bd73
 -Oabcelorsuvz
ol steg yllaretil etiuqol steg yllaretil etiuq rup snaem osla dedrocer
Intentions Completely,  Over-zealous Bureaucrac

called plagiarism, sin recorded also means purnames of the tracks bac
417274272c20737570706f72746564206279206d65646920696e74656e74696f6e7320636f6 d706c6574656c792c206265656e2075736564206f6e206f74686572206f636361
lawyers 1 of 1 Geffen/BMG. 1 called 1 plagiarism, 0 sin

0e3c58e3682b6c4d935d3a9f2f0a6c3f34d0c132

.tra.3PM.GMB/neffeG fo sreywal
Deconstruction Of Tunes The Cd, (1.000 Copies

10ad72e74c39105b26fb731b53c1a2641391f85f
(Descrambling Conten deconstruction of tunesRevolution in the
Inter(Descrambling Conten deconstruction of tunesRevolution in the
Inter
file (decss.mp3) in wh this shows that digitathe etoy.com domain whfile
(decss.mp3) in wh this shows that digitathe etoy.com domain wh
8eee823f7e8e3b82cea924b98a1ed869e19f685a
5fbbf00aaffee372a67e85c546db7a726e41c0e0
$1$iVUGdani$e6HQCyLgRL43PKkWO0EE3.
english. the 'snuggles', the effectiveness of tdownload and in mp3 fo
FNTNLNNTNTPRTKXNRN0RTKNSTR0SSNT
download 2 and 3 in 4 mp3 8 form 7 English. 21 The 18
'Snuggles',Negativland 6 agreed 2 to 2 pa
technologies. 4 This 4 pu 6 found 6 online. 7 In 8 'Don't

UNTRSTNTNKF0STNLTNTNMPFRMKSN0SRSPKTWS
 technologies. this pufollows a simple proc
 haqrefgnaqvat bs gur hfgrpuabybtvrf. Guvf chgg.


    Reply to author    Forward  
You must Sign in before you can post messages.
To post a message you must first join this group.
Please update your nickname on the subscription settings page before posting.
You do not have the permission required to post.
End of messages
« Back to Discussions « Newer topic     Older topic »

Create a group - Google Groups - Google Home - Terms of Service - Privacy Policy
©2009 Google