Illumina exm ID conversion

[Venkat Addala]

Hi UCSC Team,

I would like to know how do i map illumina exmID in OmniExpressExome genotyping chip (look like this exm2269097) to SNP ID or location. I looked after the location mentioned along with that but i couldn't map to any of the SNP in around 5K region. I followed the same steps  that you mentioned in previous mail on converting "kpg" ID to SNP location. With "exm ID" this is not working.  I want to know what actually this "exmID" means. Kindly help.

​

​Thanks

Venky​

​

​

[Matthew Speir]

Hi Venkat,

Thank you for your question about converting Illumina exm IDs. I'm not familiar with exm IDs, and I couldn't find any information on them after some web searches. I would suggest you contact Illumina, the creators of the OmniExpressExome chip, for an explanation of what these exm IDs represent. You can find contact information for their customer support here: http://www.illumina.com/company/contact-us.ilmn. If you can provide me with a few sample lines from your file that contains these IDs and their positions, I may be able to suggest a technique for using the Genome Browser to convert them. If this file contains private information that you do not wish to share with the public list, you may send the file to me directly.

I hope this is helpful. If you have any further questions, please reply to gen...@soe.ucsc.edu. All messages sent to that address are archived on a publicly-accessible Google Groups forum. If your question includes sensitive data, you may send it instead to genom...@soe.ucsc.edu.

Matthew Speir
UCSC Genome Bioinformatics Group

--

[Venkat Addala]

HI Mathew,

These is how exm ID looks in Illumina Chip file.

Header :

IlmnID,Name,IlmnStrand,SNP,AddressA_ID,AlleleA_ProbeSeq,AddressB_ID,AlleleB_ProbeSeq,GenomeBuild,Chr,MapInfo,Ploidy,Species,Source,SourceVersion,SourceStrand,SourceSeq,TopGenomicSeq,BeadSetID,Exp_Clusters,RefStrand

exm1015483-0_B_R_1922528506,exm1015483,BOT,[T/C],0040687298,TCGCCATTGGCACACTCAAACTCATCTTGTGCTCGGCAAGAGGAATTCAC,,,37,12,57586960,diploid,Homo sapiens,ExomeSNPs,0,TOP,GCGTGGGCACTGGGGCCCACAGCGCTGGCTCAGAAAGCTCCCTCCACCTCCCTCCCCAGC[A/G]GTGAATTCCTCTTGCCGAGCACAAGATGAGTTTGAGTGTGCCAATGGCGAGTGCATCAAC,GCGTGGGCACTGGGGCCCACAGCGCTGGCTCAGAAAGCTCCCTCCACCTCCCTCCCCAGC[A/G]GTGAATTCCTCTTGCCGAGCACAAGATGAGTTTGAGTGTGCCAATGGCGAGTGCATCAAC,868,3,-

exm1015490-0_T_F_1922495431,exm1015490,TOP,[A/G],0058740938,AGTTTGAGTGTGCCAATGGCGAGTGCATCAACTTCAGCCTGACCTGCGAC,,,37,12,57587039,diploid,Homo sapiens,ExomeSNPs,0,TOP,GCACAAGATGAGTTTGAGTGTGCCAATGGCGAGTGCATCAACTTCAGCCTGACCTGCGAC[A/G]GCGTCCCCCACTGCAAGGACAAGTCCGATGAGAAGCCATCCTACTGCAGTAAGGAGCCCC,GCACAAGATGAGTTTGAGTGTGCCAATGGCGAGTGCATCAACTTCAGCCTGACCTGCGAC[A/G]GCGTCCCCCACTGCAAGGACAAGTCCGATGAGAAGCCATCCTACTGCAGTAAGGAGCCCC,850,3,+

--Venkat

--
Regards

Venkat Addala 

Computational Biologist

[Venkat Addala]

Hi Mathew,

I got the support from illumina, they have mapping files http://support.illumina.com/downloads/humancoreexome-12v1-0_product_files.html check that Auxiliary File, it has the details. Thanks for your support.

--Venkat

--
Regards

Venkat Addala 

Computational Biologist