Multiple sequences in UCSC browser, not identified in NCBI

[Warren Anderson]

General question: why does the UCSC genome browser give two sets of chromosomal coordinates for the same refSeq ID, and why do SNP from one of the sets fail to show up in dbSNP??

for example, when I search for rat Tnf (NM_012675) in the UCSC genome browser, I get these results:

NM_012675 at chr20:4855829-4858446
NM_012675 at chr20:5189383-5192000

However, when I search for SNPs from one strand in dbSNP, it does not identify the SNP in the Tnf gene:

rs198435874 [Rattus norvegicus]

TCCCTCCCTCAGCAAACCACCAAGC[A/G]GAGGAGCAGCTGGAGTGGCTGAGCC

Chromosome: 20:4857207

Gene: LOC103694380 (GeneView)

Functional Consequence: synonymous codon

Validated: by frequency

This was the case for many other genes as well. Can someone please explain?

[Steve Heitner]

Hello, Warren.

This is the result of a discrepancy between our own BLAT program and GenBank.  According to NCBI, NM_012675 (Tnf) only maps to chr20:5,189,382-5,192,000.  Our own BLAT program, however, maps it to both chr20:4,855,829-4,858,446 and chr20:5,189,382-5,192,000.  This is why our Browser shows Tnf at chr20:4,855,829-4,858,446 while dbSNP shows LOC103694380.

If you examine the records for NM_012675 (http://www.ncbi.nlm.nih.gov/nuccore/NM_012675?report=GenBank) and LOC103694380 (http://www.ncbi.nlm.nih.gov/gene/103694380), they do both represent the same thing.

Please contact us again at gen...@soe.ucsc.edu if you have any further questions.  All messages sent to that address are archived on a publicly-accessible Google Groups forum.  If your question includes sensitive data, you may send it instead to genom...@soe.ucsc.edu.

---
Steve Heitner
UCSC Genome Bioinformatics Group

--